- Email: [email protected]
Different in vivo localization of the Escherichia coli proteins CspD and CspA
FEMS Microbiology Letters 202 (2001) 171^176
www.fems-microbiology.org
Di¡erent in vivo localization of the Escherichia coli proteins CspD and CspA Mara Giangrossi a
a;b
, Rachel M. Exley b , Franc°oise Le Hegarat b , Cynthia L. Pon
a;
*
Laboratorio di Genetica, Dipartimento di Biologia MCA, Universita© di Camerino, I-62032, Camerino (MC), Italy b Institut de Ge¨ne¨tique et Microbiologie, Universite¨ de Paris-Sud, F-91405, Orsay, France Received 28 March 2001; received in revised form 5 June 2001; accepted 5 June 2001 First published online 24 July 2001
Abstract Two Csp proteins (CspA and CspD) were fused to the green fluorescent protein GFP and expressed from their natural promoters or from an inducible promoter. Fluorescence microscopy and computerized image analysis indicate that in Escherichia coli growing at 37³C CspD localizes in the nucleoid like the control H-NS while CspA occupies a polar position away from the nucleoid. Following cold shock CspA maintains its location, while CspD is not sufficiently expressed to permit its localization. The different localization of CspA and CspD indicates that these proteins play different roles in the cell in spite of their extensive structural similarity. ß 2001 Federation of European Microbiological Societies. Published by Elsevier Science B.V. All rights reserved. Keywords : Cold shock protein D; Cold shock protein A; In vivo localization ; Cold shock; H-NS ; Green £uorescent protein fusion; Fluorescence microscopy
1. Introduction Following a shift in temperature from 37³C to 10³C (cold shock), Escherichia coli cultures enter an acclimation phase during which gene expression and metabolism undergo changes which permit adaptation of the cells to the new growth temperature. During the growth lag caused by cold shock the synthesis of some proteins increases [1] and then returns to constitutive levels when the cells resume growth. The main cold shock protein in E. coli is CspA, a 7 kDa nucleic acid-binding protein [1^3] which stimulates the expression of cold shock genes at the transcriptional [4,5] and translational ([6] ; M. Giangrossi and A.M. Giuliodori, manuscript in preparation) levels. In turn, cold shock regulation of cspA occurs transcriptionally, translationally, and also through changes of mRNA stability ([7] and references therein). CspA could be an RNA chaperone stimulating RNA degradation and binding nascent RNA during transcription, a role actually demonstrated for its homologue CspE. Indeed, in E. coli there are nine highly
* Corresponding author. Tel. : +39 (737) 40 32 40; Fax: +39 (737) 40 32 43. E-mail address : [email protected] (C.L. Pon).
homologous genes (from cspA to cspI) some of which respond to cold (cspA, cspB, cspG and cspI) or nutritional (cspD) stress. In spite of their structural similarity, there is no evidence as to whether the nine csp gene products in the cell have similar or somehow specialized roles. Although attempts to amplify speci¢c RNA sequences recognized by these proteins yielded disappointing results, an extensive functional redundancy seems unlikely (for review, see [7]). A clue in favor of possible functional di¡erences among Csp family members comes from the di¡erent cellular localization of CspA and CspD fused with the green £uorescent protein (GFP) presented in this work. As a control, we have con¢rmed the localization of H-NS, a DNAbinding protein whose association with the nucleoid had been obtained only in cold-shocked cells subjected to cryo¢xation [8]. 2. Materials and methods 2.1. Construction of the hns-gfp fusion To construct the hns-gfp fusion (Fig. 1A), hns was ampli¢ed by PCR using the oligonucleotides 5PXbahns (5PCCACTCTAGAATAAGTTTGAGATTACTACA) and
0378-1097 / 01 / $20.00 ß 2001 Federation of European Microbiological Societies. Published by Elsevier Science B.V. All rights reserved. PII: S 0 3 7 8 - 1 0 9 7 ( 0 1 ) 0 0 2 9 1 - 9
FEMSLE 10043 15-8-01
Cyaan Magenta Geel Zwart
172
M. Giangrossi et al. / FEMS Microbiology Letters 202 (2001) 171^176
3PXmahns (5P-AAAGATTCCCGGGTGATCAGGAAATCGTCG) to obtain a fragment (+5 to +455) in which the TAA stop codon was changed to the Glu codon GAA. Following XbaI and XmaI digestion, this fragment was cloned downstream from the lac promoter in pGFP ASV (Clontech, USA) giving rise to phns-gfp ASV in which the H-NS coding region is fused in frame, through a spacer encoding 11 amino acids, to GFP ASV , a mutated GFP with a half-life of 110 min. The in vivo expression of this fusion protein was con¢rmed by Western blot analysis using both anti-H-NS and anti-GFP antibodies (Fig. 1B) while the biological activity of H-NS within the fusion was demonstrated by the capacity of hns-gfp to repress the bgl operon of E. coli TP504 (F3 leu B6 serB1203 thi-1 tonA21 lacY1 supE44 zch506: :Tn10 zdd230: :Tn9 vhns) [9]. 2.2. Construction of the cspD-gfp and cspA-gfp fusions The cspD-gfp fusion was constructed amplifying a cspD fragment extending from 3271 to +319 using oligonucleotides 5PEcoRIcspD (5P-TGATCGAATTCCAGCCAGT) and 3PXmaIcspD (5P-GAAGACCCGGGCGACTGCC GCTT) as PCR primers. The ampli¢ed fragment was cloned in pGFP ASV digested with XbaI and XmaI and in pTZgfp digested with EcoRI and XmaI to yield pcspD-gfp ASV and pTZcspD-gfp, respectively (Fig. 1A). The pTZgfp was constructed by transferring the fragment encoding GFP ASV from pgfp ASV into pTZ19R digested with SmaI and HindIII. In pTZgfp, the orientation of the region encoding GFP ASV is opposite that of the lac promoter and therefore the GFP cannot be expressed. The cspA-gfp fusion (controlled by the lac promoter (Fig. 1Ac ) was constructed amplifying the +120 to +379 fragment of cspA using 5PXbacspA (5P-TCGCCTCTAGACAC ACTTAATTATTAAAGG) and 3PXmacspA (5PGCAGAGCTCCC CGGGTGGTTACGTTACCA GCCTGCC) as primers. Plasmid pcspA-gfp ASV was obtained by cloning this fragment into XbaI and XmaI digested pGFP ASV . The construct pTZcspA-gfp was obtained cloning into EcoRI and XmaI digested pTZgfp a cspA fragment extending from 3170 to +379, which was ampli¢ed using 3PXmacspA (see above) and 5PEcoRIcspA (5PGCGTTGAATTCAAGCCAAC) as primers. 