Dietary manganese supplementation affects mammillary knobs of eggshell ultrastructure in laying hens

Dietary manganese supplementation affects mammillary knobs of eggshell ultrastructure in laying hens Y. N. Zhang, H. J. Zhang, S. G. Wu, J. Wang,1 and G. H. Qi1 Key Laboratory of Feed Biotechnology of Ministry of Agriculture, Feed Research Institute, Chinese Academy of Agricultural Sciences, Beijing 100081, China ABSTRACT This study evaluated the mechanism by which dietary manganese (Mn) supplementation—in either an organic or inorganic form—affects mammillary knobs of the eggshell ultrastructure in laying hens. A total of 225 54-week-old Hy-Line Brown laying hens were fed a basal diet containing 27.5 mg Mn/kg feed for 2 wk, after which they were randomly allocated into 3 groups and fed a basal diet (control) or a basal diet supplemented with 120 mg Mn/kg feed from monohydrate Mn sulfate (an inorganic source of Mn) or with 80 mg Mn/kg feed from an amino acid–Mn complex (an organic source of Mn) for 10 wk. For each group, 5 replicates of 15 hens each were used with 1 hen per cage. Compared with the control, dietary Mn supplementation increased the mammillary-knob density of eggs at 9.5 h post-oviposition (P < 0.05). The Mn content in both blood and eggshell gland was increased with the

supplementation of Mn in inorganic and organic forms (P < 0.05), but the blood Mn content was higher after inorganic-Mn supplementation as compared with organic-Mn supplementation (P < 0.05). RNA sequencing and quantitative real-time PCR analysis of the eggshell gland showed that dietary Mn supplementation increased the expression of genes encoding some proteoglycans, glycoproteins, and calcium-binding proteins in the eggshell gland (P < 0.05), and involved in the process of the protein glycosylation and glycan metabolism in the eggshell gland (P < 0.05). Overall, dietary Mn supplementation can involve in the process of protein glycosylation and glycan metabolism and improve the expression of genes encoding proteoglycans and glycoproteins in the eggshell gland, thus increasing the mammillary-knob density during the initial deposition stage of shell formation.

Key words: manganese, mammillary knob, mechanism, laying hen 2018 Poultry Science 0:1–10 http://dx.doi.org/10.3382/ps/pex419

INTRODUCTION

Despite strong evidence shows that there is a positive effect of Mn on shell mammillary knobs in laying hens (Leach and Gross, 1983; Xiao et al., 2014; Zhang et al., 2017a,b), the mechanism by which dietary Mn supplementation affects the mammillary knobs of shell ultrastructure in laying hens has not been elucidated. The eggshell is a natural composite bioceramic consisting of shell membrane, mammillary knob layer, palisade layer, vertical crystal layer, and cuticle (Arias et al., 1993). Several studies have reported the crucial effect of eggshell ultrastructure on its quality, i.e., the average size, shape, and orientation of calcite crystals (Ahmed et al., 2005) and the thickness and interstitial spaces in mammillary knobs and palisade calcite crystals (Radwan et al., 2010; Radwan, 2015; Fathi et al., 2016). There is a strong positive correlation between crystal size and orientation and the thickness of the mammillary knobs (Dunn et al., 2012). In addition, the mammillary knobs form the basement of palisade and vertical crystal layers of eggshells (Bain, 1992). Their size and density on shell membrane affect crystal fusion and compact columnar biomineral deposition in the palisade layer (Arias et al., 2001), and the speed at which the mammillary knobs coalesce regulates column

The avian eggshell is an essential part of the egg, as it provides physical protection and nutrients to the developing embryo and prevents microbial contamination of the egg contents; in addition, it reduces economic loss due to the breakage of eggshells in the egg industry (Nys et al., 2004). Currently, dietary manganese (Mn) is reported to be positively associated with the eggshell ´ atkiewicz et al., 2015; Xiao quality of laying hens (Swi  et al., 2015). Our previous studies have shown that dietary Mn supplementation increases eggshell breaking strength and thickness by improving its ultrastructure, mainly by decreasing the width and thickness of the shell mammillary knobs (Xiao et al., 2014; Zhang et al., 2017a). Moreover, we noted an increase in mammillary knob density, a decrease in the size and thickness of mammillary knobs, and an increase in palisade thickness during eggshell formation (Zhang et al., 2017b).  C 2018 Poultry Science Association Inc. Received September 4, 2017. Accepted December 1, 2017. 1 Corresponding authors: [email protected] (JW); qiguanghai@ caas.cn (GHQ)

1 Downloaded from https://academic.oup.com/ps/advance-article-abstract/doi/10.3382/ps/pex419/4818393 by Claude Moore Health Sciences Library user on 25 January 2018

2

ZHANG ET AL.

size in the palisade layer (Parsons, 1982). Therefore, the size, orientation, and thickness of the mammillary knobs affect multiple aspects of the shell structure and have a decisive effect on eggshell quality. The eggshell structure results from the sequential deposition of calcium carbonate and extracellular matrix during its formation (Fernandez et al., 1997), which is regulated by specialized oviduct cell populations that secrete specific macromolecules in an assembly-line sequence as the egg passes along the oviduct (Arias et al., 2001). These macromolecules include the matrix proteins, glycoproteins, and anionic side chains of proteoglycans (Fernandez et al., 2001), and they can influence the crystal growth by controlling the size, shape, and orientation of calcite crystals (Nys et al., 1999). The deposition of mammillary knobs is formed at the initial phase (5.5 to 10 h post-oviposition [PO]), during which crystal aggregation and spherulitic crystal growth of calcite are initiated on the surface at nucleation sites (Nys et al., 2004). During the initial phase, the keratan and dermatan sulfate proteoglycans secreted by lining epithelial cells of the red isthmus and uterus have an affinity for calcium and affect the nucleation and growth of the eggshell calcite crystals (Arias et al., 2001); keratan sulfate proteoglycan is more prevalent in the mammillary knobs as compared with the palisade layer (Arias et al., 1992; 2001). Therefore, the organic matrix, especially sulfate proteoglycans in the eggshell gland, during the initial phase of shell formation may affect the formation of the mammillary knobs. Thus, the current study was to examine the effects of dietary Mn supplementation on the mammillary-knob density of eggs at 9.5 PO, which corresponds to the formation of mammillary knobs during the initial stage. We then performed RNA sequencing (RNA-Seq) analysis of the eggshell gland at this stage to identify genes and pathways that underlie the changes in mammillary knobs induced by Mn supplementation in laying hens and confirmed the results by quantitative realtime polymerase chain reaction (PCR) analysis. Besides, our previous studies showed the supplementation with 120 mg Mn/kg feed from monohydrate Mn sulfate or 80 mg Mn/kg feed from amino acid–Mn complex (when included in a corn-soybean basal diet containing 32.7 mg Mn/kg feed (analyzed value, and calculated value is 29.3 mg/kg)) was almost equally optimal (Zhang et al., 2017a), and there were no differences in breaking strength and thickness of eggshells between the two supplements (Zhang et al., 2017a,b). Therefore, we explored the mechanism of Mn supplementation on shell mammillary knobs in laying hens by using the optimal levels of organic and inorganic Mn.

