Differential expression of stromal cell-derived factor 1 in human brain microvascular endothelial cells and pericytes involves histone modifications

Biochemical and Biophysical Research Communications 382 (2009) 519–524

Contents lists available at ScienceDirect

Biochemical and Biophysical Research Communications journal homepage: www.elsevier.com/locate/ybbrc

Differential expression of stromal cell-derived factor 1 in human brain microvascular endothelial cells and pericytes involves histone modifications Jungwon Seo a,b,1, Yong-Ou Kim c,1, Inho Jo a,b,c,* a

Department of Molecular Medicine, Ewha Womans University Medical School, 911-1 Mok 6-dong, Yangchun-gu, Seoul 158-710, South Korea Ewha Medical Research Institute, Ewha Womans University Medical School, 911-1 Mok 6-dong, Yangchun-gu, Seoul 158-710, South Korea c Center for Biomedical Sciences, National Institute of Health, 194 Tongillo, Eunpyeong-gu, Seoul 122-701, South Korea b

a r t i c l e

i n f o

Article history: Received 3 March 2009 Available online 14 March 2009

Keywords: Stromal cell-derived factor 1 Endothelial cells Pericytes Epigenetic DNA methylation Histone modifications

a b s t r a c t Stromal cell-derived factor 1 (SDF-1) regulates neovascularization, which is coordinately controlled by endothelial cells (EC) and their surrounding cells, pericytes or smooth muscle cells. In the basal state, SDF-1 expression is much lower in EC than in their surrounding cells. In this study, we evaluated epigenetic regulation to determine if it is involved in the mechanism responsible for the differential expression of SDF-1 in two types of vascular cells, brain microvascular EC (HBMEC) and pericytes (HBMP). We found that HBMEC did not express SDF-1, but that HBMP did. Furthermore, treatment of EC with 5-aza-20 -dexoycytidine and trichostatin A resulted in a remarkable restoration of SDF-1 expression. Additionally, bisulfite-sequencing analysis revealed no differences in the methylation state of SDF-1 promoter between HBMEC and HBMP. Finally, a chromatin immunoprecipitation assay revealed reduced levels of histone H3 lysine 9 (H3K9) acetylation and H3K4 trimethylation with concomitant enhancement of H3K9 trimethylation in HBMEC relative to HBMP, which suggests that histone modifications are involved in the cell-specific expression of SDF-1. Ó 2009 Elsevier Inc. All rights reserved.

Introduction The blood–brain barrier (BBB), which is essential for the normal brain function, greatly restricts the movement of molecules and cells into the central nervous system (CNS) [1]. Dysfunction of the BBB resulting from increased permeability by impairment of the tight junction seal complicates a number of neurologic diseases, including stroke and neuroinflammatory disorders. The BBB is composed of endothelial cells (EC) and periendothelial accessory structures such as pericytes. EC and pericytes are believed to interact in coordination to induce vessel development. For example, pericytes play a role in the structural integrity and differentiation of the vessel and formation of endothelial tight junctions [2–5], while EC regulate pericyte growth via endothelin-1 [6]. Although the cellular and molecular mechanisms for the coordinated interactions between EC and pericytes remain largely unknown, it is likely that they are attributable to the cell-specific expression of several vasoactive proteins. Indeed, platelet-derived growth factor (PDGF)-B is ex-

* Corresponding author. Department of Molecular Medicine, Ewha Womans University Medical School, 911-1 Mok 6-dong, Yangchun-gu, Seoul 158-710, South Korea. Fax: +82 2 2650 5786. E-mail address: [email protected] (I. Jo). 1 These authors contributed equally to this work. 0006-291X/$ - see front matter Ó 2009 Elsevier Inc. All rights reserved. doi:10.1016/j.bbrc.2009.03.049