2.3. Microscopic observations and image analysis Two microliters of the desired culture were placed on microscope slides and observed using a Zeiss Axioplan microscope equipped with a 100U UPlanFluor objective, 1.25U optovar and 4P,6-diamidino-2-phenylindole (DAPI) and GFP ¢lters (Zeiss). Fluorescent photographs were obtained with Fujicolor (ASA 1600). The image analysis program used was created by Dr. Hugues Talbot, CSIRO, Australia. Images were segmented in three phases. (1) Preprocessing: registration was performed manually using carefully selected control points in FITC and DAPI im-
FEMSLE 10043 15-8-01
ages to overlay precisely the images taken at di¡erent wavelengths. A top-hat operation [10] was then performed to eliminate variations in the background. (2) Seed selection: the background was selected automatically by thresholding, using a pixel level determined manually. The location for each bacterium was selected manually and a seed created for each by drawing a line inside the bacterium. (3) Region growing: contours were de¢ned automatically using the algorithm described by Adams and Bischof [11]. This algorithm grows out regions stemming from the seeds, individually and in parallel, one pixel at a time. The process is repeated and stops only when the image is entirely tessellated. Objects de¢ned in this manner were labeled in raster order and rotated. For each object and for each wavelength a column wise sum is made across the width of the object. The result is a vector of data with as many entries as the object is long, measured in pixels. The column-wise sum is taken as the average £uorescence intensity at that wavelength along the length of the bacterium. Data for all bacteria were normalized along the longitudinal axis and this axis was subsequently divided into 10 regions. The amount of £uorescence within each region was expressed as a percentage of the total £uorescence within the bacterium. The mean percent total £uorescence within each region for all bacteria was calculated and these data were represented on histograms. 3. Results and discussion In this study we have selected CspA and CspD because they are among the better characterized members of the Csp family whose expression occurs in di¡erent moments of cell growth, namely entering (CspD) and exiting (CspA) stationary phase and in response to two di¡erent types of stress such as nutritional (CspD) and cold (CspA) [7]. The in vivo localization of these proteins fused to the GFP [12] was compared to that of H-NS, an abundant DNA-binding protein which had previously been immunologically localized in the nucleoid in cryosubstituted cells ([8] and references therein). The genes encoding the chimeric fusions of GFP with H-NS, CspA and CspD were prepared as described in Section 2 and placed under the control of the inducible lac promoter (phns-gfp ASV , pcspA-gfp ASV and pcspD-gfp ASV ) and, in the case of cspA-gfp and cspDgfp, also under the control of the cspA and cspD natural promoters yielding pTZcspA-gfp and pTZcspD-gfp. The production of the fusion proteins by E. coli JM109 cells harboring the above vectors (Fig. 1A) was ascertained by SDS^PAGE and immunological Western blot analysis (Fig. 1B). Aliquots of cell cultures taken at di¡erent phases of the growth cycle were observed in an epi£uorescence microscope without prior ¢xation to visualize the fusion proteins with respect to the nucleoid which was stained by incubating the cells in the presence of 0.2 mg ml31 DAPI.
Cyaan Magenta Geel Zwart
M. Giangrossi et al. / FEMS Microbiology Letters 202 (2001) 171^176
173
Fig. 1. Construction and expression of the protein fusions used in this work. A: Schematic representation of the translational fusions constructed in this article (see Section 2). The ¢rst four constructs are placed under the control of the inducible plac and correspond to: (a) pGFP ASV , (b) phns: :gfp ASV , (c) pcspA: :gfp ASV , (d) pcspD : :gfp ASV . The last two constructs correspond to: (e) pTZcspA: :gfp and (f) pTZcspD : :gfp which are controlled by the natural promoters of cspA and cspD, respectively. SD, Shine^Dalgarno sequence ; J, linker sequence ; MCS, multiple cloning sites. The GFP coding sequence is indicated in gray while the coding sequences of the other proteins are indicated by di¡erent patterns. The relevant restriction sites used for the constructions (see Section 2) are indicated by small capital letters. B: Western blot analysis of the expression of the fusion proteins CspA-GFP, CspD-GFP and HNS-GFP under control of the inducible lac promoter and of their natural promoters. (a) Aliquots of cells in the exponential phase (OD600 = 0.6) harboring pGFP ASV (lanes 1,2), pcspA-gfp ASV (lanes 3,4) and phns-gfp ASV (lanes 5,6) taken before (lanes 1,3,5) and 30 min after (lanes 2,4,6) addition of 1 mM IPTG. The upper band in lane 2 is due to expression from the lacZ translation initiation site upstream from the MCS which adds 29 amino acids to the N-terminus of GFP. (b) Aliquots of cells harboring pTZcspD-gfp were taken during growth at 37³C at OD600 = 0.3, 0.6, 1.0, 2.2 and 3.2 (lanes 1^5). The samples were subjected to 16% SDS^PAGE followed by Western blotting and immunological detection with anti-GFP antibodies.
