- Email: [email protected]
Differential expression of the soybean BiP gene family
Plant Science 160 (2001) 273 – 281 www.elsevier.com/locate/plantsci
Differential expression of the soybean BiP gene family Ju´lio Ce´zar M. Cascardo a,1, Reginaldo A.A. Buzeli a, Raul S. Almeida b, Wagner C. Otoni a, Elizabeth P.B. Fontes b,* b
a Departamento de Biologia Vegetal, Uni6ersidade Federal de Vic¸osa, 36571.000 Vic¸osa MG, Brazil Departamento de Bioquı´mica e Biologia Molecular/BIOAGRO, Uni6ersidade Federal de Vic¸osa, 36571.000 Vic¸osa MG, Brazil
Received 9 June 2000; received in revised form 5 September 2000; accepted 5 September 2000
Abstract The soybean binding protein (BiP) gene family consists of at least four members designated soyBiPA, soyBiPB, soyBiPC and soyBiPD. We have performed immunoblotting of two-dimensional (2D) gels and RT-PCR assays with gene-specific primers to analyze the differential expression of this gene family in various soybean organs. The 2D gel profiles of the BiP forms from different organs were distinct and suggested that the BiP genes are under organ-specific regulation. In fact, while all four BiP transcripts were detected in leaves by gene-specific reverse transcriptase – polymerase chain reaction (RT-PCR) assays, different subsets were detected in the other organs. The soyBiPD was expressed in all organs, whereas the expression of the soyBiPB was restricted to leaves. The soyBiPA transcripts were detected in leaves, roots and seeds and soyBiPC RNA was confined to leaves, seeds and pods. Our data are consistent with organ-specific expression of the soybean BiP gene family. © 2001 Elsevier Science Ireland Ltd. All rights reserved. Keywords: Binding protein; Molecular chaperone; Organ-specific regulation
1. Introduction The molecular chaperone binding protein (BiP) is an endoplasmic reticulum (ER)-localized member of the stress-induced family of heat shock protein (HSP70) that transiently interacts with a wide variety of cellular proteins [1]. BiP plays an important role in nascent protein translocation across the ER membrane and assists proper folding and maturation of newly synthesized proteins as they enter the organelle. Association of BiP Abbre6iations: BiP, binding protein; bp, base pair(s); DNase, deoxyribonuclease; DTT, dithiothreitol; EDTA, ethylenediaminetetraacetic acid; ER, endoplasmic reticulum; GRP78, 78-kDa glucose regulated protein (BiP); HSP70, 70-kDa heat shock protein; IEF, isoelectric focusing; PAGE, polyacrylamide-gel electrophoresis; RNase, ribonuclease; RT-PCR, reverse transcription-polymerase chain reaction; SDS, sodium dodecyl sulfate; U, unit(s). * Corresponding author. Tel.: +55-31-8992949; fax: + 55-318992864. E-mail address: [email protected] (E.P.B. Fontes). 1 Present address: Departmento de Gene´tica-UESC, Rodovia Itabuna-Ilhe´us, Km 16, 45650.000, Ilhe´us BA, Brazil.
with secretory proteins prevents nonproductive intermolecular interactions of folding intermediates and subsequent misaggregation of proteins within the lumen of the ER (reviewed in [2]). Recently, BiP has also been shown to participate directly in a mechanism to control the permeability of the ER membrane by sealing the ER lumenal side of ribosome-free translocon pores [3]. The ER-molecular chaperone proteins are expressed constitutively at low levels in all cells but are induced upon accumulation of unfolded protein in the lumen of the ER by a signaling cascade, designated the unfolded protein response (UPR) pathway [4–6]. This signal transduction pathway is characterized by the coordinated transcriptional up-regulation of BiP and other ER proteins, which are involved in folding and assembly of nascent proteins. The inter-organelle signaling cascade, which has been elucidated in yeast, involves an ER transmembrane kinase and a basic-leucine zipper transcription factor, Hac1p,
0168-9452/01/$ - see front matter © 2001 Elsevier Science Ireland Ltd. All rights reserved. PII: S 0 1 6 8 - 9 4 5 2 ( 0 0 ) 0 0 3 8 4 - 8
274
J.C.M. Cascardo et al. / Plant Science 160 (2001) 273–281
whose level is modulated by a regulated spliceosome-independent mRNA splicing event (reviewed in [7]). Regulation of plant BiP gene expression has been examined primarily by the detection of BiP RNA and protein levels under stress conditions and at different developmental stages of the plant organs (reviewed in [8]). In general, developmental events that are associated with high secretory activity of the cells and exposure of cells to agents that impair protein folding in the ER cause induction of plant BiP (reviewed in [9,10]). In the floury2 mutant of maize, the synthesis of a zein-like storage protein variant, which contains an uncleavable signal sequence, is associated with increased accumulation of BiP [11–14]. Expression of an assembly-defective mutant of the bean storage protein phaseoline also induces BiP synthesis in tobacco leaf protoplasts [15]. Furthermore, tunicamycin, a potent activator of the UPR pathway, efficiently induces BiP expression at both mRNA and protein level in several plant systems [12,16]. These results have led to the conclusion that, like mammal and yeast BiP, plant BiP is most likely regulated through an UPR pathway. This idea is supported by the observation that overexpression of BiP in tobacco leaf protoplasts attenuates ER stress caused by tunicamycin and prevents activation of the UPR pathway [17]. Plant BiP expression has also been shown to respond to a variety of abiotic and biotic stress conditions, such as water stress, fungus infestation, insect attack, nutritional stress, cold acclimation and elicitors of the plant-pathogenesis response [18 – 22]. Recent studies on plant BiP induction in response to physiological stress conditions have demonstrated that multiple, complex regulatory mechanisms control BiP gene expression in plants. During plant-pathogenesis interactions and under osmotic stress condition, the induction of BiP has been shown to be triggered by signaling pathways distinct from the UPR pathway [23,24]. Furthermore, in some plant species, specific stress conditions and developmental events alter BiP mRNA and protein levels to different extents, suggesting that post-transcriptional mechanisms are also involved in the regulation of BiP synthesis in plants [18,20]. Alternatively or additionally, these discrepancies between the level of BiP mRNA and protein may reflect differential expression and regulation of
plant BiP gene families, since the genome of several plant species is represented by multiple BiP genes [20,25,26]. In soybean, three distinct BiP cDNAs have been isolated from a leaf library [20], and one has been identified in a seed cDNA expression library [21]. Recently, we have shown that the soybean BiP genes are differentially regulated by abiotic stresses [24]. In this paper, we extended the analysis on the soybean BiP gene family expression. We have used two-dimensional (2D) gel electrophoresis and reverse transcriptase-polymerase chain reaction (RT-PCR) assays to demonstrate that the soybean BiP genes are under organ-specific regulation.