MATERIALS AND METHODS Birds, Diets, and Sample Collection A total of 225 54-week-old Hy-Line Brown laying hens were fed a basal diet containing 27.5 mg

Table 1. Dietary composition and nutrient levels of the basal diet. Ingredient Corn Soybean meal Limestone Salt d,l-Methionine Dicalcium phosphate Premix1 50% choline chloride Total

%

Nutrient

62.91 24.40 10.00 0.30 0.10 1.50 0.64 0.15 100.00

AME (MJ/kg) Crude protein (%) Calcium (%) Methionine (%) Lysine (%) Total phosphorus (%) Available phosphorus (%) Methionine + cysteine (%) Manganese (mg/kg feed)

10.75 15.70 3.80 0.34 0.80 0.56 0.32 0.67 29.3 (27.5)2

1 Provided per kilogram feed: VA, 12,500 IU; VD3 , 4,125 IU; VE, 15 IU; VK, 2 mg; thiamine, 1 mg; riboflavin, 8.5 mg; calcium pantothenate 50 mg; niacin 32.5 mg; pyridoxine 8 mg; biotin, 2 mg; folic acid, 5 mg; VB12 , 5 mg; Zn, 66 mg; I, 1 mg; Fe, 60 mg; Cu, 8 mg; Se, 0.3 mg. 2 The number in parentheses is the measured value.

Table 2. Mn concentrations of 3 experimental diets (mg Mn/kg feed). Treatment Control (basal diet) Inorganic Mn1 Organic Mn2

Dietary Mn supplementation

Calculated total

Measured total

0 120 80

29.3 149.3 109.3

27.5 140.8 114.5

1

Manganese sulfate monohydrate. Amino acid–Mn complex. The amounts of Mn, lysine, and methionine in the amino acid–Mn complex were measured and accounted for 8.78, 1.04, and 0.08% of the total weight, respectively. The chelation quotient for the amino acid–Mn complex is 113.7. 2

Mn/kg feed (analyzed value, and calculated value is 29.3 mg/kg) for 2 wk and then were randomly allocated into 3 groups that were fed a basal diet (control), or a basal diet supplemented with 120 mg Mn/kg feed from monohydrate Mn sulfate (31.8% [wt/wt] Mn; Jiangxi Chunjiang Technology Co., Ltd., Yichun, Jiangxi, China) or 80 mg Mn/kg feed from an amino acid–Mn complex (8.78% [wt/wt] Mn; Availa-Mn, Zinpro Animal Nutrition Inc., Eden Prairie, MN) for 10 wk. Each dietary treatment had 5 replicates of 15 hens with 1 hen per cage. The time of oviposition was recorded daily with an automatic-monitoring control system (FRI, CAAS, Beijing, China). The composition and nutrient levels of the formulated corn-soybean meal basal diet are listed in Table 1, with the Mn concentrations of the 3 diets shown in Table 2. At the end of the trial, 2 birds from each replicate were sacrificed by cervical dislocation at 9.5 h PO to coincide with mammillary knob deposition. Blood samples (∼2 mL) were immediately collected in heparinized centrifuge tubes during bleeding from the jugular vein and then were kept at –20◦ C until analysis. Eggs were taken from those hens to measure the mammillary knob density of their eggshells. The eggshell glands surrounding the eggs were immediately removed, placed on ice, cut open, and washed with PBS to minimize contamination. Then a small part of the eggshell gland (∼0.08 g) was put into a tube containing RNA-free fluid (∼1 mL, Tiangen Biotech Co., Ltd., Beijing, China), the other

Downloaded from https://academic.oup.com/ps/advance-article-abstract/doi/10.3382/ps/pex419/4818393 by Claude Moore Health Sciences Library user on 25 January 2018

3

MANGANESE & EGGSHELL ULTRASTRUCTURE Table 3. Primer sequence of target and reference genes. Gene SYT15 FMOD THBS2 MGAT5 KCNA1 COL12A1 ACTB

Primer sequence (5 –3 ) Forward: GCATCCGAAAGGCTCCTCAT Reverse: GCATCTTTCATCAGGCAGCAG Forward: GGATGAGAACAGCCCCTACG Reverse: ATGGCTGACGAGAAGTTGGG Forward: TGTATGTGGCGAAAGGGTCC Reverse: TGATTGGCTCCTCTGGCATC Forward: GATGGGTCCACATGCTCCTT Reverse: GGTATCAGCCATTCGTCGGA Forward: TGCGGTACTTCGACCCTTTG Reverse: GCTGGTATTCTCCCTCTGGC Forward: GGATTGAGCAGGAACTGGCT Reverse: TCATCTCCGCCGATTGCTAC Forward: AATGGCTCCGGTATGTGCAA Reverse: GGCCCATACCAACCATCACA

part was put into another tube to measure the Mn content; all samples were frozen in liquid nitrogen immediately and then kept at –80◦ C until analysis. Each treatment had 5 replicates of 2 eggs each.

Fragment size (bp)

Annealing temperature (◦ C)

108

60

138

60

125

60

210

60

243

60

166

60

112

60

complex were first smashed into powder and then digested and measured as the same as the Mn content in blood and eggshell gland.