pressed in EC, while its receptor, PDGFR-b, is expressed in pericytes [5,7,8]. The stromal cell-derived factor 1 (SDF-1), also known as CXCL12, is a CXC chemokine that exerts its effect via the binding of CXCR4, a G protein-coupled receptor. The results of several studies have suggested that SDF-1 plays an important role in the maintenance of BBB integrity. For example, in the CNS, SDF-1 is overexpressed in astrocytes and neurons in patients with HIVassociated dementia and other neuroinflammatory disorders [9,10]. In addition, it was recently reported that increased SDF-1 expression and polarized distribution of SDF-1 at the BBB were associated with the migration and infiltration of leukocytes into the brain [11–13]. Although SDF-1 is expressed in microvascular EC in the skin [14], human retina [15], and bone marrow [16], its expression is much lower in these cells than in their corresponding mesenchymal-origin cells. Furthermore, RT-PCR revealed that SDF1 mRNA was not detected in human umbilical EC (HUVEC). Due to the ability of EC to accumulate chemokines from extracellular environments [17], it has been suggested that SDF-1 detected in EC may merely result from the uptake of SDF-1 released by surrounding cells such as pericytes. In this study, we examined the differential expression of SDF-1 in brain microvascular endothelial cells (HBMEC) and pericytes (HBMP) comprising the BBB. We found that SDF-1 was predominantly expressed in brain pericytes, which are associated with the epigenetic regulation of histone acetylation and methylation.

520

J. Seo et al. / Biochemical and Biophysical Research Communications 382 (2009) 519–524

Materials and methods Cell culture, drug treatments, and transfection. HBMEC and HBMP were purchased from Cell Systems (Kirkland, WA) and maintained in CS-C medium (Cell Systems) on an attachment factor-coated culture dish at 37 °C under 5% CO2. The cells were incubated with 5 lM 5-aza-20 -deoxycytidine (5-Aza) (Sigma, St. Louis, MO) for 48 h or 0.3 lM trichostatin A (TSA) (Sigma) for 24 h. Amaxa nucleofection technology (Amaxa, Koeln, Germany) was used to transiently transfect the cells with 0.4 lg of pGL3-basic luciferase vector containing the SDF-1 gene promoter. The transfectants were assayed for luciferase activity using the Luciferase Assay System (Promega, Madison, WI). RT-PCR. Total RNA was isolated from cells with or without treatments using Trizol Reagent (Invitrogen, Carlsbad, CA) and then used for reverse transcription (RT) reactions. The RT reaction was performed using SuperscriptII reverse transcriptase (Invitogen) in a 20 ll reaction mixture that contained 1 lg of RNA for 1.5 h at 42 °C. PCR was then conducted using 2 ll of the RT sample in a 50 ll reaction mixture. The PCR primers are described in Table 1. Cloning of the SDF-1 promoter. Nested PCR was conducted using the forward primer [SDF-1 (F, 1394)], the reverse primer [SDF-1 (R, +359)], and genomic DNA from the HBMP as a template. The reaction product was purified using QIAquick Spin Columns (Qiagen, Hilden, Germany), after which it was amplified using nested PCR primers [SDF-1 (F, 1359, BamHI) and SDF-1 (R, ATG, HindIII)]. A pGL3-SDF-1(1359) construct was then amplified from 1359 to +114 of the first exon containing the ATG start codon. Next, the amplified PCR products were subcloned into the BamHI–HindIII site of the pGL3-basic vector (Promega). The primers are described in Table 1. High fidelity Platinum DNA Taq polymerase (Invitrogen) was used for all PCRs. DNA sequence analyses were conducted by Solgent Co. Ltd. (Daejeon, South Korea). Bisulfite-sequencing. Genomic DNA was extracted from HBMEC and HBMP using a DNeasy Blood and Tissue Kit (Qiagen). Bisulfite treatment was conducted as previously described [18]. Briefly, the genomic DNA (2 lg) was sheared by passage through a 30 g needle 15 times and then denatured by incubation in 0.3 M NaOH for 30 min at 39 °C. Next, bisulfite solution (3.9 M sodium bisulfite, 0.66 mM hydroquinone, pH 5.1) was added to the denatured DNA, which was subsequently incubated at 55 °C for 16 h. The DNA was then desalted using a Qiagen Quickspin column and mod-