2. Materials and methods
2.1. Plant materials Soybean plants (Glycine max cv. Cristalina) were germinated in 5-l pots containing a mixture of soil, sand and dung (3:1:1) and grown in standardized greenhouse conditions. Plant tissues were harvested, immediately frozen in liquid nitrogen and stored at −80°C.
2.2. Whole cell protein extraction Total protein was extracted from an acetone dry powder, using a protocol adapted from Go¨rg et al. [27]. Briefly, plant tissues were crushed in liquid nitrogen and 2 g of the powder were homogenized with 10% (w/v) trichloroacetic acid (TCA) in acetone containing 0.07% (v/v) 2-mercaptoethanol. Total protein was precipitated for 40 min at − 20°C, recovered by centrifugation at 16 000 × g for 15 min and washed two to three times with acetone containing 0.07% (v/v) 2-mercaptoethanol. The pellet was dried under vacuum and 30 mg of the acetone dry powder was resuspended in 1 ml of lysis buffer (9 M urea, 2% (v/v) Triton X-100, 2% (v/v) 2-mercaptoethanol, 0.8% (v/v) Ampholines (pH 5–7), 0.2% (v/v) Ampholines (pH 3.5– 10), 8 mM PMSF) followed by ultrasonication on ice. Cell debris was removed by centrifugation at 30 000 × g for 15 min and protein concentration was determined as described by Hill and Straka [28].
J.C.M. Cascardo et al. / Plant Science 160 (2001) 273–281
275
2.3. 2D gel electrophoresis and immunoblotting
2.5. RT-PCR
2D gel electrophoresis was performed as described by O’Farrell [29]. For the first dimension, 30 – 50 mg of protein were loaded on isoelectric focusing tube gels (Bio–Rad), in which the pH gradient was established with 80% pH 5–7 and 20% pH 3.5 – 10 Ampholines (Amersham Pharmacia Biotech.). After electrophoresis at 750 V for 3.5 h, the gels were equilibrated with buffer A (5 mM Tris– HCl pH 6.8, 6 M urea, 30% (v/v) glycerol and 2% (w/v) sodium dodecyl sulfate (SDS) and stored at −80°C. Prior to the second dimension, the gels were re-equilibrated for 15 min with buffer A containing 65 mM DTT and then for 15 min with buffer A containing 65 mM DTT and 260 mM iodoacetamide. SDS-polyacrylamide-gel electrophoresis (PAGE) was carried out as described previously [30], and the proteins were transferred from 10% SDS-polyacrylamide gels to nitrocellulose membranes by electroblotting. Immunoblot analyses were performed using polyclonal antiBiP-carboxy antibody [21] at a 1:1000 dilution and a goat anti-rabbit IgG alkaline phosphatase conjugate (Sigma) at a 1:5000 dilution. Alkaline phosphatase activity was assayed using 5-bromo-4-chloro-3-indolyl phosphate (Life Technologies, Inc.) and p-nitroblue tetrazolium (NBT) (Life Technologies, Inc.). The pH gradient of the isoelectric focusing gels was determined by incubating 0.2 cm mock loaded gel slices in 2 ml of H2O at room temperature for 12 h with shaking. The pH of each gel slice was measured and plotted as a function of the distance from the anode. Pre-stained molecular markers were electrophoresed in the second dimension and served as a reference point for comparison of the different gels.