In full agreement with the previous localization of H-NS in the nucleoid [8], the present experiments carried out with phns-gfp AVS (after IPTG induction) demonstrated that H-NS-GFP is located within the nucleoid in coldshocked cells (not shown) and at all stages (i.e. OD600 = 0.6, 1.5 and 2.5) of growth at 37³C (Fig. 2A,B). The good overlap between the H-NS-GFP (green) and the DAPI (blue) £uorescence can also be appreciated from the normalized distribution of the £uorescence intensity of the two £uorophores along the longitudinal cell axis (Fig. 3A). In contrast to H-NS-GFP the £uorescence of free GFP
FEMSLE 10043 15-8-01
expressed from pgfp ASV is di¡used throughout the control cell (not shown). The cellular localization of CspD-GFP and CspA-GFP was studied after expressing these fusions from the natural promoters of cspD and cspA, respectively. The CspD-GFP £uorescence clearly overlaps that of the DAPI-stained DNA in cells harboring pTZcspD-gfp (Figs. 2C,D and 3B) suggesting that, like H-NS-GFP, also CspD-GFP is associated with the nucleoid. On the contrary, in the cells harboring pTZcspA-gfp the CspA-GFP £uorescence is predominantly found at the cell poles, in a position clearly
Cyaan Magenta Geel Zwart
174
M. Giangrossi et al. / FEMS Microbiology Letters 202 (2001) 171^176
tempted after triggering their expression from an inducible promoter. Substantial expression of CspA-GFP was obtained in cells induced at mid-exponential growth at 37³C (Fig. 1Ba , lanes 3 and 4) and also at later stages
Fig. 2. Localization of GFP fusions with H-NS, CspD and CspA. Fluorescence localization of GFP fusion proteins (A,C,E) and DAPI-stained nucleoids (B,D,F) in cells expressing HNS-GFP (A,B), CspD-GFP (C,D) and CspA-GFP (E,F). In panels A and B are seen E. coli JM109 exponential phase (OD600 = 0.6 in LB medium) cells containing phnsgfp ASV after 30 min induction with IPTG; in panels C and D are seen late stationary phase (OD600 = 3.2 in LB medium) cells containing pTZcspD-gfp and in panels E and F are early exponential phase (OD600 = 0.2 in M9 minimal medium) cells containing pTZcspA: :gfp. Additional details are given in the text. The bar represents 1 Wm.
di¡erent from the central location of the DAPI £uorescence (Figs. 2E,F and 3C). In Fig. 2F the nucleoid is less dense because the cells were taken in early log phase and not in stationary phase where a nucleoid structure is more evident. However, since the success in the localization of the green £uorescence depended on the expression level of the fusion protein which in turn depended on the activity of the cspA and cspD promoters which varied as a function of the phase of growth or, more generally, on the growth conditions, the localization of the fusion proteins was not possible under all experimental conditions. In particular, while the nucleoid localization of CspD-GFP was clearly seen during late exponential growth, when the cspD promoter is active (Fig. 1Bb ) in agreement with an earlier report [13], the same fusion protein was not seen in earlier phases of growth (Fig. 1Bb ) or during cold shock (not shown) when this promoter is little or not at all active. On the other hand, experiments performed on aliquots of culture taken during the growth phases of cells harboring pTZcspA-gfp demonstrated that CspA-GFP is expressed at very high level after cold shock and at the beginning of the exponential phase of growth at 37³C while it decreases at later stages (not shown), in full agreement with the data of Brandi et al. [14]. To overcome the problem of CspD-GFP and CspAGFP localization under conditions in which their expression level falls below detection, their localization was at-
FEMSLE 10043 15-8-01
Fig. 3. Image analysis of the mean £uorescence intensity detected along length-normalized bacterial axis. A: Fluorescence of cells expressing HNS-GFP. B: Fluorescence of cells expressing CspD-GFP. C: Fluorescence of cells expressing CspA-GFP. The intensity of the GFP green £uorescence (black bars) and of the blue DAPI £uorescence (gray bars) are expressed as percent of the total £uorescence as a function of its position along the bacterial axis subdivided into 10 sections. Further details are given in Section 2.
Cyaan Magenta Geel Zwart
M. Giangrossi et al. / FEMS Microbiology Letters 202 (2001) 171^176
(not shown) and the cellular localization of CspA was the same as that seen above; similar results were obtained when CspA-GFP was expressed from the inducible promoter at di¡erent stages of cold shock (not shown). Unlike with CspA-GFP the CspD-GFP fusion was e¤ciently expressed from the lac promoter only under the same growth conditions when its physiological expression would occur. Thus, CspD-GFP was expressed little or not at all during cold shock and during early or mid-exponential growth so that its localization was impossible under these conditions. Furthermore, while stationary-state cells resuming growth contain a substantial amount of CspD-GFP, regardless of IPTG induction, the corresponding £uorescence remained di¡used in the cell (not shown) and was rapidly diluted by cell doubling; these results indicate that cspD mRNA is subject to some sort of post-transcriptional control which restricts its expression to cells entering stationary phase and that only at this stage the conditions exist for the nucleoid localization of CspD. On the contrary, our experiments con¢rmed the localization of CspA at the cell poles during all phases of cold adaptation and of growth at 37³C, suggesting that its location does not depend on a particular physiological state of the cell but rather on its particular a¤nity for a cellular target localized at the poles. In summary, we have localized in vivo H-NS, CspA and CspD using non-toxic £uorescent markers. Our data indicate that H-NS is associated with the nucleoid, thus extending to viable