ification was completed by incubation in 0.3 M NaOH at 37 °C for 15 min. The bisulfite-treated DNA was then purified using a Qiagen Quickspin column and amplified by PCR, after which the products were cloned into TOPO pCR2.1 (Invitrogen) following the manufacturer’s instructions. Fifteen clones obtained from each of the PCR products were then selected at random and sequenced. The primers used for bisulfite-sequencing are listed in Table 1. Chromatin immunoprecipitation (ChIP) assay. A ChIP assay was performed using a ChIP assay kit (Upstate, Lake Placid, NY) according to the manufacturer’s instructions. The same numbers of HBMEC and HBMP (2  106 cells per antibody) were cross-linked in 1% formaldehyde and then suspended in SDS lysis buffer (1% SDS, 10 mM EDTA and 50 mM Tris, pH 8.1). Next, the chromatin solution was sonicated, precleared and immunoprecipitated with 2 lg of desired antibodies and protein A–agarose beads. The DNA recovered after ChIP was then used for PCR with input chromatin and mock immunoprecipitations without antibody serving as controls. Antibodies against acetylated histone H3 Lysine 9 (H3K9-ace) and trimethylated H3K9 (H3K9-3me) were purchased from Upstate and trimethylated histone H3 Lysine 4 (H3K4-3me) was obtained from AbCam (Cambridge, UK). The primers used for the ChIP assay are listed in Table 1. Real-time PCR. The DNA levels of SDF-1 promoter were quantified by real-time PCR using a SensiMixPlus SYBR kit (Quantace, London, UK) with a Rotor-gene 6000 analyzer (Corbett Research, Sydney, Australia). The reaction conditions were as follows: 95 °C for 10 min, followed by 40 cycles of 95 °C for 20 s, 60 °C for 15 s, and 72 °C for 20 s. At the end of each cycle the fluorescence was measured and used for quantitation. Results SDF-1 is expressed in HBMP while its receptor CXCR4 is expressed in HBMEC The mRNA expression of SDF-1 and CXCR4 in HBMEC and HBMP was examined by semi-quantitative RT-PCR. Interestingly, SDF-1 was expressed in HBMP, not in HBMEC, while CXCR4 was exclusively expressed in HBMEC. In addition, we found that PDGF-B and PDGFR-b were expressed in EC and pericytes, respectively, which is similar to the results of previous studies [5,7,8]. These findings suggest that SDF-1 that is released by pericytes may exert its effects via binding to CXCR4 in EC. Transcriptional silencing of the SDF-1 gene in HBMEC is associated with an epigenetic regulation mechanism

Table 1 DNA sequences of PCR primers. Primers

DNA sequences

For RT-PCR SDF-1 (F) SDF-1 (R) b-Actin (F) b-Actin (R)

CCATGAACGCCAAGGTCGTG CCAGGTACTCCTGAATCCAC CCTTCAACTCCATCATGAAG CCATTCTCCTTAGAGAGAAG

For cloning SDF-1 (F, 1394) SDF-1 (R, +359) SDF-1 (F, 1359, BamHI) SDF-1 (R, ATG, HindIII)

CATCTAACGGCCAAAGTGGT TCTCTGCAGGTCACAAACCC CCCGGATCCCACAGAAGACACCTACTC CCCAAGCTTCCACGACCTTGGCGTTCAT

For bisulfite-sequencing SDF-1-BS (F1) SDF-1-BS (R1) SDF-1-BS (F2) SDF-1-BS (R2)

TTTTTTGTTTTGTTTGTATAGG TAAATAAAAACCAATAAAAAACAAACAAATTAATC GGAGTTTGAGAAGGTTAAAGGT AACTACCTCCACCCCCACTATATC

For ChIP assay SDF-1-promoter (F) SDF-1-promoter (R) b-Actin-promoter (F) b-Actin-promoter (R)

CGCCTAAGGTCCTCAGTCTC CTCCTCCGCTCCCTCTGT CCAACGCCAAAACTCTCCC AGCCATAAAAGGCAACTTTCG

To elucidate the regulatory mechanism of SDF-1 expression, we transfected the SDF-1 promoter region from 1359 to +114 [pGL3SDF-1(1359)] into HBMEC and HBMP by electroporation (Fig. 2A). The transcriptional activity was 100-fold higher in cells that were transfected with pGL3-SDF-1(1359) than in those that were transfected with pGL-Basic. Interestingly, this ectopic transfection of SDF-1 promoter resulted in a remarkable increase in transcriptional activity in HBMEC, where endogeneous SDF-1 was not expressed, as well as in HBMP. These results suggest that the SDF-1 gene is silenced in EC by chromatin-related mechanisms such as epigenetic regulations, but not by transcription factors-mediated mechanisms. To determine if epigenetic regulations such as DNA methylation or histone modifications account for the transcriptional silencing of SDF-1, EC were treated with either the DNA-demethylating agent, 5-Aza, or the histone deacetylase (HDAC) inhibitor, TSA (Fig. 2B). Both 5-Aza and TSA abolished the SDF-1 gene silencing in HBMEC, which suggests that an epigenetic mechanism plays a role in SDF-1 expression.