Total RNA from seeds, leaves, roots and pods was extracted as described using an RNAeasy kit (Qiagen). The RNA was treated with 2 U of RNase-free DNase (Promega) in 20 mM Tris– HCl pH 8.4, 50 mM KCl and 2 mM MgCl2 at 37°C for 1 h and recovered by ethanol precipitation. First strand cDNA was synthesized from 2–5 mg total RNA using the SuperScript II Kit (Life Technologies, Inc.) according to the manufacturer’s instructions. PCR assays were performed with soyBiPA-, soyBiPB-, soyBiPC- [20] or soyBiPD[21] specific primers (Table 1). A typical reaction consisted of 2 ml of the reverse transcription reaction, 200 mM each of dNTPs, 100 nM each of sense and antisense gene-specific primers, 1 X PCR buffer (10 mM Tris–HCl pH 8.3, 50 mM KCl, 2.5 mM MgCl2) and 1 U of Taq DNA polymerase (Life Technologies, Inc.) in a total volume of 30 ml. The presence of contaminating DNA was assessed in control reactions conducted without reverse transcriptase. The reactions were performed for 35 cycles (30 s at 94°C, 30 s at 52°C, and 1 min at 72°C), with a final extension at 72°C for 10 min. For RNA abundance assays, the number of cycles was reduced to 25. The reaction products were separated by electrophoresis on 1% agarose/Tris – borate-ethylenediaminetetraacetic acid (EDTA) gels and visualized with ethidium bromide-staining under UV transillumination. PCR assays were also carried out with soybean Actin 3 gene-specific primers (GenBank™ accession number J01297) to assess the quantity and quality of the cDNA. The upstream primer 5%-cccctcaacccaaaggtcaacag-3% (coordinates 614–636) and the downstream primer 5%-ggaatctctctgccccaattgtg-3% (positions 2011–2024) amplify a 440-bp fragment from the Actin 3 cDNA and a 520-bp fragment, including an 81-bp intron, from genomic DNA.
2.4. Dephosphorylation assays For the dephosphorylation assays, total protein extracts were dialyzed against 10 mM Tris–HCl pH 7.5, 10 mM MgCl2, 50 mM potassium acetate and 4 mM PMSF and treated with 4 U of alkaline phosphatase (Amersham Pharmacia Biotech.) for 2 h at 37°C. Following phosphatase treatment, the proteins were dialyzed against 40 mM Tris–HCl pH 7.5 and 1 mM PMSF, concentrated by freezedrying and resuspended in lysis buffer. The integrity of the proteins was monitored by SDS-PAGE.
3. Results
3.1. 2D gel analysis of BiP isoforms and their relati6e organ distribution To identify and characterize the soybean BiP isoforms, total protein was extracted from different organs of soybean plants, resolved by 2D gel
J.C.M. Cascardo et al. / Plant Science 160 (2001) 273–281
276
electrophoresis, transferred to nitrocellulose and probed with an anti-soybean BiP serum. The polyclonal antibody, which recognizes the carboxy-terminus of soybean BiP, discriminates between BiP and the cytoplasmic HSP70 protein [21]. In Fig. 1, differential pattern of BiP isoform accumulation or modification was observed in seeds, roots, pods and leaves. Three isoforms with pI of 5.5–5.7 were detected in seed extracts (Fig. 1A), while at least four distinct BiP isoforms (pI 5.6, 5.7, 6.0 and 6.1) in approximately equimolar amounts were resolved in root extracts (Fig. 1C). BiP isoforms from pod (Fig. 1E) and leaf (Fig. 1G) extracts were resolved as clusters at slightly different isoelectric points (pI 5.6–6.1 and pI 5.7–6.1, respectively). We have recently demonstrated that soybean BiP exists in interconvertible phosphorylated and non-phosphorylated forms and the equilibrium can be shifted to either direction in response to different stimuli [24]. To identify whether the apparent isoforms are products of different genes or are differentially processed forms of the same polypeptide, the extracts were treated with alkaline phosphatase prior to electrophoresis. Dephosphorylation of the BiP isoforms from roots, leaves and pods caused a shift in their isoelectric focusing positions, but did not alter the number or staining intensity of the BiP polypeptides (Fig. 1C–H, compare AP − and +). The effectiveness of the alkaline phosphatase
treatment was confirmed by complete removal of radiolabeled phosphate incorporated into the protein (11, 12, 24 and data not shown). Thus, the multiplicity of BiP polypeptides on 2D gels is not due to different phosphorylation levels of the same protein in pods, leaves and roots. In contrast, after phosphatase treatment, the pI 5.5 and 5.6 BiP forms from seeds co-migrated as a single species, whereas the pI 5.7 BiP form remained distinct (compare Fig. 1A and B). These results indicate that the pI 5.5 and the pI 5.6 BiP isoforms are most likely variants of the same polypeptide. The pI 5.7 form does not constitute a non-phosphorylated version of the more acidic ones, but might represent a distinct BiP polypeptide. Since mammals and plant BiP are also modified by ADP-ribosylation [12,31] the removal of ADPribose by phosphodiesterase was included in the assays. These experiments showed that incorporation of ADP-ribose into the soybean BiP forms does not cause detectable shifts in their isoelectric states on IEF gels (data not shown). Thus, the charge heterogeneity of the resolved polypeptides is not likely due to ADP-ribosylation.