Transcriptomic Profiling Determination of Mammillary Knob Density At the end of the trial, calcified eggshells obtained from the resulting eggs were sampled to assess the density of their mammillary knobs by scanning electron microscopy (FEI Quanta 600; Thermo Fisher Scientific Ltd., Portland, OR). Before imaging, both the inside and outside of calcified eggshells were washed with distilled water to remove dirt, and then were dried overnight. Then samples were first mounted onto copper blocks and then coated with gold powder. Each treatment had 5 replicates with 2 eggs each, and for each egg 6 samples were examined from the sharp, equatorial, and blunt areas of the eggs (i.e., 2 samples per area), with 3 images taken for each sample.

Measurement of Mn Content in Blood and Eggshell Gland The blood samples were melted in a warm water bath (37◦ C) for 2 h, and the eggshell gland samples were freeze-dried using a lyophilizer (LJG-12; Beijing Songyuanhuaxing Technology Develop Co., Ltd., Beijing, China) for 72 h. Then all samples were dissolved in 3 mL nitric acid and 3 mL H2 O2 , incubated at room temperature for 2 h, and then digested in a microwave digestion instrument (MDS-10; Shanghai Xinyi Instrument Technology Co., Ltd., Shanghai, China). The digestion procedure of samples was shown as below: 130◦ C last for 10 min, then 150◦ C for another 5 min, and 180◦ C for another 20 min. Then the fluid was transferred into the conical flask and eliminated most of the acid (90%) with heat, and diluted to 50 mL with doubledistilled water. The amounts of Mn in the blood and eggshell gland samples were determined using inductively coupled plasma/mass spectrometry (Agilent 7700 series ICP/MS; Agilent Technologies Inc., Alpharetta, GA). The amounts of Mn in diets and amino acid–Mn

At the end of the trial, eggshell gland samples were isolated from hens to measure the genes and pathways involved in shell mammillary knob formation that were affected by dietary Mn supplementation. Total RNA was isolated from eggshell gland samples with Trizol (Invitrogen, Carlsbad, CA). The quality and concentration of total RNA were measured by 1.0% agarose gel electrophoresis and spectrophotometric analysis (NanoDrop 8000 spectrophotometer; NanoDrop Technologies, Wilmington, DE). RNA library construction and sequencing were performed at Shanghai Personal Biotechnology Co., Ltd. (Shanghai, China). The cDNA libraries were constructed following the TruSeq RNA Sample Preparation Guide (Illumina, San Diego, CA). Poly(A) mRNA was isolated from purified total RNA using biotin-oligo(dT) magnetic beads and was fragmented to generate average insert sizes of ∼350 bp before creating the cDNA libraries. Quality control was conducted using PicoGreen fluorescence spectrophotometry and an Agilent Bioanalyzer (Agilent Technologies, Palo Alto, CA). A cluster was generated, diluted to 4–5 pM, and sequenced using the Illumina NextSeq 500 System with paired-end 2 × 150-bp reads. Two eggshell gland samples from each replicate were mixed as a sample, and then each treatment had 5 replicate samples.

Quantitative Real-Time Polymerase Chain Reaction Analysis To confirm the reproducibility and accuracy of the RNA-Seq gene expression data obtained from the chicken eggshell gland libraries, quantitative real-time PCR was carried out on the 7 selected shared genes. The PCR primers used in this study are listed in Table 3. Quantitative real-time PCR was performed using the ABI Step-One Plus Real-Time PCR system

Downloaded from https://academic.oup.com/ps/advance-article-abstract/doi/10.3382/ps/pex419/4818393 by Claude Moore Health Sciences Library user on 25 January 2018

4

ZHANG ET AL.

Figure 1. (A, B, C) Scanning electron microscope images of the eggshell mammillary knobs at 9.5 PO for laying hens in Control (A), IM (B), and OM (C) groups. Scale bar: 300 μ m; width × height: 750 μ m × 635 μ m. (D) The effect of dietary Mn supplementation on mammillary knob density. (E) The effect of dietary Mn supplementation on Mn content in blood. (F) The effect of dietary Mn supplementation on Mn content in eggshell gland. Control, basal diet; IM, inorganic Mn; OM, organic Mn. Data are shown as the mean ± SE from 5 replicates per treatment (2 eggs per replicate). a–c Means ± SE within a row with differing superscripts differ significantly (P < 0.05).

(ABI 2700; Applied Biosystems, Foster City, CA). The relative gene expression levels were normalized to the endogenous RNA control actin beta (ACTB) in Gallus gallus (chicken) with the 2−ΔΔCT method (Livak and Schmittgen, 2001).

Statistical Analysis Raw RNA-Seq data were preprocessed, assembled, and then filtered by standard quality control criteria. The corresponding sequence reads were mapped to the chicken genome in Ensembl using Bowtie2/Tophat2 (http://tophat.cbcb.umd.edu), and the reads of each gene were normalized by using the reads per kilobase per million mapped reads (RPKM) method. The significance was determined by normalizing the raw reads and calculating the P-value by using DESeq (http://bioconductor.org/packages/release/bioc/html/ DESeq.html). Genes with fold changes log2 (RPKM (Mn Treated/Control)) > 2 and P-value < 0.05 were identified as differentially expressed genes (DEGs). We used “Historical Event Markup and Linking” software to generate heat maps for the relevant genes associated with eggshell formation. These genes were further compared between the control and the inorganic-Mn or organic-Mn treatment using independent-sample t-tests. The corresponding fold change was also

calculated. Differences were considered statistically significant at P < 0.05. All other data were first tested for normality and homogeneity of their variances and then were analyzed with an ANOVA followed by Tukey’s multiple comparison test when appropriate using SPSS 16.0 for Windows (SPSS Inc., Chicago, IL). A P-value ≤ 0.05 was considered significant. Data are expressed as the mean ± SE.