521

J. Seo et al. / Biochemical and Biophysical Research Communications 382 (2009) 519–524

HBMEC

HBMP

the 5-Aza treatment shown in Fig. 2B, prompted us to test the DNA methylation status of SDF-1 promoter in HBMEC. To accomplish this, the genomic DNA of HBMEC and HBMP was treated with sodium bisulfite to convert the unmethylated cytosine to uracil. Two regions of the SDF-1 gene, amplified by PCR from the bisulfite-treated genomic DNA and subsequently sequenced, included the 21 CpG sites located from 655 to 393 and the 59 CpG sites located from 217 to +206, which are commonly used in the previous studies [19–21]. As shown in Fig. 3, these CpG sites, which existed in the proximal region of promoter, exon 1, and partial intron 1 of the SDF-1 gene, were hypomethylated in HBMEC as well as HBMP. These findings indicate that SDF-1 gene silencing in HBMEC is not caused by DNA hypermethylation.

SDF-1

CXCR4

PDGF-B

Histone modifications are associated with SDF-1 gene silencing in HBMEC

PDGFR-β

β-actin

Fig. 1. SDF-1 is expressed in HBMP and its receptor, CXCR4, is expressed in HBMEC. Total RNA was extracted from confluent monolayers of HBMEC and HBMP. The same amount (1 lg) of total RNA from HBMEC and HBMP was then used to synthesize cDNA as described in Materials and methods. The mRNA expression of SDF-1, CXCR4, PDGF-B, PDGFR-b and b-actin was detected by semi-quantitative RTPCR. The results are representative of at least four experiments (n = 4).

DNA promoter methylation is not involved in SDF-1 gene silencing in HBMEC

Because TSA also induced SDF-1 expression (Fig. 2B) and SDF-1 transcription was found to be enhanced in H3K4 demethylase / mouse cells in a previous study [22], we investigated the involvement of H3K9 acetylation and H3K4 methylation in SDF-1 gene silencing using a ChIP assay. Our results showed that the levels of H3K9-ace and H3K4-3me in the promoter region of SDF-1 were significantly lower in HBMEC than in HBMP, as evidenced by both semi-quantitative PCR (Fig. 4A) and real-time PCR (Fig. 4B). In addition, H3K9 in the promoter region of SDF-1 was more trimethylated in HBMEC than in HBMP. Conversely, the level of H3K9-ace and H3K4-3me in the promoter region of b-actin, a house keeping gene, was high in both HBMEC and HBMP. These epigenetic marks, deacetylation and methylation of H3K9, and demethylation of H3K4, are indicative of a decrease in the transcriptional activity of SDF-1 in HBMEC and suggest that SDF-1 expression may be regulated by histone modifications. Discussion

A

160

Relative Luciferase Activity %

It was recently reported that SDF-1 expression was silenced or down-regulated by promoter hypermethylation in carcinoma or astrocytoma [19–21]. These reports, together with the result of

140

HBMEC

HBMP

In this study, we found that SDF-1 was differentially expressed in cells comprising the BBB. Specifically, SDF-1 was predominantly

B

80

za

A TS

co

100

5-A

ntr o

l

120

SDF-1

60

β-actin

40 20

9) 35

sic

(-1

-ba

DF -1

L3

L3

-S

pG pG

pG

L3

-S

pG

DF -1

L3

(-1

-ba

35

sic

9)

0

Fig. 2. SDF-1 gene silencing is associated with an epigenetic regulation mechanism in HBMEC. HBMEC and HBMP were transfected with an SDF-1 promoter-luciferase construct. Luciferase activity was then measured using a Luciferase Assay System, normalized to total cellular protein, and expressed relative to that of pGL3-basic in HBMEC. The results shown are means ± SD and are considered to be statistically significant at **P < 0.01 (n = 3; A). HBMEC were treated with 5 lM 5-Aza for 48 h or 0.3 lM TSA for 24 h. The mRNA expression of SDF-1 was then determined by semi-quantitative RT-PCR as described in Fig. 1. The results are representative of at least three experiments (n = 3; B).