3.2. Soybean BiP gene family and gene-specific primers Although our results do not completely rule out the possibility that as yet uncharacterized post-
Table 1 Gene-specific primersa Primer
BiPAF BiPAR BiPBF BiPBR BiPCF BiPCR BiPDF BiPDR a
Sequence
CGAGCTCTAGAGATGTTGTTGCTT TACGTAGACGGCTGTAGTTCC TGAGCTCTAGTTAGTCGGAGTCTG CGATCGGCACGAGGAAGTTG CGAGCGCACCTTCAACTTAACC CAACATGGCCATTCTTGTAAACACCG ATCTGGAGGAGCCCTAGGCGGTGG CTTGAAGAAGCTTCGTCGTAAAACTAAG
Annealing sequence (% identity) BiPA
BiPB
BiPC
BiPD
100 100 45.8 40 22.7 92 62.9 44
46.2 0 100 100 27.3 46 100 70
ND ND ND ND 100 100 ND ND
41.7 0 58.3 45 9 92 100 100
Annealing Position (cognate cDNA)
2044 2317 2080 2259 12 260 1966 2184
The annealing position corresponds to the nucleotide position in the cognate cDNA in which the 5% nucleotide of the primer sequence anneals. The numbering scheme was taken considering the first nucleotide of the BiP cDNA sequence in the GeneBank™ (accessions U08384, U08383, U08382 and AF031241) as the nucleotide +1. F and R following the name of the primers refer to forward and reverse, respectively.
J.C.M. Cascardo et al. / Plant Science 160 (2001) 273–281
Fig. 1. Immunoblot analysis of BiP isoforms from different soybean organs. Soluble proteins extracted from seeds (A and B), roots (C and D), pods (E and F) and leaves (G and H), with ( +) and without ( −) alkaline phosphatase (AP) treatment, were resolved by 2D IEF/SDS-PAGE. The second dimension gels were 10% SDS-polyacrylamide gels, except for panels A and B, which were 8% SDS-polyacrylamide gels. After electrophoresis, the proteins were transferred to nitrocellulose and probed with an anti-soybean BiP serum. The pH gradient (pI) is shown at the bottom and pre-stained molecular markers (M) are on the left. Arrows show the position of individual BiP polypeptides. Absence of arrows indicates that BiP polypeptides were resolved as clusters.
translational modifications cause the relative shift in the isoelectric focusing position of the BiP forms, they are consistent with an organ-specific expression of the soybean BiP gene family. To address this possibility, we investigated the expression patterns of the four cloned BiP genes by RT-PCR with gene-specific primers. The gene-specific primers were designed to take advantage of the most divergent sequences of the known BiP cDNAs, which differ most in their 5% and the 3% untranslated sequences (Table 2). Consequently, primer sets were designed to amplify small frag-
277
ments from either 3% or 5% ends of the genes (Table 1). The set of forward and reverse primers were 100% complementary to the annealing sequences of their cognate cDNA, while they were a minimum of four mismatches to the other cDNAs. Fig. 2A indicates that the A primers amplified the correctly sized fragment from soyBiPA-specific plasmid DNA (lane 1), but did not amplify any fragment from recombinant lambda DNA harboring soyBiPD sequence (lane 8). Likewise the D primers amplified the predicted sized fragment from the soyBiPD-specific recombinant lambda DNA (lane 5), but failed to amplify any fragment from plasmid DNA harboring the soyBiPA sequence (lane 4). Both B and C primers failed to amplify soyBiPA (lanes 2 and 3) and soyBiPDspecific sequences (lanes 7 and 6), but not a soybean genomic DNA sequence (data not shown). These results indicate that under the conditions used for the PCR analyses, the A and D primers are gene-specific and do not cross-amplify a noncognate BiPA or BiPD gene sequence. The sets of B and C primers are capable of discriminating between sequences present in the soybean genome and BiPA or BiPD-specific sequences. Since soyBiPB and soyBiPC DNA are no longer available, the specificity of B and C primers was confirmed further by sequencing the amplified fragments from leaf cDNA. For the RT-PCR assays, the integrity and amount of the cDNA prepared from different organs of soybean plants were routinely assessed with actin-specific primers (Fig. 2B). The actin primers were designed to amplify a 580-bp fragment from genomic DNA (Fig. 2B, lane 1) and a 440-bp fragment from actin cDNA (lane 2), such that the presence of contaminating genomic DNA could be easily assessed in our cDNA preparations (lane 3). DNA contamination was also monitored in control reactions conducted without reverse transcriptase (lane 4).
3.3. Members of the soybean BiP family display differential pattern of expression As previous work has demonstrated that soybean BiP is temporally regulated in seeds, leaves and roots, we analyzed the individual pattern of BiP transcript accumulation in these organs predominantly at mid-maturation stage [20,32]. The results of RT-PCR with gene-specific primers
J.C.M. Cascardo et al. / Plant Science 160 (2001) 273–281
278
Table 2 Nucleotide sequence identity between the soybean BiP cDNAsa Region
Full length cDNA Coding region 5%-untranslated 3%-untranslated
Pairwise comparison (% identity) A×B
A×C
A×D
B×C
B×D
80 90 41 61
83 89 37 ND
83 91 57 61
89 92 61 ND
96 97 65 93
C×D 88 93 71 ND
a
The degree of identity between the various regions of the soybean BiP genes was analyzed using the CLUSTAL-W program. A, B, C and D refer to soyBiPA, soyBiPB, soyBiPC and soyBiPD cDNAs, respectively (GeneBank™ accessions U08384, U08383, U08382 and AF031241).