RESULTS Dietary Mn Supplementation Improves Mammillary Knob Density and Mn Content in Blood and Eggshell Gland Scanning electron microscopy images of mammillary knobs of calcified eggshells at 9.5 h PO are shown in Figure 1 (A–C). Compared with the control, dietary Mn supplementation increased the mammillary-knob density at 9.5 h PO (P < 0.05; Figure 1D). The Mn levels in blood and eggshell gland were both increased with the supplementation of Mn in inorganic and organic forms (P < 0.05; Figure 1E, F), but the blood Mn content was higher with inorganic-Mn treatment as compared with organic-Mn treatment (P < 0.05).

Downloaded from https://academic.oup.com/ps/advance-article-abstract/doi/10.3382/ps/pex419/4818393 by Claude Moore Health Sciences Library user on 25 January 2018

MANGANESE & EGGSHELL ULTRASTRUCTURE

5

Figure 2. (A) Number of differentially expressed genes (DEGs) between control and Mn-added treatments in inorganic and organic forms (5 replicates per groups). (B) Venn diagrams showing 21 shared DEGs induced by the Mn supplementation. (C) Fold change analysis showing expression patterns of the 14 shared DEGs. Fold changes were determined by comparing the change in gene expression (reads per kilobase per million mapped reads, RPKM) of hens receiving supplemental Mn relative to control hens and were log2 transformed. (D) Heatmaps of expression data generated from the read counts of glycan biosynthesis and metabolism and the organic matrix in eggshell gland along with fold change analysis with Mn supplementation in both inorganic and organic forms. Each column in the heatmap represents an individual replicate. The RPKM values were log10 transformed, and the fold changes were log2 transformed. Control, basal diet; IM, inorganic Mn; OM, organic Mn. ∗P < 0.05, ∗∗P < 0.01, ∗∗∗P < 0.001.

Dietary Mn Supplementation Affects Protein Glycosylation and Glycan Metabolism and Increases Expression of Genes Encoding Proteoglycans, Glycoproteins, and Calcium-Binding Proteins in Eggshell Gland To identify the genes and pathways involved in changes in mammillary-knob density with dietary Mn supplementation, we investigated the gene expression profile in chicken eggshell gland using RNA-Seq. A total of ∼14,630 genes were detected by RNA-Seq analysis. Differentially expressed genes (DEGs) were initially identified by the combined cut-offs of P < 0.05 and fold change >2. Overall, 545 DEGs were identified between the control and inorganic-Mn treatments, with

508 up-regulated genes and 37 down-regulated genes (Figure 2A). Between the control hens and the hens that had received organic Mn, there were 71 DEGs with 55 up-regulated genes and 16 down-regulated genes (Figure 2A). To increase our understanding of the biological processes, molecular functions, and cellular components in eggshell gland that are regulated by dietary Mn during the formation of mammillary knobs, we analyzed the DEGs with respect to enrichment in gene ontology (GO) terms. The GO terms enrichment analysis showed that the DEGs between the control and inorganic-Mn group were significantly enriched in biological processes, cellular components, and molecular functions (P < 0.05; Figure 3A), whereas the DEGs

Downloaded from https://academic.oup.com/ps/advance-article-abstract/doi/10.3382/ps/pex419/4818393 by Claude Moore Health Sciences Library user on 25 January 2018

6

ZHANG ET AL.

Figure 3. The enrichment of differentially expressed genes (DEGs) in gene ontology (GO) terms. (A) GO terms enrichment analysis of DEGs between the control and inorganic-Mn group. (B) GO terms enrichment analysis of DEGs between the control and organic-Mn group. ∗P < 0.05, ∗∗P < 0.01, ∗∗∗P < 0.001.

between the control and organic-Mn group were enriched only in biological processes and cellular components (P < 0.05; Figure 3B). Taken together, the DEGs between the control and Mn-added treatments were both enriched in cellular components, especially the proteinaceous extracellular matrix, extracellular space, extracellular region, and cellular component (P < 0.05). We first focused our investigation on the 21 shared genes that were differentially expressed between the control and the Mn-added treatments in both inorganic and organic forms (Figure 2B). Of the 21 joint transcripts, all genes exhibited the same patterns of expression with 18 genes up-regulated and 3 genes downregulated, which is shown in Figure 2C (except for 7 unknown genes). Among them, an up-regulated gene that encodes alpha-1,6-mannosylglycoprotein 6-betaN-acetylglucosaminyltransferase A (MGAT5) was observed with Mn supplementation in laying hens. Furthermore, dietary Mn supplementation increased the

mRNA levels of genes that encode some of the proteoglycans and glycoproteins in the eggshell gland, such as fibromodulin (FMOD), thrombospondin 2 (THBS2, also known as TSP2), collagen type XII alpha 1 chain (COL12A1), and cadherin 6 (CDH6). Dietary Mn supplementation also led to an increase in the expression of some genes that encode calcium-binding proteins in addition to THBS2, such as synaptotagmin 15 (SYT15) and potassium voltage-gated channel subfamily A member 1 (KCNA1) in the eggshell gland. Moreover, dietary Mn supplementation significantly increased expression of six genes of the joint transcripts mentioned above, except for no significant difference in gene CDH6 (data not shown), based on quantitative real-time PCR validation (Figure 4). As dietary Mn supplementation increased the gene expression of some proteoglycans and glycoproteins in the eggshell gland in this study and as the content of sulfated proteoglycans or uronic acid in the eggshell is

Downloaded from https://academic.oup.com/ps/advance-article-abstract/doi/10.3382/ps/pex419/4818393 by Claude Moore Health Sciences Library user on 25 January 2018

MANGANESE & EGGSHELL ULTRASTRUCTURE

7

Figure 4. Expression of the 6 genes in eggshell gland that were selected for validation of RNA-Seq data by using quantitative real-time PCR analysis. (A, B, C, D, E, F) The 6 genes include MGAT5 (A), SYT15 (B), THBS2 (C), FMOD (D), CLO12A1 (E), and KCNA1 (F). The relative gene expression levels were normalized to the RNA control actin beta (ACTB) in Gallus gallus (chicken). Data are presented as the mean ± SE from 5 replicates per treatment. a–c Means ± SE within a row with differing superscripts differ significantly (P < 0.05).