cells the previous electron microscopic observation [8]. Our study further shows that CspA and CspD, although belonging to the same multigene family, not only are expressed at di¡erent times during the growth cycle and in response to di¡erent types of stress, but are also localized in di¡erent parts of the cell. CspA is localized at the poles of the cell away from the nucleoid and is expressed primarily during the early phase of growth and after cold shock, while CspD is associated with the nucleoid in the late exponential phase of growth. If bulk transcription indeed occurs at the periphery of the nucleoid, as suggested by an earlier study carried out by high resolution autoradiography [15], the main localization of CspA in the cellular compartment not occupied by the nucleoid could be consistent with the hypothesis that this protein is a chaperone for nascent RNA. However, more recent data indicate that most RNA polymerase is localized within the nucleoid interior, at least in Bacillus subtilis [16]. The localization of CspA is consistent with the ¢ndings that this protein is required during transitions from steady state to resumption of growth and from growth at optimal temperature to cold since it has been proposed that the cell poles are the area where bacteria sense environmental changes [17] and where oriC is localized immediately after cell division [18]. Since CspD likely binds single stranded nucleic acids like the other Csp proteins ([19] and references therein), its nucleoid localization may suggest a role of this protein
FEMSLE 10043 15-8-01
175
in binding and perhaps protecting the DNA regions of the chromosome present in the single stranded conformation at the time of entry in stationary phase. Beyond these speculations on their functions, our ¢ndings provide a clear-cut indication that CspA and CspD perform di¡erent roles in the cell in spite of their super¢cial similarities and high degree of structural homology. Additional studies are obviously necessary to clarify these roles. Acknowledgements We wish to express our gratitude to Dr. Hugues Talbot (CSIRO, Australia) who has created the image analysis program. This work was partially supported by grants from the Italian C.N.R. Target Project on Biotechnology and MURST (PRIN 1999 `Molecular mechanisms of thermal adaptation in bacteria') to C.L.P. and from CNRS/ Universite¨ Paris XI (UMR C8621) and ARC 6794 to F.L.H. ; R.M.E. was the recipient of a E.C. Biotech fellowship (contract No. BIO4CT975141) and of a Leverhulme Trust Scholarship. References [1] Jones, P.G., Van Bogelen, R.A. and Neidhardt, F.C. (1987) Induction of proteins in response to low temperature in Escherichia coli. J. Bacteriol. 169, 2092^2095. [2] Goldstein, J., Pollitt, N.S. and Inouye, M. (1990) Major cold shock protein of Escherichia coli. Proc. Natl. Acad. Sci. USA 87, 283^287. [3] Schindelin, H., Jiang, W., Inouye, M. and Heinemann, U. (1994) Crystal structure of CspA, the major cold-shock protein of Escherichia coli. Proc. Natl. Acad. Sci. USA 91, 5119^5123. [4] La Teana, A., Brandi, A., Falconi, M., Spurio, R., Pon, C.L. and Gualerzi, C.O. (1991) Identi¢cation of a cold shock transcriptional enhancer of the Escherichia coli gene encoding nucleoid protein HNS. Proc. Natl. Acad. Sci. USA 88, 10907^10911. [5] Jones, P.G., Krah, R., Tafuri, S.R. and Wol¡e, A.P. (1992) DNA gyrase, CS7.4, and the cold shock response in Escherichia coli. Mol. Microbiol. 174, 5798^5802. [6] Brandi, A., Pietroni, P., Gualerzi, C.O. and Pon, C.L. (1996) Posttranscriptional regulation of CspA expression in Escherichia coli. Mol. Microbiol. 19, 231^240. [7] Yamanaka, K. (1999) Cold shock response in Escherichia coli. J. Mol. Microbiol. Biotechnol. 1, 193^202. [8] Du«rrenberger, M., La Teana, A., Citro, G., Venanzi, F., Gualerzi, C.O. and Pon, C.L. (1991) Escherichia coli DNA-binding protein HNS is localized in the nucleoid. Res. Microbiol. 142, 373^380. [9] Beloin, C., Hirschbein, L. and Le Hegarat, F. (1996) Suppression of the Bgl phenotype of a vhns strain of Escherichia coli by a Bacillus subtilis antiterminator binding site. Mol. Gen. Genet. 250, 761^766. [10] Serra, J. (1982) Image Analysis and Mathematical Morphology. Academic Press, New York. [11] Adams, R. and Bischof, L. (1994) Seeded region growing. IEEE Trans. Pattern Anal. Machine Intelligence 16, 641^647. [12] Chal¢e, M., Tu, Y., Euskirchen, G., Ward, W.W. and Prasher, D.C. (1994) Green £uorescent protein as marker for gene expression. Science 263, 802^805. [13] Yamanaka, K. and Inouye, M. (1997) Growth-phase-dependent expression of cspD, encoding a member of the CspA in Escherichia coli. J. Bacteriol. 179, 5126^5130.
Cyaan Magenta Geel Zwart
176
M. Giangrossi et al. / FEMS Microbiology Letters 202 (2001) 171^176
[14] Brandi, A., Spurio, R., Gualerzi, C.O. and Pon, C.L. (1999) Massive presence of the Escherichia coli major cold shock protein CspA under non stress conditions. EMBO J. 18, 1653^1659. [15] Ryter, A. and Chang, A. (1975) Localisation of transcribing genes in the bacterial cell by means of high resolution autoradiography. J. Mol. Biol. 98, 797^810. [16] Lewis, P.J., Thaker, S.D. and Errington, J. (2000) Compartmentalization of transcription and translation in Bacillus subtilis. EMBO J. 19, 710^718. [17] Santini, C.L., Bernadac, A., Zhang, M., Chanal, A., Ize, B., Blanco,
FEMSLE 10043 15-8-01
C. and Wu, L.F. (2001) Translocation of jelly¢sh green £uorescent protein via the TAT system of Escherichia coli and change of its periplasmic localization in response to osmotic up-shock. J. Biol. Chem. 276, 8159^8164. [18] Niki, H., Yamaichi, Y. and Hiraga, S. (2000) Dynamic organization of chromosomal DNA in Escherichia coli. Genes Dev. 14, 212^223. [19] Graumann, P.L. and Marahiel, M. (1998) A superfamily of proteins that contain the cold-shock domain. Trends Biochem. Sci. 23, 286^ 290.