show that the soybean BiP genes have different profiles of organ expression (Fig. 3). The four BiP genes are expressed in leaves, as judged by amplification of the expected sized fragment from unstressed leaf cDNA with our gene-specific primers (Fig. 3, lanes C). Nevertheless, except for the soyBiPD whose mRNA was detected in all organs analyzed (lanes BiPD), soyBiPA, soyBiPB and soyBiPC were differentially expressed. The soyBiPA mRNA was detected in leaves, roots and seeds but not in pods (lanes BiPA). Transcripts of the soyBiPC gene were absent in roots, but were detected in leaves, pods and seeds (lanes BiPC). The soyBiPB expression seems to be restricted to leaves because the soyBiPB-specific primers failed to amplify the cDNA from seeds, pods and roots (lanes BiPB). The general profile of organ expression was unchangeable at distinct stage of development. The integrity and amount of the cDNA from different organs were assessed with actin-specific primers (lanes actin).
different organs and we showed that the soybean BiP gene family is under organ-specific regulation. The results of our 2D gel electrophoresis demonstrated that the patterns displayed by the BiP forms from different soybean organs are distinct. Furthermore, RT-PCR experiments using genespecific primers established that three of the soybean BiP genes are differentially expressed in different organs.
4. Discussion In contrast to mammals and yeast, the genome of several plant species, such as maize, tobacco and soybean, is represented by multiple copies of BiP genes [20,25,26]. This observation has raised the possibility that individual members of the plant BiP gene family exhibit differential regulation, function or substrate specificity [20,26]. In support of this hypothesis, we have previously demonstrated that the soybean BiP gene family is differentially regulated in response to abiotic stress conditions [24]. Here we investigated the individual contribution of the members of this family to the general pattern of BiP expression observed in
Fig. 2. Specificity of the soyBiP primers. (A) PCR assays were performed using either soyBiPA plasmid DNA or soyBiPD l recombinant DNA as substrate for Taq polymerase and the BiPA primers (lanes 1 and 8), BiPB primers (lanes 2 and 7), BiPC primers (lanes 3 and 6) or BiPD primers (lanes 4 and 5). M corresponds to DNA standard markers indicated on the left in bp. P marks the position of the primers. (B) Soybean genomic DNA (lane 1), cDNA prepared from DNase-treated leaf RNA (lane 2) and cDNA prepared from untreated-leaf RNA (lane 3) were used as substrate for Taq polymerase in PCR assays with actin 3-specific primers. In lane 4, the reverse transcriptase was omitted from the RT-PCR assay. M corresponds to DNA standard markers whose sizes are shown on the left in bp.
J.C.M. Cascardo et al. / Plant Science 160 (2001) 273–281
Fig. 3. Organ-specific expression of the soybean BiP gene family. RT-PCR assays were performed with cDNA prepared from leaf (L), pod (P), root (R) or seed (S) polyA+mRNA using the soyBiPB- (BiPB), soyBiPA- (BiPA), soyBiPC(BiPC) or soyBiPD- (BiPD) specific primers. Numbers on the left correspond to the sizes of DNA standard markers in bp.
Since precise information about the copy number of BiP genes in the soybean genome is not available, we can not rule out the possibility that the gene-specific primers recognized as yet uncharacterized BiP genes in the RT-PCR assays. Nevertheless, this possibility does not invalidate the interpretation that expression of the soybean BiP gene family is differentially regulated for two reasons. First, despite size differences of soyBiP 3% untranslated regions, the fragment sizes that were amplified by the gene-specific primers were consistently identical to the ones predicted from their cognate cDNAs. Second, some primers failed to recognize any transcripts from some organs. These data demonstrated that neither the cognate gene nor a putative closely related uncharacterized BiP gene is expressed in that particular organ. The 2D profile of BiP isoforms observed in distinct organs did not correlate reasonably well with the transcript accumulation of individual members of the gene family. Although four distinct BiP species from roots could be detected in our 2D electrophoresis (Fig. 1D), only the soyBiPA and soyBiPD transcripts were detected in this organ. This result may reflect the existence of additional copies of uncharacterized BiP genes in the soybean genome. Alternatively or additionally, it might indicate that differential post-translational modification other than phosphorylation would be responsible for the charge heterogeneity of BiP species detected in roots. This latter alternative is further supported by the fact that the number of unphosphorylated BiP species (Fig. 1B) was lower than the individual BiP transcripts detected in seeds (Fig. 3). In fact, the differences in the predicted isoelectric points of the soyBiPA-, soyBiPB-
279
and soyBiPD- full-length cDNA encoded products, which differ by only 0.03 or at maximum 0.06 pI units to each other, support the notion that some BiP isoforms may not be resolved in our 2D gel system. While these observations are consistent with the poor resolution of pod and leaf soybean BiP isoforms (Fig. 1F and H), they do not allow us to identify the BiP isoforms displayed in the 2D gel profiles of different organs. Further studies will be necessary to recognize and designate the different BiP isoforms in our 2D gel system. The members of the soybean BiP gene family have been isolated from leaf and seed cDNA libraries prepared from RNA populations of different soybean varieties [20,21]. Among them, the soyBiPB and soyBiPD are the most conserved (96% identical) and were isolated from cDNA libraries derived from different genotypes. The possibility that soyBiPB and soyBiPD are allelic forms of the same gene has not been completely ruled out [21]. In fact, the interpretation that soyBiPB and soyBiPD cDNAs map to different loci in the soybean genome and constitute distinct genes is based on the reduced conservation of their 5% and 3% untranslated region in comparison with the coding region (Table 1). However, their 3% untranslated sequence keeps a high degree of sequence identity (93%) and the soyBiPD cDNA (GeneBank™ accession AF031241) does not contain enough 5% untranslated sequence to support a conclusive sequence comparison analysis. On the other hand, the use of gene-specific primers in RT-PCR assays has indicated that all four of the soybean BiP genes are transcriptionally active and appear to be differentially regulated. More specifically, the comparison of the expression profiles of soyBiPB and soyBiPD transcripts in the same genetic background confirmed that they are different genes. While the soyBiPD is expressed in all organs analyzed, the soyBiPB is only detected in leaves (Fig. 3). Thus, although these cDNAs share a high degree of sequence conservation that extends to include their 3% untranslated region, the soyBiPB and soyBiPD exhibit different pattern of gene expression. The data presented in this study have shown the differential expression of the soybean BiP gene family and indicated that plant BiP has evolved independent regulatory mechanisms, possibly to maximize BiP expression according to cell require-
280
J.C.M. Cascardo et al. / Plant Science 160 (2001) 273–281
ments or under specific stress conditions which is sensed differently by distinct plant organs. Alternatively, these results might be correlated with distinct functions or substrate specificity of the individual members of the family. The questions regarding substrate specificity and the role of each isoform in the ER-stress response and protein processing will be the focus for further experiments.