increased with Mn supplementation (Xiao et al., 2014; Zhang et al., 2017a), we further investigated the effect of dietary Mn supplementation on the process of glycan biosynthesis and metabolism in the eggshell gland. In fact, dietary inorganic-Mn supplementation significantly involved in the process of protein glycosylation and glycan metabolism in the eggshell gland based on gene expression data (Figure 2D). The mRNA levels of genes encoding N-acetylglucosaminyltransferase 3 (GCNT3, also known as C2GnT-M), polypeptide N-acetylgalactosaminyltransferase 2 (GALNT2, also known as GalNAc-T2), and N-acetylgalactosaminyltransferase 18 (GALNT18, also known as GalNAc-T18) were increased with inorganic-Mn supplementation (P < 0.05). In addition to MGAT5 mentioned above, the expression of another protein ribophorin II (RPN2) and UDPglucose: glycoprotein glucosyltransferase 1 (UGGT1) were increased after inorganic-Mn supplementation (P < 0.05). Furthermore, in addition to an increased mRNA level for FMOD in the eggshell gland, N-deacetylase/N-sulfotransferase (NDST3) also showed increase mRNA expression after inorganic-Mn treatment (P < 0.05). Supplementation with inorganic Mn also increased the expression of the genes that encode lactosylceramide alpha-2,3-sialyltransferase (SIAT9 also known as ST3Gal5) and phosphatidylinositol glycan anchor biosynthesis class G (PIGG) (P < 0.05). Dietary organic-Mn supplementation also involved in the process of protein glycosylation and glycan metabolism in the eggshell gland, although not to the same extent as inorganic-Mn supplementation.

Expression of GCNT3, GALNT2, UGGT1, NDST3, and PIGG in eggshell gland was also increased after organic-Mn treatment as compared with the control (P < 0.05), but the fold changes were < 2 (Figure 2D).

DISCUSSION In the current study, the mammillary-knob density of eggshell during their initial stage of shell formation increased with Mn supplementation in laying hens, which was consistent with our previous results (Zhang et al., 2017b). The increased density of mammillary knobs indicates that the calcite crystals in later formation are smaller in size and can be more closely spaced. Similarly, the mammillary knob width of whole eggshells decreased with dietary Mn supplementation in studies by Xiao et al. (2014) and Zhang et al. (2017a). The kinetics of calcium carbonate precipitation and the morphology of calcite crystals are modified by the organic matrix in uterine fluid (Gautron et al., 1997; Nys et al., 1999), and dietary Mn supplementation improves shell ultrastructure by modulating the sulfated proteoglycan content in membranes and the calcified eggshell (Xiao et al., 2014; Zhang et al., 2017a). In addition, our current study showed that dietary Mn supplementation involved in the process of protein glycosylation and glycan metabolism, and increased the expression of genes encoding proteoglycans and glycoproteins in the eggshell gland during the initial deposition stage. Moreover, the proteoglycans and proteins in organic matrix control the crystal morphology and growth, and affect the formation of eggshell ultrastructure

Downloaded from https://academic.oup.com/ps/advance-article-abstract/doi/10.3382/ps/pex419/4818393 by Claude Moore Health Sciences Library user on 25 January 2018

8

ZHANG ET AL.

(Nys et al., 2004). Furthermore, it is reported that the putative role of keratan sulfate proteoglycan is in the nucleation of the first calcite crystals, and the dermatan sulfate proteoglycan is to regulate the growth and orientation of the later forming crystals of the chicken eggshell (Fernandez et al., 2001). In this respect, the increase in mammillary knob density with Mn supplementation in the current study is most likely due to the changes of proteoglycans and glycoproteins in the eggshell gland. The high ordered and mineralized structure of eggshell in hens result from the deposition of inorganic minerals and organic matrix in the uterine fluid (Fernandez et al., 2001), which is secreted by the ciliated and non-ciliated epithelium and tubular gland cells of eggshell gland (Chousalkar and Roberts, 2008). Mammillary knobs consist of the calcium reserve and crown region (Dieckert et al., 1989), and the fusion of mammillary knobs is regulated through the deposition of additional calcite crystals in the inter-mammillary spaces, which affects the size and density of mammillary knobs (Gautron et al., 1997). Meanwhile, the density of nucleation sites on the membrane may also affect the density of mammillary knobs, as they grow at the existing nucleation sites (Nys et al., 2004). Furthermore, the nucleation sites and calcite crystal deposition that involve in mammillary knob formation are modulated by the organic matrix in the eggshell gland (Fernandez et al., 1997). Keratin sulfate proteoglycan is mainly involved in the nucleation of the first randomly oriented crystals of the mammillary layer (Arias et al., 1992). The increase in mammillary knob density with dietary Mn supplementation that we observed indicates that the keratin sulfate proteoglycan content may be increased in the eggshell. In fact, Mn supplementation increased the gene expression of FMOD and NDST3 in the eggshell gland. NDST3 is an essential bifunctional enzyme that catalyzes both the N-deacetylation and the N-sulfation of glucosamine of glycosaminoglycan (Sugahara and Kitagawa, 2002), which is an essential part of proteoglycan (Esko et al., 2009). FMOD is a member of the family of small leucine-rich proteoglycans that are important for extracellular matrix organization and tissue repair in multiple organs (Ameye et al., 2002). Proteoglycans are macromolecules consisting of a protein core covalently bound to one or more glycosaminoglycan side chains (Kjellen and Lindahl, 1991), and the core protein of FMOD has an attached N-linked keratan sulfate chain (Lauder et al., 1997). The increased gene expression of FMOD and NDST3 implies that the proteoglycans formation in eggshell gland may be affected by dietary Mn supplementation in laying hens. This is consistent with our earlier result that dietary Mn supplementation improves shell structure by increasing the sulfated proteoglycan content in the eggshell (Zhang et al., 2017a). In addition, THBS2 is a multidomain, calcium-binding extracellular glycoprotein of animals that can support cell attachment in a calcium-dependent manner and