522

J. Seo et al. / Biochemical and Biophysical Research Communications 382 (2009) 519–524

-655

-393 -217

+1

156

206

-195 -190 -183 -178 -161 -150 -127 -124 -115 -113 -111 -99 -93 -82 -76 -70 -60 -58 -56 -51 -46 -41 -19 -15 -12 -10 -8 +3 +6 +21 +28 +37 +41 +44 +48 +55 +60 +62 +66 +70 +74 +78 +82 +86 +90 +92 +101 +110 +116 +128 +137 +139 +152 +155 +164 +168 +171 +185 +200

-633 -617 -607 -604 -589 -582 -567 -554 -547 -537 -534 -528 -525 -518 -507 -491 -469 -455 -449 -434 -430

Exon1 Intron

HBMEC

HBMP

Fig. 3. DNA promoter methylation is not associated with differential expression of SDF-1. The genomic DNA extracted from HBMEC and HBMP was treated with bisulfite to convert unmethylated cytosines into uracils. Bisulfite-treated DNA was amplified by PCR and then cloned. Next, fifteen clones obtained from each of the PCR products were selected at random and sequenced. The CpG sites depicted across the first row are numbered relative to the main transcriptional start site (+1). Each subsequent row depicts the methylation status across the CpG sites in a single DNA molecule isolated by cloning. Filled and unfilled squares represent methylated and unmethylated CpG sites, respectively.

expressed in pericytes, but not in EC. Furthermore, this cell-specific expression was due to epigenetic regulation such as histone modifications, but not DNA methylation. It was previously reported that SDF-1 mRNA was present in bone marrow (BM) stromal cells, but not in HUVEC [16]. In the same report, the SDF-1 receptor, CXCR4, was expressed in HUVEC, but not in BM stromal cells. We found that this cell-specific expression of the SDF-1/CXCR4 system was reproducible under our experimental conditions (Fig. 1). Indeed, no expression of SDF-1 in EC, together with reciprocal pattern of SDF-1 and its receptor CXCR4 expressions in two vascular cells, suggests that SDF-1 expressed in pericytes may play a role in neovascularization in a paracrine manner. Previously, SDF-1 was reported to induce tube formation through phosphoinositide 3-kinase in EC [23]. In addition, the reciprocal pattern of PDGF-B expression in EC and its receptor, PDGFR-b, in pericytes is known to be essential for pericyte recruitment in angiogenic vessels [5]. Moreover, we observed upregulated Ang-1 expression in pericytes in response to hypoxia, while the expression of Ang-2, which behaves like an antagonist of Ang-1, was regulated only in EC [24]. Recent studies have shown that SDF-1 gene expression was silenced or down-regulated by promoter hypermethylation in carcinoma and astrocytoma, and that these changes in expression were associated with metastasis [19–21]. Similarly, in the present study, we found that the ectopic transfection of SDF-1 promoter into HBMEC resulted in a promoter activity as high as the activity that was observed in HBMP (Fig. 2A). These results, combined with the finding that the DNA-demethylating agent, 5-Aza, greatly induced SDF-1 expression (Fig. 2B), indicate that DNA methylation may be

involved in SDF-1 gene silencing in HBMEC. However, this assumption may not be correct because the broad SDF-1 gene region covering exon 1 and partial intron 1, as well as proximal region of promoter were hypomethylated in HBMEC (Fig. 3). Furthermore, the two vascular cells were found to have similar methylation status irrespective of their differential SDF-1 expression. Our finding that DNA methylation did not play a role in SDF-1 expression contradicts the results of previously conducted studies. These differences may be attributable to the use of different cell types: primary microvascular cells in our study versus cancer cells in previous studies. Nonetheless, we cannot completely exclude the possibility that methylation sites other than those tested in this study may be responsible for SDF-1 gene silencing, although we evaluated well-known sites that are commonly used. Because it was recently reported that 5-Aza induced hyperacetylation of centromeric heterochromatin [25] and caused H3K9 demethylation and H3K4 methylation independently of its effects on cytosine methylation [26], it is likely that the increased SDF-1 expression that was observed in response to 5-Aza treatment in HBMEC (Fig. 2B) was due to H3K4 methylation and H3K9 demethylation. These findings are similar to the results of studies conducted to evaluate the gene expression of E-cad or Runx3 in which the response to 5-Aza was not associated with promoter methylation status [27,28]. It is well known that deacetylation and methylation of H3K9 generate a more compact chromatin configuration via increased ionic interaction between positively charged lysines of histones and negatively charged DNA. This heterochromatin formation makes chromatin inaccessible to transcriptional factors, which induces transcriptional suppression [29].