Acknowledgements We thank Dr Becky Boston and Dr Jeff Gillikin for helpful discussions and critical reading of the manuscript. We are grateful to Dr Eliot Herman for kindly providing the soyBiPA clone. This research was supported by the Brazilian Government Agency, FINEP/FNDCT Grant 64.94.0113.00 (to E.P.B. Fontes) and FAPEMIG Grant CBB 2598/98 (to E.P.B. Fontes). J.C.M. Cascardo and R.A.A. Buzeli were supported by a graduate CNPq fellowship from the Brazilian Government. R.S. Almeida was the recipient of FAPEMIG scholarships from the Minas Gerais State, Brazil.
References [1] R.J. Ellis, S.M. van der Vies, Molecular chaperones, Annu. Rev. Biochem. 60 (1991) 321–347. [2] C. Hammond, A. Helenius, Quality control in the secretory pathway, Curr. Opin. Cell Biol. 7 (1995) 523 – 529. [3] B.D. Hamman, L.M. Hendershot, A.E. Johnson, BiP maintains the permeability barrier of the ER membrane by sealing the lumenal end of the translocon pore before and early in translocation, Cell 92 (1998) 747–758. [4] M.-J. Gething, J. Sambrook, Protein folding in the cell, Nature 355 (1992) 33–45. [5] J.P. Hendrick, F.-U. Hartl, Molecular chaperone functions of heat-shock proteins, Annu. Rev. Biochem. 62 (1993) 349–384. [6] A.S. Lee, Mammalian stress response: induction of the glucose-regulated protein family, Curr. Opin. Cell Biol. 4 (1992) 267–273. [7] C.E. Shamu, Signal transduction: splicing together the unfolded-protein response, Curr. Biol. 7 (1997) R67 – R70. [8] J. Denecke, Soluble endoplasmic reticulum resident proteins and their function in protein synthesis and transport, Plant Physiol. Biochem. 34 (1996) 197– 205. [9] R.S. Boston, P.V. Viitanen, E. Vierling, Molecular chaperones and protein folding in the plants, Plant Mol. Biol. 34 (1996) 191–222.
[10] G. Galili, C. Sengupta-Gopalam, A. Ceriotti, The endoplasmic reticulum of plant cells and its role in protein maturation and biogenesis of oil bodies, Plant Mol. Biol. 38 (1998) 1 – 29. [11] R.S. Boston, E.P.B. Fontes, B.B. Shank, R.L. Wrobel, Increased expression of the maize immunoglobulin binding protein homolog b-70 in three zein regulatory mutants, Plant Cell 3 (1991) 497 – 505. [12] E.P.B. Fontes, B.B. Shank, R.L. Wrobel, S.P. Moose, G.R. O’Brian, E.T. Wurtzel, R.S. Boston, Characterization of an immunoglobulin binding protein homolog in the maize floury-2 endosperm mutant, Plant Cell 3 (1991) 483 – 496. [13] C.E. Coleman, M.A. Lopes, J.W. Gillikin, R.S. Boston, B.A. Larkins, A defective signal peptide in the maize high-lysine mutant floury-2, Proc. Natl. Acad. Sci. USA 92 (1995) 6828 – 6831. [14] J.W. Gillinkin, F. Zhang, C.E. Coleman, H.W. Bass, B.A. Larkins, R.S. Boston, A defective signal peptide tethers the floury-2 zein to the endoplasmic reticulum membrane, Plant Physiol. 114 (1997) 345 – 352. [15] E. Pedrazzini, G. Giovinazzo, R. Bollini, A. Ceriotti, A. Vitale, Binding of BiP to an assembly-defective protein in plant cells, Plant J. 5 (1994) 103 – 110. [16] L. D’amico, B. Valsania, M.G. Daminati, M.S. Fabrini, G. Nitti, R. Bollini, A. Ceriotti, A. Vitale, Bean homologues of the mammalian glucose regulated proteins: induction by tunicamycin and interaction with newlysynthesized storage proteins in the endoplasmic reticulum, Plant J. 2 (1992) 443 – 445. [17] N. Leborgne-Castel, E.P.W.M. Jelitto-Van Dooren, A.J. Crofts, J. Denecke, Overexpression of BiP in tobacco alleviates endoplasmic reticulum stress, Plant Cell 11 (1999) 459 – 469. [18] J.V. Anderson, Q.B. Li, D.W. Haskell, C.L. Guy, Structural organization of the spinach endoplasmic reticulumlumenal 70-kilodalton heat-shock cognate gene and expression of 70-kilodalton heat-shock genes during cold acclimation, Plant Physiol. 