bind to other glycoproteins and proteoglycans (Adams and Lawler, 2004). COL12A1 is a component of proteinaceous extracellular matrix, which consists mainly of proteins (especially collagen) and glycosaminoglycans (mostly as proteoglycans) and forms a sheet underlying or overlying cells such as endothelial and epithelial cells (Sugrue et al., 1989). CDH6 is a singlepass transmembrane glycoprotein that can interact selectively and non-covalently with calcium ions (Ca2+ ) and mediate calcium-dependent cell−cell adhesion by homophilic interactions (Koch et al., 1997). MGAT5 and RPN2 play crucial roles in N-glycan biosynthesis (Hirabayashi et al. 2002; Mohorko et al., 2011), and MGAT5 can sequentially add glucosamine branches to form N-linked glycans (Hirabayashi et al., 2002). Whereas, GCNT3, GALNT2 and GALNT18 play vital roles in O-glycan biosynthesis (Fritz et al., 2006; Raman et al., 2012), Furthermore, UGGT1 can recognize glycoproteins with minor folding defects and provides quality control for protein folding in the endoplasmic reticulum (Moremen et al., 2012). The SIAT9 and PIGG function in the biosynthesis of glycosphingolipid and glycosyl phosphatidylinositol, respectively (Takeda and Kinoshita, 1995; Saito and Ishii, 2002). Considering the genes mentioned above, we can see that Mn supplementation play roles in the process of protein glycosylation and increases the expression of genes that encode some of the glycoproteins in the eggshell gland, which is primarily due to the role of Mn as a cofactor for enzymes such as UGGT1, GALNT2, and GALNT18 (Arnold et al., 2000; Fritz et al., 2006). Furthermore, THBS2 contains a calcium-rich signature domain, and the large number of bound Ca2+ molecules and the Ca2+ -dependent conformational changes in its structure suggest that THBS2 may act as both a buffer and sensor of the Ca2+ concentration in solution (Carlson et al., 2005). SYT15 is a highly conserved synaptic vesicle protein that can bind calcium at physiological concentrations and acts as a cooperative calcium receptor during exocytosis (Brose et al., 1992). The potassium voltage-gated channels (KCNs) are the prototypical members of a family of membrane signaling proteins, of which its subfamily A member 1 (KCNA1) affects Ca2+ homeostasis in motor axons (Brunetti et al., 2012). The increased mRNA levels of THBS2, SYT15, and KCNA1 in Mn-added treatments suggest that dietary Mn supplementation increases the expression of genes that encode some calcium-binding proteins, which may also help to modulate mammillary knob formation in the eggshell gland, as the organic matrix in the uterine fluid has calcium affinity and modulates crystal deposition in the eggshell (Nys et al., 1999). In the current study, compared with the Mn supplemented groups, the hens in control group decreased the mammillary knob density and gene expression of some glycoproteins and proteoglycans. It indicates that dietary Mn deficiency may affect the content of proteoglycans and glycoproteins in eggshell gland and modulate the formation of mammillary knobs. Moreover,

Downloaded from https://academic.oup.com/ps/advance-article-abstract/doi/10.3382/ps/pex419/4818393 by Claude Moore Health Sciences Library user on 25 January 2018

MANGANESE & EGGSHELL ULTRASTRUCTURE

Mn-deficient hens have a reduced hexosamine content in the shell matrix and produce thin, rough, and translucent shells (Longstaff and Hill, 1972). Dietary Mn deficiency also changes the shell ultrastructure, particularly with respect to large irregular mammillary knobs, an effect that is mainly related to decreased hexosamine and hexuronic acid content in the eggshell (Leach and Gross, 1983). On the other hand, dietary Mn supplementation can affect the ultrastructure of eggshells by enhancing the sulfate glycosaminoglycans or uronic acid synthesis in the eggshell glands (Xiao et al., 2014; Zhang et al., 2017a). Considering the studies mentioned above and the observed results from our current study, dietary Mn supplementation, in both inorganic and organic forms, can involve in the process of protein glycosylation and glycan metabolism and can increase the mRNA levels of some proteoglycans and glycoproteins in the eggshell gland. These changes may provide a mechanism for the improvement of mammillary-knob density that results from Mn supplementation in diets of laying hens. Manganese can function as both an enzyme activator and a constituent of metalloenzymes involved in the glycosylation of proteins. It is a vital element for bone growth, carbohydrate and lipid metabolism, immune and nervous system function, and reproduction (Schramm, 2012), some of which were also affected by Mn supplementation in the current study according to the RNA-Seq analysis of eggshell glands (data not shown). It is interesting to note that there are more DEGs between the control and inorganic-Mn group relative to those between the control and organic-Mn group in the current study, and dietary inorganic-Mn supplementation more significantly involved in the process of protein glycosylation and glycan metabolism in the eggshell gland relative to supplementation with organic Mn. It is partly due to the higher supplemental Mn level in the inorganic group relative to the organic group (120 vs. 80 mg/kg, respectively), as we also observed higher blood Mn content in hens supplemented with inorganic Mn as compared with those from the organic-Mn group (Figure 1). However, the speculation need to be studied further. Anyway, from the results obtained in the current study, dietary Mn supplementation can involve in the process of protein glycosylation and glycan metabolism in the eggshell gland. The levels of Mn in blood and eggshell gland were increased with Mn supplementation in the current study, which is consistent with findings that additional supplemented Mn in the diet can be absorbed into the blood and deposited in tissues (Xie et al., 2014). In addition, Berta et al. (2004) reported that Mn content in the liver and tibia was improved with increasing supplemental Mn in the diet. In this respect, the higher supplemented Mn level in the diet is possibly responsible for the higher blood Mn content in the inorganic group (120 mg/kg supplementation) as compared with the organic group (80 mg/kg supplementation) in the current study. However, there was no significant

9

difference in Mn content in the eggshell gland between the inorganic-Mn and organic-Mn treatments, which indicated the Mn deposition in the eggshell gland was more effective in the organic group (80 mg/kg supplementation) relative to the inorganic group (120 mg/kg supplementation) in the current study. The effects of dietary inorganic and organic Mn supplementation on Mn content in blood and eggshell gland are different in the current study, which is also observed in the growing broiler chickens that the results of dietary Mn supplementation on Mn content in plasma and liver show different changes (Conly et al., 2012). Ultimately, the increased Mn content in blood and eggshell gland with Mn supplementation also suggests that the changes in mammillary knob density in our study were a result of the changes in Mn content in laying hens. In conclusion, dietary Mn supplementation can involve in the process of protein glycosylation and glycan metabolism and increase the expression of genes that encode proteoglycans and glycoproteins in eggshell gland, thus improving the mammillary-knob density during the initial deposition stage of shell formation.