Cyaan Magenta Geel Zwart
www.fems-microbiology.org
Di¡erent in vivo localization of the Escherichia coli proteins CspD and CspA Mara Giangrossi a
a;b
, Rachel M. Exley b , Franc°oise Le Hegarat b , Cynthia L. Pon
a;
*
Laboratorio di Genetica, Dipartimento di Biologia MCA, Universita© di Camerino, I-62032, Camerino (MC), Italy b Institut de Ge¨ne¨tique et Microbiologie, Universite¨ de Paris-Sud, F-91405, Orsay, France Received 28 March 2001; received in revised form 5 June 2001; accepted 5 June 2001 First published online 24 July 2001
Abstract Two Csp proteins (CspA and CspD) were fused to the green fluorescent protein GFP and expressed from their natural promoters or from an inducible promoter. Fluorescence microscopy and computerized image analysis indicate that in Escherichia coli growing at 37³C CspD localizes in the nucleoid like the control H-NS while CspA occupies a polar position away from the nucleoid. Following cold shock CspA maintains its location, while CspD is not sufficiently expressed to permit its localization. The different localization of CspA and CspD indicates that these proteins play different roles in the cell in spite of their extensive structural similarity. ß 2001 Federation of European Microbiological Societies. Published by Elsevier Science B.V. All rights reserved. Keywords : Cold shock protein D; Cold shock protein A; In vivo localization ; Cold shock; H-NS ; Green £uorescent protein fusion; Fluorescence microscopy
1. Introduction Following a shift in temperature from 37³C to 10³C (cold shock), Escherichia coli cultures enter an acclimation phase during which gene expression and metabolism undergo changes which permit adaptation of the cells to the new growth temperature. During the growth lag caused by cold shock the synthesis of some proteins increases [1] and then returns to constitutive levels when the cells resume growth. The main cold shock protein in E. coli is CspA, a 7 kDa nucleic acid-binding protein [1^3] which stimulates the expression of cold shock genes at the transcriptional [4,5] and translational ([6] ; M. Giangrossi and A.M. Giuliodori, manuscript in preparation) levels. In turn, cold shock regulation of cspA occurs transcriptionally, translationally, and also through changes of mRNA stability ([7] and references therein). CspA could be an RNA chaperone stimulating RNA degradation and binding nascent RNA during transcription, a role actually demonstrated for its homologue CspE. Indeed, in E. coli there are nine highly
* Corresponding author. Tel. : +39 (737) 40 32 40; Fax: +39 (737) 40 32 43. E-mail address : [email protected] (C.L. Pon).
homologous genes (from cspA to cspI) some of which respond to cold (cspA, cspB, cspG and cspI) or nutritional (cspD) stress. In spite of their structural similarity, there is no evidence as to whether the nine csp gene products in the cell have similar or somehow specialized roles. Although attempts to amplify speci¢c RNA sequences recognized by these proteins yielded disappointing results, an extensive functional redundancy seems unlikely (for review, see [7]). A clue in favor of possible functional di¡erences among Csp family members comes from the di¡erent cellular localization of CspA and CspD fused with the green £uorescent protein (GFP) presented in this work. As a control, we have con¢rmed the localization of H-NS, a DNAbinding protein whose association with the nucleoid had been obtained only in cold-shocked cells subjected to cryo¢xation [8]. 2. Materials and methods 2.1. Construction of the hns-gfp fusion To construct the hns-gfp fusion (Fig. 1A), hns was ampli¢ed by PCR using the oligonucleotides 5PXbahns (5PCCACTCTAGAATAAGTTTGAGATTACTACA) and
0378-1097 / 01 / $20.00 ß 2001 Federation of European Microbiological Societies. Published by Elsevier Science B.V. All rights reserved. PII: S 0 3 7 8 - 1 0 9 7 ( 0 1 ) 0 0 2 9 1 - 9
FEMSLE 10043 15-8-01
Cyaan Magenta Geel Zwart
172
M. Giangrossi et al. / FEMS Microbiology Letters 202 (2001) 171^176
3PXmahns (5P-AAAGATTCCCGGGTGATCAGGAAATCGTCG) to obtain a fragment (+5 to +455) in which the TAA stop codon was changed to the Glu codon GAA. Following XbaI and XmaI digestion, this fragment was cloned downstream from the lac promoter in pGFP ASV (Clontech, USA) giving rise to phns-gfp ASV in which the H-NS coding region is fused in frame, through a spacer encoding 11 amino acids, to GFP ASV , a mutated GFP with a half-life of 110 min. The in vivo expression of this fusion protein was con¢rmed by Western blot analysis using both anti-H-NS and anti-GFP antibodies (Fig. 1B) while the biological activity of H-NS within the fusion was demonstrated by the capacity of hns-gfp to repress the bgl operon of E. coli TP504 (F3 leu B6 serB1203 thi-1 tonA21 lacY1 supE44 zch506: :Tn10 zdd230: :Tn9 vhns) [9]. 2.2. Construction of the cspD-gfp and cspA-gfp fusions The cspD-gfp fusion was constructed amplifying a cspD fragment extending from 3271 to +319 using oligonucleotides 5PEcoRIcspD (5P-TGATCGAATTCCAGCCAGT) and 3PXmaIcspD (5P-GAAGACCCGGGCGACTGCC GCTT) as PCR primers. The ampli¢ed fragment was cloned in pGFP ASV digested with XbaI and XmaI and in pTZgfp digested with EcoRI and XmaI to yield pcspD-gfp ASV and pTZcspD-gfp, respectively (Fig. 1A). The pTZgfp was constructed by transferring the fragment encoding GFP ASV from pgfp ASV into pTZ19R digested with SmaI and HindIII. In pTZgfp, the orientation of the region encoding GFP ASV is opposite that of the lac promoter and therefore the GFP cannot be expressed. The cspA-gfp fusion (controlled by the lac promoter (Fig. 1Ac ) was constructed amplifying the +120 to +379 fragment of cspA using 5PXbacspA (5P-TCGCCTCTAGACAC ACTTAATTATTAAAGG) and 3PXmacspA (5PGCAGAGCTCCC CGGGTGGTTACGTTACCA GCCTGCC) as primers. Plasmid pcspA-gfp ASV was obtained by cloning this fragment into XbaI and XmaI digested pGFP ASV . The construct pTZcspA-gfp was obtained cloning into EcoRI and XmaI digested pTZgfp a cspA fragment extending from 3170 to +379, which was ampli¢ed using 3PXmacspA (see above) and 5PEcoRIcspA (5PGCGTTGAATTCAAGCCAAC) as primers. 