523

J. Seo et al. / Biochemical and Biophysical Research Communications 382 (2009) 519–524

A

input EC

mock P

EC

H3K9-ace P

EC

H3K4-3me

P

EC

P

H3K9-3me EC

P

SDF-1 β-actin

B

4.5

*

4 3.5

ChI P / input

3 2.5 HBMEC

2

HBMP

1.5 1 0

** H3k9-ace

** H3k4-3me

H3k9-3me

Fig. 4. SDF-1 expression is repressed by histone modifications in HBMEC. ChIP analysis was performed with antibodies specific for acetylated H3K9 (H3K9-ace), trimethylated H3K4 (H3K4-3me) and trimethylated H3K9 (H3K9-3me). The DNA purified after ChIP was evaluated by semi-quantitative PCR (A) and real-time PCR (B). Input represents amplification of the total input DNA from whole cell lysates. Mock represents ChIP samples analyzed without antibody (A). The amount of DNA after the ChIP assay was normalized to the input DNA level and expressed relative to that of HBMP (B). The results shown are the mean ± SD and are considered to be statistically significant at * P < 0.05 and **P < 0.01 (n = 3; (B). EC, HBMEC; P, HBMP.

Furthermore, it has been reported that the methylation of H3K4 is linked with actively transcribed euchromatin [30]. Thus, it is likely that the SDF-1 gene silencing in HBMEC may result from histone modifications. The induction of SDF-1 expression in response to the HDAC inhibitor, TSA, that was observed in HBMEC in the present study provides further evidence of the involvement of histone modifications in SDF-1 expression. Although we found the differential expression of SDF-1 between EC and pericytes, further study is warranted to explain its biological significance. Previously, it was reported that in ischemic EC, SDF-1 expression was directly induced by the angiogenic factor such as a hypoxia-inducible factor [31]. Later, this elevated SDF-1 was shown to indeed promote tumor cell growth [32]. Recent study also demonstrated that both increased SDF-1 expression and disruption of its polarity were found in active lesions in multiple sclerosis, which resulted in the transendothelial migration and infiltration of leukocytes into the brain and consequently dysregulation of BBB function [11]. All these findings suggest that SDF-1 is highly associated with active angiogenesis and metastasis. Therefore, the suppression of SDF-1 expression in basal EC by histone modifications from our study is important for the maintenance of BBB integrity and the normal function of vessels. Whether histone modifications also play a role in increasing SDF-1 expression in pathological state warrants further investigation. In conclusion, the results of this study demonstrated that the differential expression of SDF-1 in EC and pericytes, the major components of the BBB, was regulated by epigenetic modifications of histone acetylation and methylation, but not of DNA methylation.

Acknowledgments This work was supported in part by the Korean Food and Drug Administration grant (08512KFDA418) and the Korea National Institute of Health intramural research grant (348-6111-213-000207). References [1] P. Ballabh, A. Braun, M. Nedergaard, The blood–brain barrier: an overview: structure, regulation, and clinical implications, Neurobiol. Dis. 16 (2004) 1–13. [2] G. Allt, J.G. Lawrenson, Pericytes: cell biology and pathology, Cells Tissues Organs 169 (2001) 1–11. [3] R. Balabanov, P. Dore-Duffy, Role of the CNS microvascular pericyte in the blood–brain barrier, J. Neurosci. Res. 53 (1998) 637–644. [4] R. Bandopadhyay, C. Orte, J.G. Lawrenson, A.R. Reid, S. De Silva, G. Allt, Contractile proteins in pericytes at the blood–brain and blood–retinal barriers, J. Neurocytol. 30 (2001) 35–44. [5] P. Lindahl, B.R. Johansson, P. Leveen, C. Betsholtz, Pericyte loss and microaneurysm formation in PDGF-B-deficient mice, Science 277 (1997) 242–245. [6] S. Yamagishi, C.C. Hsu, K. Kobayashi, H. Yamamoto, Endothelin 1 mediates endothelial cell-dependent proliferation of vascular pericytes, Biochem. Biophys. Res. Commun. 191 (1993) 840–846. [7] M. Hellstrom, M. Kalen, P. Lindahl, A. Abramsson, C. Betsholtz, Role of PDGF-B and PDGFR-beta in recruitment of vascular smooth muscle cells and pericytes during embryonic blood vessel formation in the mouse, Development 126 (1999) 3047–3055. [8] K.K. Hirschi, S.A. Rohovsky, L.H. Beck, S.R. Smith, P.A. D’Amore, Endothelial cells modulate the proliferation of mural cell precursors via platelet-derived growth factor-BB and heterotypic cell contact, Circ. Res. 84 (1999) 298–305. [9] K. Rostasy, C. Egles, A. Chauhan, M. Kneissl, P. Bahrani, C. Yiannoutsos, D.D. Hunter, A. Nath, J.C. Hedreen, B.A. Navia, SDF-1alpha is expressed in astrocytes and neurons in the AIDS dementia complex: an in vivo and in vitro study, J. Neuropathol. Exp. Neurol. 62 (2003) 617–626.