ACKNOWLEDGMENTS This study was supported by the National Natural Science Foundation of China (31572426), the earmarked fund for Modern Agro-industry Technology Research System (CARS-40-K12), the China Agriculture Research System-Beijing Team for Poultry Industry, and the Agricultural Science and Technology Innovation Program (ASTIP).

REFERENCES Adams, J. C., and J. Lawler. 2004. Thrombospondins. Int. J. Biochem. Cell Biol. 36:961–968. Ahmed, A. M. H., A. Rodriguez, M. L. Vidal, J. Gautron, J. GarciaRuiz, and Y. Nys. 2005. Changes in eggshell mechanical properties, crystallographic texture and in matrix proteins induced by moult in hens. Br. Poult. Sci. 46:268–279. Ameye, L., D. Aria, K. Jepsen, A. Oldberg, T. Xu, and M. F. Young. 2002. Abnormal collagen fibrils in tendons of biglycan/fibromodulin-deficient mice lead to gait impairment, ectopic ossification, and osteoarthritis. FASEB J. 16:673– 680. Arias, J. I., C. Jure, J. P. Wiff, M. S. Fernandez, V. Fuenzalida, and J. L. Arias. 2001. Effect of sulfate content of biomacromolecules on the crystallization of calcium carbonate. Mat. Res. Soc. 711:243–248. Arias, J. L., D. A. Carrino, M. S. Fern´ andez, J. P. Rodriguez, J. E. Dennis, and A. I. Caplan. 1992. Partial biochemical and immunochemical characterization of avian eggshell extracellular matrices. Arch. Biochem. Biophy. 298:293–302. Arias, J. L., D. J. Fink, S. Q. Xiao, A. H. Heuer, and A. I. Caplan. 1993. Biomineralization and eggshells: cell-mediated acellular compartments of mineralized extracellular matrix. Int. Rev. Cytol. 145:217–250. Arnold, S. M., L. I. Fessler, J. H. Fessler, and J. K. Randal. 2000. Two homologues encoding human UDP-glucose: glycoprotein glucosyltransferase differs in mRNA expression and enzymatic activity. Biochemistry. 39:2149–2163. Bain, M. M. 1992. Eggshell strength: A relationship between the mechanism of failure and the ultrastructural organisation of the mammillary layer. Br. Poult. Sci. 33:303–319.

Downloaded from https://academic.oup.com/ps/advance-article-abstract/doi/10.3382/ps/pex419/4818393 by Claude Moore Health Sciences Library user on 25 January 2018

10

ZHANG ET AL.

Berta, E., E. Andr´ asofszky, A. Bersenyi, R. Glavits, A. Gaspardy, and S. G. Fekete. 2004. Effect of inorganic and organic manganese supplementation on the performance and tissue manganese content of broiler chicks. Acta Vet. Hung. 52:199–209. Brose, N., R. Jahn, N Brose, A. G Petrenko, T. C S¨ udhof, and R. Jahn. 1992. Synaptotagmin: a calcium sensor on the synaptic vesicle surface. Science. 256:1021–1025. Brunetti, O., P. Imbrici, F. M. Botti, V. E. Pettorossi, M. C. D’Adamo, M. Valentino, C. Zammit, M. Mora, S. Gibertini, and G. D. Giovanni. 2012. Kv1. 1 knock-in ataxic mice exhibit spontaneous myokymic activity exacerbated by fatigue, ischemia and low temperature. Neurobiol. Dis. 47:310–321. Carlson, C. B., D. A. Bernstein, D. S. Annis, M. M. Tina, A. H. Blue-leaf, F. M. Deane, and L. K. James. 2005. Structure of the calcium-rich signature domain of human thrombospondin-2. Nat. Struct. Mol. Biol. 12:910–914. Chousalkar, K. K., and J. R. Roberts. 2008. Ultrastructural changes in the oviduct of the laying hen during the laying cycle. Cell Tissue Res. 332:349–358. Conly, A. K., R. Poureslami, E. A. Koutsos, A. B. Batal, B. Jung, R. Beckstead, and D. G. Peterson. 2012. Tolerance and efficacy of tribasic manganese chloride in growing broiler chickens. Poult. Sci. 91:1633–1640. Dieckert, J. W., M. C. Dieckert, and C. R. Creger. 1989. Calcium reserve assembly: a basic structural unit of the calcium reserve system of the hen egg shell. Poult. Sci. 68:1569–1584. Dunn, I. C., A. B. Rodr´ıguez-Navarro, K. Mcdade, M. Schmutz, R. Preisinger, D. Waddington, P. W. Wilson, and M. Bain. 2012. Genetic variation in eggshell crystal size and orientation is large and these traits are correlated with shell thickness and are associated with eggshell matrix protein markers. Anim. Genet. 43:410–418. Esko, J. D., K. Kimata, and U. Lindahi. 2009. Proteoglycans and sulfated glycosaminoglycans. Essentials of Glycobiology. 2nd edition. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY. Fathi, M. M., A. E. El-Dlebshany, M. Bachine El-Deen, L. M. Radwan, and G. N. Rayan. 2016. Effect of long-term selection for egg production on eggshell quality of Japanese quail (Coturnix japonica). Poult. Sci. 95:2570–2575. Fernandez, M. S., A. Moya, L. Lopez, and J. L. Arias. 2001. Secretion pattern, ultrastructural localization and function of extracellular matrix molecules involved in eggshell formation. Matrix Biol. 19:793–803. Fernandez, M. S., M. Araya, and J. L. Arias. 1997. Eggshells are shaped by a precise spatio-temporal arrangement of sequentially deposited macromolecules. Matrix Biol. 16:13–20. Fritz, T. A., J. Raman, and L. A. Tabak. 2006. Dynamic association between the catalytic and lectin domains of human UDPGalNAc: polypeptide alpha-N-acetylgalactosaminyltransferase-2. J. Biol. Chem. 281:8613–8619. Gautron, J., M. T. Hincke., and Y. Nys. 1997. Precursor matrix proteins in the uterine fluid change with stages of eggshell formation in hens. Connect. Tissue Res. 36:195–210. Hirabayashi, J., T. Hashidate, Y. Arata, N. Nishi, T. Nakamura, M. Hirashima, T. Urashima, T. Oka, M. Futai, and W. E. Muller. 2002. Oligosaccharide specificity of galectins: a search by frontal affinity chromatography. BBA-Gen. Subjects. 1572:232–254. Kjellen, L., and U. Lindahl. 1991. Proteoglycans: structures and interactions. Annu. Rev. Biochem. 60:443–475. Koch, A. W., S. Pokutta, A. Lustig, and J. Engel. 1997. Calcium binding and homoassociation of E-cadherin domains. Biochemistry. 36:7697–7705. Lauder, R. M., T. N. Huckerby, and I. A. Nieduszynski. 1997. The structure of the keratan sulphate chains attached to fibromodulin from human articular cartilage. Glycoconjugate J. 14:651–660. Leach, R. M., and J. R. Gross. 1983. The effect of manganese deficiency upon the ultrastructure of the eggshell. Poult. Sci. 62:499– 504.