2.3. Microscopic observations and image analysis Two microliters of the desired culture were placed on microscope slides and observed using a Zeiss Axioplan microscope equipped with a 100U UPlanFluor objective, 1.25U optovar and 4P,6-diamidino-2-phenylindole (DAPI) and GFP ¢lters (Zeiss). Fluorescent photographs were obtained with Fujicolor (ASA 1600). The image analysis program used was created by Dr. Hugues Talbot, CSIRO, Australia. Images were segmented in three phases. (1) Preprocessing: registration was performed manually using carefully selected control points in FITC and DAPI im-
FEMSLE 10043 15-8-01
ages to overlay precisely the images taken at di¡erent wavelengths. A top-hat operation [10] was then performed to eliminate variations in the background. (2) Seed selection: the background was selected automatically by thresholding, using a pixel level determined manually. The location for each bacterium was selected manually and a seed created for each by drawing a line inside the bacterium. (3) Region growing: contours were de¢ned automatically using the algorithm described by Adams and Bischof [11]. This algorithm grows out regions stemming from the seeds, individually and in parallel, one pixel at a time. The process is repeated and stops only when the image is entirely tessellated. Objects de¢ned in this manner were labeled in raster order and rotated. For each object and for each wavelength a column wise sum is made across the width of the object. The result is a vector of data with as many entries as the object is long, measured in pixels. The column-wise sum is taken as the average £uorescence intensity at that wavelength along the length of the bacterium. Data for all bacteria were normalized along the longitudinal axis and this axis was subsequently divided into 10 regions. The amount of £uorescence within each region was expressed as a percentage of the total £uorescence within the bacterium. The mean percent total £uorescence within each region for all bacteria was calculated and these data were represented on histograms. 3. Results and discussion In this study we have selected CspA and CspD because they are among the better characterized members of the Csp family whose expression occurs in di¡erent moments of cell growth, namely entering (CspD) and exiting (CspA) stationary phase and in response to two di¡erent types of stress such as nutritional (CspD) and cold (CspA) [7]. The in vivo localization of these proteins fused to the GFP [12] was compared to that of H-NS, an abundant DNA-binding protein which had previously been immunologically localized in the nucleoid in cryosubstituted cells ([8] and references therein). The genes encoding the chimeric fusions of GFP with H-NS, CspA and CspD were prepared as described in Section 2 and placed under the control of the inducible lac promoter (phns-gfp ASV , pcspA-gfp ASV and pcspD-gfp ASV ) and, in the case of cspA-gfp and cspDgfp, also under the control of the cspA and cspD natural promoters yielding pTZcspA-gfp and pTZcspD-gfp. The production of the fusion proteins by E. coli JM109 cells harboring the above vectors (Fig. 1A) was ascertained by SDS^PAGE and immunological Western blot analysis (Fig. 1B). Aliquots of cell cultures taken at di¡erent phases of the growth cycle were observed in an epi£uorescence microscope without prior ¢xation to visualize the fusion proteins with respect to the nucleoid which was stained by incubating the cells in the presence of 0.2 mg ml31 DAPI.
Cyaan Magenta Geel Zwart
M. Giangrossi et al. / FEMS Microbiology Letters 202 (2001) 171^176
173
Fig. 1. Construction and expression of the protein fusions used in this work. A: Schematic representation of the translational fusions constructed in this article (see Section 2). The ¢rst four constructs are placed under the control of the inducible plac and correspond to: (a) pGFP ASV , (b) phns: :gfp ASV , (c) pcspA: :gfp ASV , (d) pcspD : :gfp ASV . The last two constructs correspond to: (e) pTZcspA: :gfp and (f) pTZcspD : :gfp which are controlled by the natural promoters of cspA and cspD, respectively. SD, Shine^Dalgarno sequence ; J, linker sequence ; MCS, multiple cloning sites. The GFP coding sequence is indicated in gray while the coding sequences of the other proteins are indicated by di¡erent patterns. The relevant restriction sites used for the constructions (see Section 2) are indicated by small capital letters. B: Western blot analysis of the expression of the fusion proteins CspA-GFP, CspD-GFP and HNS-GFP under control of the inducible lac promoter and of their natural promoters. (a) Aliquots of cells in the exponential phase (OD600 = 0.6) harboring pGFP ASV (lanes 1,2), pcspA-gfp ASV (lanes 3,4) and phns-gfp ASV (lanes 5,6) taken before (lanes 1,3,5) and 30 min after (lanes 2,4,6) addition of 1 mM IPTG. The upper band in lane 2 is due to expression from the lacZ translation initiation site upstream from the MCS which adds 29 amino acids to the N-terminus of GFP. (b) Aliquots of cells harboring pTZcspD-gfp were taken during growth at 37³C at OD600 = 0.3, 0.6, 1.0, 2.2 and 3.2 (lanes 1^5). The samples were subjected to 16% SDS^PAGE followed by Western blotting and immunological detection with anti-GFP antibodies.