524

J. Seo et al. / Biochemical and Biophysical Research Communications 382 (2009) 519–524

[10] M. Krumbholz, D. Theil, S. Cepok, B. Hemmer, P. Kivisakk, R.M. Ransohoff, M. Hofbauer, C. Farina, T. Derfuss, C. Hartle, J. Newcombe, R. Hohlfeld, E. Meinl, Chemokines in multiple sclerosis: CXCL12 and CXCL13 up-regulation is differentially linked to CNS immune cell recruitment, Brain 129 (2006) 200–211. [11] E.E. McCandless, L. Piccio, B.M. Woerner, R.E. Schmidt, J.B. Rubin, A.H. Cross, R.S. Klein, Pathological expression of CXCL12 at the blood–brain barrier correlates with severity of multiple sclerosis, Am. J. Pathol. 172 (2008) 799–808. [12] E.E. McCandless, Q. Wang, B.M. Woerner, J.M. Harper, R.S. Klein, CXCL12 limits inflammation by localizing mononuclear infiltrates to the perivascular space during experimental autoimmune encephalomyelitis, J. Immunol. 177 (2006) 8053–8064. [13] M. Malik, Y.Y. Chen, M.F. Kienzle, B.E. Tomkowicz, R.G. Collman, A. Ptasznik, Monocyte migration and LFA-1-mediated attachment to brain microvascular endothelia is regulated by SDF-1alpha through Lyn kinase, J. Immunol. 181 (2008) 4632–4637. [14] P. Cipriani, A. Franca Milia, V. Liakouli, A. Pacini, M. Manetti, A. Marrelli, A. Toscano, E. Pingiotti, A. Fulminis, S. Guiducci, R. Perricone, B. Kahaleh, M. Matucci-Cerinic, L. Ibba-Manneschi, R. Giacomelli, Differential expression of stromal cell-derived factor 1 and its receptor CXCR4 in the skin and endothelial cells of systemic sclerosis patients: Pathogenetic implications, Arthritis Rheumatism 54 (2006) 3022–3033. [15] P. Lai, T. Li, J. Yang, C. Xie, X. Zhu, H. Xie, X. Ding, S. Lin, S. Tang, Upregulation of stromal cell-derived factor 1 (SDF-1) expression in microvasculature endothelial cells in retinal ischemia-reperfusion injury, Graefes Arch. Clin. Exp. Ophthalmol. 246 (2008) 1707–1713. [16] H.J. Yun, D.Y. Jo, Production of stromal cell-derived factor-1 (SDF-1) and expression of CXCR4 in human bone marrow endothelial cells, J. Korean Med. Sci. 18 (2003) 679–685. [17] J. Middleton, S. Neil, J. Wintle, I. Clark-Lewis, H. Moore, C. Lam, M. Auer, E. Hub, A. Rot, Transcytosis and surface presentation of IL-8 by venular endothelial cells, Cell 91 (1997) 385–395. [18] A.M. Lindroth, Y.J. Park, C.M. McLean, G.A. Dokshin, J.M. Persson, H. Herman, D. Pasini, X. Miro, M.E. Donohoe, J.T. Lee, K. Helin, P.D. Soloway, Antagonism between DNA and H3K27 methylation at the imprinted Rasgrf1 locus, PLoS Genet. 4 (2008) e1000145. [19] M.K. Wendt, P.A. Johanesen, N. Kang-Decker, D.G. Binion, V. Shah, M.B. Dwinell, Silencing of epithelial CXCL12 expression by DNA hypermethylation promotes colonic carcinoma metastasis, Oncogene 25 (2006) 4986–4997. [20] W. Zhou, Z. Jiang, N. Liu, F. Xu, P. Wen, Y. Liu, W. Zhong, X. Song, X. Chang, X. Zhang, G. Wei, J. Yu, Down-regulation of CXCL12 mRNA expression by promoter hypermethylation and its association with metastatic progression in human breast carcinomas, J. Cancer Res. Clin. Oncol. 135 (2009) 91–102.