Livak, K. J., and T. D. Schmittgen. 2001. Analysis of relative gene expression data using real-time quantitative PCR and the 2−ΔΔCT method. Methods. 25:402–408. Longstaff, M., and R. Hill. 1972. The hexosamine and uronic acid contents of the matrix of shells of eggs from pullets fed on diets of different manganese content. Br. Poult. Sci. 13:377–385. Mohorko, E., R. Glockshuber, and M. Aebi. 2011. Oligosaccharyltransferase: the central enzyme of N-linked protein glycosylation. J. Inherit. Metab. Dis. 34:869–878. Moremen, K. W., M. Tiemeyer, and A. V. Nairn. 2012. Vertebrate protein glycosylation: diversity, synthesis and function. Nat. Rev. Mol. Cell Biol. 13:448–462. Nys, Y., J. Gautron, J. M. Garcia-Ruiz, and M. T. Hincke. 2004. Avian eggshell mineralization: biochemical and functional characterization of matrix proteins. C. R. Palevol. 3:549–562. Nys, Y., M. T. Hincke, J. L. Arias, J. M. Garcia-Ruiz, and S. E. Solomon. 1999. Avian eggshell mineralization. Poult. Avian Biol. Rev. 10:143–166. Parsons, A. H. 1982. Structure of the eggshell. Poult. Sci. 61:2013– 2021. Radwan, L. M. 2015. Eggshell quality: a comparison between Fayoumi, Gimieizah and Brown Hy-Line strains for mechanical properties and ultrastructure of their eggshells. Anim. Prod. Sci. 56:908–912. Radwan, L. M., A Galal, M. M. Fathi, and A. Zein El-Dein. 2010. Mechanical and ultrastructural properties of eggshell in two Egyptian native breeds of chicken. Int. J. Poult. Sci. 9:77–81. Raman, J., Y. Guan, C. L. Perrine, T. A. Gerken, and L. A. Tabak. 2012. UDP-N-acetyl-alpha-D-galactosamine:polypeptide N-acetylgalactosaminyltransferases: completion of the family tree. Glycobiology. 22:768–777. Saito, M., and A. Ishii. 2002. ST3Gal-V (GM3 Synthase, SAT-I). Pages 289–294 in: Handbook of Glycosyltransferases and Related Genes, N. Taniguchi, ed. Springer, Japan. Schramm, V. L. 2012. Manganese in Metabolism and Enzyme Function. Elsevier, Philadelphia, PA. Sugahara, K., and H. Kitagawa. 2002. Heparin and heparan sulfate biosynthesis. IUBMB Life. 54:163–175. Sugrue, S. P., M. K. Gordon, J. Seyer, B. Dublet, M. Rest, and B. R. Olsen. 1989. Immunoidentification of type XII collagen in embryonic tissues. J. Cell Biol. 109:939–945. ´ atkiewicz, S., A. Arczewska-Wlosek, J. Krawczyk, M. Puchala, Swi  and D. Jozefiak. 2015. Dietary factors improving eggshell quality: an updated review with special emphasis on microelements and feed additives. Worlds Poult. Sci. J. 71:83–94. Takeda, J., and T. Kinoshita. 1995. GPI-anchor biosynthesis. Trends Biochem. Sci. 20:367–371. Xiao, J. F., S. G. Wu, H. J. Zhang, H. Y. Yue, J. Wang, F. Ji, and G. H. Qi. 2015. Bioefficacy comparison of organic manganese with inorganic manganese for eggshell quality in Hy-Line Brown laying hens. Poult. Sci. 94:1871–1878. Xiao, J. F., Y. N. Zhang, S. G. Wu, H. J. Zhang, H. Y. Yue, and G. H. Qi. 2014. Manganese supplementation enhances the synthesis of glycosaminoglycan in eggshell membrane: A strategy to improve eggshell quality in laying hens. Poult. Sci. 93:380–388. Xie, J. J., C. H. Tian, Y. W. Zhu, L. Y. Zhang, L. Lu, and X. G. Luo. 2014. Effects of inorganic and organic manganese supplementation on gonadotropin-releasing hormone-I and folliclestimulating hormone expression and reproductive performance of broiler breeder hens. Poult. Sci. 93:959–969. Zhang, Y. N., H. J. Zhang, S. G. Wu, J. Wang, and G. H. Qi. 2017b. Dietary manganese supplementation modulated mechanical and ultrastructural changes during eggshell formation in laying hens. Poult. Sci. 96:2699-2707. Zhang, Y. N., J. Wang, H. J. Zhang, S. G. Wu, and G. H. Qi. 2017a. Effect of dietary supplementation of organic or inorganic manganese on eggshell quality, ultrastructure and components in laying hens. Poult. Sci. 96:2184–2193.

Downloaded from https://academic.oup.com/ps/advance-article-abstract/doi/10.3382/ps/pex419/4818393 by Claude Moore Health Sciences Library user on 25 January 2018