In full agreement with the previous localization of H-NS in the nucleoid [8], the present experiments carried out with phns-gfp AVS (after IPTG induction) demonstrated that H-NS-GFP is located within the nucleoid in coldshocked cells (not shown) and at all stages (i.e. OD600 = 0.6, 1.5 and 2.5) of growth at 37³C (Fig. 2A,B). The good overlap between the H-NS-GFP (green) and the DAPI (blue) £uorescence can also be appreciated from the normalized distribution of the £uorescence intensity of the two £uorophores along the longitudinal cell axis (Fig. 3A). In contrast to H-NS-GFP the £uorescence of free GFP
FEMSLE 10043 15-8-01
expressed from pgfp ASV is di¡used throughout the control cell (not shown). The cellular localization of CspD-GFP and CspA-GFP was studied after expressing these fusions from the natural promoters of cspD and cspA, respectively. The CspD-GFP £uorescence clearly overlaps that of the DAPI-stained DNA in cells harboring pTZcspD-gfp (Figs. 2C,D and 3B) suggesting that, like H-NS-GFP, also CspD-GFP is associated with the nucleoid. On the contrary, in the cells harboring pTZcspA-gfp the CspA-GFP £uorescence is predominantly found at the cell poles, in a position clearly
Cyaan Magenta Geel Zwart
174
M. Giangrossi et al. / FEMS Microbiology Letters 202 (2001) 171^176
tempted after triggering their expression from an inducible promoter. Substantial expression of CspA-GFP was obtained in cells induced at mid-exponential growth at 37³C (Fig. 1Ba , lanes 3 and 4) and also at later stages
Fig. 2. Localization of GFP fusions with H-NS, CspD and CspA. Fluorescence localization of GFP fusion proteins (A,C,E) and DAPI-stained nucleoids (B,D,F) in cells expressing HNS-GFP (A,B), CspD-GFP (C,D) and CspA-GFP (E,F). In panels A and B are seen E. coli JM109 exponential phase (OD600 = 0.6 in LB medium) cells containing phnsgfp ASV after 30 min induction with IPTG; in panels C and D are seen late stationary phase (OD600 = 3.2 in LB medium) cells containing pTZcspD-gfp and in panels E and F are early exponential phase (OD600 = 0.2 in M9 minimal medium) cells containing pTZcspA: :gfp. Additional details are given in the text. The bar represents 1 Wm.
di¡erent from the central location of the DAPI £uorescence (Figs. 2E,F and 3C). In Fig. 2F the nucleoid is less dense because the cells were taken in early log phase and not in stationary phase where a nucleoid structure is more evident. However, since the success in the localization of the green £uorescence depended on the expression level of the fusion protein which in turn depended on the activity of the cspA and cspD promoters which varied as a function of the phase of growth or, more generally, on the growth conditions, the localization of the fusion proteins was not possible under all experimental conditions. In particular, while the nucleoid localization of CspD-GFP was clearly seen during late exponential growth, when the cspD promoter is active (Fig. 1Bb ) in agreement with an earlier report [13], the same fusion protein was not seen in earlier phases of growth (Fig. 1Bb ) or during cold shock (not shown) when this promoter is little or not at all active. On the other hand, experiments performed on aliquots of culture taken during the growth phases of cells harboring pTZcspA-gfp demonstrated that CspA-GFP is expressed at very high level after cold shock and at the beginning of the exponential phase of growth at 37³C while it decreases at later stages (not shown), in full agreement with the data of Brandi et al. [14]. To overcome the problem of CspD-GFP and CspAGFP localization under conditions in which their expression level falls below detection, their localization was at-
FEMSLE 10043 15-8-01
Fig. 3. Image analysis of the mean £uorescence intensity detected along length-normalized bacterial axis. A: Fluorescence of cells expressing HNS-GFP. B: Fluorescence of cells expressing CspD-GFP. C: Fluorescence of cells expressing CspA-GFP. The intensity of the GFP green £uorescence (black bars) and of the blue DAPI £uorescence (gray bars) are expressed as percent of the total £uorescence as a function of its position along the bacterial axis subdivided into 10 sections. Further details are given in Section 2.
Cyaan Magenta Geel Zwart
M. Giangrossi et al. / FEMS Microbiology Letters 202 (2001) 171^176
(not shown) and the cellular localization of CspA was the same as that seen above; similar results were obtained when CspA-GFP was expressed from the inducible promoter at di¡erent stages of cold shock (not shown). Unlike with CspA-GFP the CspD-GFP fusion was e¤ciently expressed from the lac promoter only under the same growth conditions when its physiological expression would occur. Thus, CspD-GFP was expressed little or not at all during cold shock and during early or mid-exponential growth so that its localization was impossible under these conditions. Furthermore, while stationary-state cells resuming growth contain a substantial amount of CspD-GFP, regardless of IPTG induction, the corresponding £uorescence remained di¡used in the cell (not shown) and was rapidly diluted by cell doubling; these results indicate that cspD mRNA is subject to some sort of post-transcriptional control which restricts its expression to cells entering stationary phase and that only at this stage the conditions exist for the nucleoid localization of CspD. On the contrary, our experiments con¢rmed the localization of CspA at the cell poles during all phases of cold adaptation and of growth at 37³C, suggesting that its location does not depend on a particular physiological state of the cell but rather on its particular a¤nity for a cellular target localized at the poles. In summary, we have localized in vivo H-NS, CspA and CspD using non-toxic £uorescent markers. Our data indicate that H-NS is associated with the nucleoid, thus extending to viable cells the