104 (1994) 1370 – 1395. [19] J. Denecke, L.E. Carlsson, S. Vidal, A.-S. Ho¨glund, B. Ek, M.J. van Zeiji, K.M.C. Sinjorgo, E.T. Palva, The tobacco homolog of mammalian calreticulin is present in protein complexes in vivo, Plant Cell 7 (1995) 391–406. [20] A. Kalinski, D.L. Rowley, D.S. Loer, C. Foley, G. Buta, E.M. Herman, Binding-protein expression is subject to temporal, developmental and stress-induced regulation in terminally differentiated soybean organs, Planta 195 (1995) 611 – 621. [21] J.E.F. Figueiredo, J.C.M. Cascardo, S.M.B. Carolino, F. Alvim, E.P.B. Fontes, Water-stress regulation and molecular analysis of the soybean BiP gene family, Braz. J. Plant Physiol. 9 (1997) 103 – 110. [22] M.A. Fontes, W.C. Otoni, S.M.B. Carolino, S.H. Brommonshenkel, E.P.B. Fontes, M. Fari, R.P. Louro, Hyperhydricity in pepper plants regenerated in vitro: involvement of BiP (binding protein) and ultrastructural aspects, Plant Cell Rep. 19 (1999) 81 – 87. [23] E.P.W.M. Jelitto-Van Dooren, S. Vidal, J. Denecke, Anticipating endoplasmic reticulum stress: a novel early response before pathogenesis-related gene induction, Plant Cell 11 (1999) 1935 – 1943.
J.C.M. Cascardo et al. / Plant Science 160 (2001) 273–281
[24] J.C.M. Cascardo, R.S. Almeida, R.A.A. Buzeli, S.M.B. Carolino, W.C. Otoni, E.P.B. Fontes, The phosphorylation state and expression of soybean BiP isoforms are differentially regulated following abiotic stresses, J. Biol. Chem. 275 (2000) 14494–14500. [25] J. Denecke, M.H.S. Goldman, J. Demolder, J. Seurinck, J. Botterman, The tobacco luminal binding protein is encoded by a multigene family, Plant Cell 3 (1991) 1025–1035. [26] R.L. Wrobel, G.R. O’Brian, R.S. Boston, Comparative analysis of BiP gene expression in maize endosperm, Gene 204 (1997) 105–113. [27] A. Go¨rg, W. Postel, S. Gu¨nther, Two-dimensional electrophoresis. The current state of two-dimensional electrophoresis with immobilized pH gradients, Electrophoresis 9 (1988) 531–546. [28] H.D. Hill, J.G. Straka, Protein determination using
.
[29]
[30]
[31]
[32]
281
bicinchonic acid, Anal. Biochem. 170 (1988) 203– 208. P.H. O’Farrell, High resolution two-dimensional electrophoresis of protein, J. Biol. Chem. 250 (1975) 4007– 4021. U. Laemmli, Cleavage of structural proteins during the assembly of the head of the bacteriophage T4, Nature 227 (1970) 680 – 685. L. Carlsson, E. Lazarides, ADP-ribosylation of the Mr 83 000 stress-inducible and glucose-regulated protein in avian and mammalian cells: modulation by heat shock and glucose starvation, Proc. Natl. Acad. Sci. USA 80 (1983) 4664 – 4668. E.P.B. Fontes, C.J. Silva, S.M.B. Carolino, J.E.F. Figueiredo, D.P.O. Batista, A soybean BiP protein (BiP) homolog is temporally regulated in soybean seeds and associates detectably with normal storage proteins in vitro, Braz. J. Genet. 19 (1996) 305 – 312.