[21] W. Zhou, Z. Jiang, X. Song, Y. Liu, P. Wen, Y. Guo, F. Xu, L. Kong, P. Zhang, A. Han, J. Yu, Promoter hypermethylation-mediated down-regulation of CXCL12 in human astrocytoma, J. Neurosci. Res. 86 (2008) 3002–3010. [22] R.J. Klose, Q. Yan, Z. Tothova, K. Yamane, H. Erdjument-Bromage, P. Tempst, D.G. Gilliland, Y. Zhang, W.G. Kaelin Jr., The retinoblastoma binding protein RBP2 is an H3K4 demethylase, Cell 128 (2007) 889–900. [23] S. Kanda, Y. Mochizuki, H. Kanetake, Stromal cell-derived factor-1alpha induces tube-like structure formation of endothelial cells through phosphoinositide 3-kinase, J. Biol. Chem. 278 (2003) 257–262. [24] Y.S. Park, N.H. Kim, I. Jo, Hypoxia and vascular endothelial growth factor acutely up-regulate angiopoietin-1 and Tie2 mRNA in bovine retinal pericytes, Microvasc. Res. 65 (2003) 125–131. [25] S. Takebayashi, M. Nakao, N. Fujita, T. Sado, M. Tanaka, H. Taguchi, K. Okumura, 5-Aza-20 -deoxycytidine induces histone hyperacetylation of mouse centromeric heterochromatin by a mechanism independent of DNA demethylation, Biochem. Biophys. Res. Commun. 288 (2001) 921– 926. [26] C.T. Nguyen, D.J. Weisenberger, M. Velicescu, F.A. Gonzales, J.C. Lin, G. Liang, P.A. Jones, Histone H3-lysine 9 methylation is associated with aberrant gene silencing in cancer cells and is rapidly reversed by 5-aza-20 -deoxycytidine, Cancer Res. 62 (2002) 6456–6461. [27] Y. Liu, Y. Hong, Y. Zhao, T.M. Ismail, Y. Wong, K.W. Eu, Histone H3 (lys-9) deacetylation is associated with transcriptional silencing of E-cadherin in colorectal cancer cell lines, Cancer Investig. 26 (2008) 575–582. [28] S.H. Lee, J. Kim, W.H. Kim, Y.M. Lee, Hypoxic silencing of tumor suppressor RUNX3 by histone modification in gastric cancer cells, Oncogene 28 (2009) 184–194. [29] T. Kouzarides, Chromatin modifications and their function. Cell 128 (2007) 693–705. [30] A.J. Ruthenburg, C.D. Allis, J. Wysocka, Methylation of lysine 4 on histone H3: intricacy of writing and reading a single epigenetic mark, Mol. Cell 25 (2007) 15–30. [31] D.J. Ceradini, A.R. Kulkarni, M.J. Callaghan, O.M. Tepper, N. Bastidas, M.E. Kleinman, J.M. Capla, R.D. Galiano, J.P. Levine, G.C. Gurtner, Progenitor cell trafficking is regulated by hypoxic gradients through HIF-1 induction of SDF-1, Nat. Med. 10 (2004) 858–864. [32] A. Orimo, P.B. Gupta, D.C. Sgroi, F. Arenzana-Seisdedos, T. Delaunay, R. Naeem, V.J. Carey, A.L. Richardson, R.A. Weinberg, Stromal fibroblasts present in invasive human breast carcinomas promote tumor growth and angiogenesis through elevated SDF-1/CXCL12 secretion, Cell 121 (2005) 335–348.