previous electron microscopic observation [8]. Our study further shows that CspA and CspD, although belonging to the same multigene family, not only are expressed at di¡erent times during the growth cycle and in response to di¡erent types of stress, but are also localized in di¡erent parts of the cell. CspA is localized at the poles of the cell away from the nucleoid and is expressed primarily during the early phase of growth and after cold shock, while CspD is associated with the nucleoid in the late exponential phase of growth. If bulk transcription indeed occurs at the periphery of the nucleoid, as suggested by an earlier study carried out by high resolution autoradiography [15], the main localization of CspA in the cellular compartment not occupied by the nucleoid could be consistent with the hypothesis that this protein is a chaperone for nascent RNA. However, more recent data indicate that most RNA polymerase is localized within the nucleoid interior, at least in Bacillus subtilis [16]. The localization of CspA is consistent with the ¢ndings that this protein is required during transitions from steady state to resumption of growth and from growth at optimal temperature to cold since it has been proposed that the cell poles are the area where bacteria sense environmental changes [17] and where oriC is localized immediately after cell division [18]. Since CspD likely binds single stranded nucleic acids like the other Csp proteins ([19] and references therein), its nucleoid localization may suggest a role of this protein
FEMSLE 10043 15-8-01
175
in binding and perhaps protecting the DNA regions of the chromosome present in the single stranded conformation at the time of entry in stationary phase. Beyond these speculations on their functions, our ¢ndings provide a clear-cut indication that CspA and CspD perform di¡erent roles in the cell in spite of their super¢cial similarities and high degree of structural homology. Additional studies are obviously necessary to clarify these roles. Acknowledgements We wish to express our gratitude to Dr. Hugues Talbot (CSIRO, Australia) who has created the image analysis program. This work was partially supported by grants from the Italian C.N.R. Target Project on Biotechnology and MURST (PRIN 1999 `Molecular mechanisms of thermal adaptation in bacteria') to C.L.P. and from CNRS/ Universite¨ Paris XI (UMR C8621) and ARC 6794 to F.L.H. ; R.M.E. was the recipient of a E.C. Biotech fellowship (contract No. BIO4CT975141) and of a Leverhulme Trust Scholarship. References [1] Jones, P.G., Van Bogelen, R.A. and Neidhardt, F.C. (1987) Induction of proteins in response to low temperature in Escherichia coli. J. Bacteriol. 169, 2092^2095. [2] Goldstein, J., Pollitt, N.S. and Inouye, M. (1990) Major cold shock protein of Escherichia coli. Proc. Natl. Acad. Sci. USA 87, 283^287. [3] Schindelin, H., Jiang, W., Inouye, M. and Heinemann, U. (1994) Crystal structure of CspA, the major cold-shock protein of Escherichia coli. Proc. Natl. Acad. Sci. USA 91, 5119^5123. [4] La Teana, A., Brandi, A., Falconi, M., Spurio, R., Pon, C.L. and Gualerzi, C.O. (1991) Identi¢cation of a cold shock transcriptional enhancer of the Escherichia coli gene encoding nucleoid protein HNS. Proc. Natl. Acad. Sci. USA 88, 10907^10911. [5] Jones, P.G., Krah, R., Tafuri, S.R. and Wol¡e, A.P. (1992) DNA gyrase, CS7.4, and the cold shock response in Escherichia coli. Mol. Microbiol. 174, 5798^5802. [6] Brandi, A., Pietroni, P., Gualerzi, C.O. and Pon, C.L. (1996) Posttranscriptional regulation of CspA expression in Escherichia coli. Mol. Microbiol. 19, 231^240. [7] Yamanaka, K. (1999) Cold shock response in Escherichia coli. J. Mol. Microbiol. Biotechnol. 1, 193^202. [8] Du«rrenberger, M., La Teana, A., Citro, G., Venanzi, F., Gualerzi, C.O. and Pon, C.L. (1991) Escherichia coli DNA-binding protein HNS is localized in the nucleoid. Res. Microbiol. 142, 373^380. [9] Beloin, C., Hirschbein, L. and Le Hegarat, F. (1996) Suppression of the Bgl phenotype of a vhns strain of Escherichia coli by a Bacillus subtilis antiterminator binding site. Mol. Gen. Genet. 250, 761^766. [10] Serra, J. (1982) Image Analysis and Mathematical Morphology. Academic Press, New York. [11] Adams, R. and Bischof, L. (1994) Seeded region growing. IEEE Trans. Pattern Anal. Machine Intelligence 16, 641^647. [12] Chal¢e, M., Tu, Y., Euskirchen, G., Ward, W.W. and Prasher, D.C. (1994) Green £uorescent protein as marker for gene expression. Science 263, 802^805. [13] Yamanaka, K. and Inouye, M. (1997) Growth-phase-dependent expression of cspD, encoding a member of the CspA in Escherichia coli. J. Bacteriol. 179, 5126^5130.
Cyaan Magenta Geel Zwart
176
M. Giangrossi et al. / FEMS Microbiology Letters 202 (2001) 171^176
[14] Brandi, A., Spurio, R., Gualerzi, C.O. and Pon, C.L. (1999) Massive presence of the Escherichia coli major cold shock protein CspA under non stress conditions. EMBO J. 18, 1653^1659. [15] Ryter, A. and Chang, A. (1975) Localisation of transcribing genes in the bacterial cell by means of high resolution autoradiography. J. Mol. Biol. 98, 797^810. [16] Lewis, P.J., Thaker, S.D. and Errington, J. (2000) Compartmentalization of transcription and translation in Bacillus subtilis. EMBO J. 19, 710^718. [17] Santini, C.L., Bernadac, A., Zhang, M., Chanal, A., Ize, B., Blanco,
FEMSLE 10043 15-8-01
C. and Wu, L.F. (2001) Translocation of jelly¢sh green £uorescent protein via the TAT system of Escherichia coli and change of its periplasmic localization in response to osmotic up-shock. J. Biol. Chem. 276, 8159^8164. [18] Niki, H., Yamaichi, Y. and Hiraga, S. (2000) Dynamic organization of chromosomal DNA in Escherichia coli. Genes Dev. 14, 212^223. [19] Graumann, P.L. and Marahiel, M. (1998) A superfamily of proteins that contain the cold-shock domain. Trends Biochem. Sci. 23, 286^ 290.
Cyaan Magenta Geel Zwart