Differential expression of the soybean BiP gene family Ju´lio Ce´zar M. Cascardo a,1, Reginaldo A.A. Buzeli a, Raul S. Almeida b, Wagner C. Otoni a, Elizabeth P.B. Fontes b,* b
a Departamento de Biologia Vegetal, Uni6ersidade Federal de Vic¸osa, 36571.000 Vic¸osa MG, Brazil Departamento de Bioquı´mica e Biologia Molecular/BIOAGRO, Uni6ersidade Federal de Vic¸osa, 36571.000 Vic¸osa MG, Brazil
Received 9 June 2000; received in revised form 5 September 2000; accepted 5 September 2000
Abstract The soybean binding protein (BiP) gene family consists of at least four members designated soyBiPA, soyBiPB, soyBiPC and soyBiPD. We have performed immunoblotting of two-dimensional (2D) gels and RT-PCR assays with gene-specific primers to analyze the differential expression of this gene family in various soybean organs. The 2D gel profiles of the BiP forms from different organs were distinct and suggested that the BiP genes are under organ-specific regulation. In fact, while all four BiP transcripts were detected in leaves by gene-specific reverse transcriptase – polymerase chain reaction (RT-PCR) assays, different subsets were detected in the other organs. The soyBiPD was expressed in all organs, whereas the expression of the soyBiPB was restricted to leaves. The soyBiPA transcripts were detected in leaves, roots and seeds and soyBiPC RNA was confined to leaves, seeds and pods. Our data are consistent with organ-specific expression of the soybean BiP gene family. © 2001 Elsevier Science Ireland Ltd. All rights reserved. Keywords: Binding protein; Molecular chaperone; Organ-specific regulation
1. Introduction The molecular chaperone binding protein (BiP) is an endoplasmic reticulum (ER)-localized member of the stress-induced family of heat shock protein (HSP70) that transiently interacts with a wide variety of cellular proteins [1]. BiP plays an important role in nascent protein translocation across the ER membrane and assists proper folding and maturation of newly synthesized proteins as they enter the organelle. Association of BiP Abbre6iations: BiP, binding protein; bp, base pair(s); DNase, deoxyribonuclease; DTT, dithiothreitol; EDTA, ethylenediaminetetraacetic acid; ER, endoplasmic reticulum; GRP78, 78-kDa glucose regulated protein (BiP); HSP70, 70-kDa heat shock protein; IEF, isoelectric focusing; PAGE, polyacrylamide-gel electrophoresis; RNase, ribonuclease; RT-PCR, reverse transcription-polymerase chain reaction; SDS, sodium dodecyl sulfate; U, unit(s). * Corresponding author. Tel.: +55-31-8992949; fax: + 55-318992864. E-mail address: [email protected] (E.P.B. Fontes). 1 Present address: Departmento de Gene´tica-UESC, Rodovia Itabuna-Ilhe´us, Km 16, 45650.000, Ilhe´us BA, Brazil.
with secretory proteins prevents nonproductive intermolecular interactions of folding intermediates and subsequent misaggregation of proteins within the lumen of the ER (reviewed in [2]). Recently, BiP has also been shown to participate directly in a mechanism to control the permeability of the ER membrane by sealing the ER lumenal side of ribosome-free translocon pores [3]. The ER-molecular chaperone proteins are expressed constitutively at low levels in all cells but are induced upon accumulation of unfolded protein in the lumen of the ER by a signaling cascade, designated the unfolded protein response (UPR) pathway [4–6]. This signal transduction pathway is characterized by the coordinated transcriptional up-regulation of BiP and other ER proteins, which are involved in folding and assembly of nascent proteins. The inter-organelle signaling cascade, which has been elucidated in yeast, involves an ER transmembrane kinase and a basic-leucine zipper transcription factor, Hac1p,
0168-9452/01/$ - see front matter © 2001 Elsevier Science Ireland Ltd. All rights reserved. PII: S 0 1 6 8 - 9 4 5 2 ( 0 0 ) 0 0 3 8 4 - 8
274
J.C.M. Cascardo et al. / Plant Science 160 (2001) 273–281
whose level is modulated by a regulated spliceosome-independent mRNA splicing event (reviewed in [7]). Regulation of plant BiP gene expression has been examined primarily by the detection of BiP RNA and protein levels under stress conditions and at different developmental stages of the plant organs (reviewed in [8]). In general, developmental events that are associated with high secretory activity of the cells and exposure of cells to agents that impair protein folding in the ER cause induction of plant BiP (reviewed in [9,10]). In the floury2 mutant of maize, the synthesis of a zein-like storage protein variant, which contains an uncleavable signal sequence, is associated with increased accumulation of BiP [11–14]. Expression of an assembly-defective mutant of the bean storage protein phaseoline also induces BiP synthesis in tobacco leaf protoplasts [15]. Furthermore, tunicamycin, a potent activator of the UPR pathway, efficiently induces BiP expression at both mRNA and protein level in several plant systems [12,16]. These results have led to the conclusion that, like mammal and yeast BiP, plant BiP is most likely regulated through an UPR pathway. This idea is supported by the observation that overexpression of BiP in tobacco leaf protoplasts attenuates ER stress caused by tunicamycin and prevents activation of the UPR pathway [17]. Plant BiP expression has also been shown to respond to a variety of abiotic and biotic stress conditions, such as water stress, fungus infestation, insect attack, nutritional stress, cold acclimation and elicitors of the plant-pathogenesis response [18 – 22]. Recent studies on plant BiP induction in response to physiological stress conditions have demonstrated that multiple, complex regulatory mechanisms control BiP gene expression in plants. During plant-pathogenesis interactions and under osmotic stress condition, the induction of BiP has been shown to be triggered by signaling pathways distinct from the UPR pathway [23,24]. Furthermore, in some plant species, specific stress conditions and developmental events alter BiP mRNA and protein levels to different extents, suggesting that post-transcriptional mechanisms are also involved in the regulation of BiP synthesis in plants [18,20]. Alternatively or additionally, these discrepancies between the level of BiP mRNA and protein may reflect differential expression and regulation of
plant BiP gene families, since the genome of several plant species is represented by multiple BiP genes [20,25,26]. In soybean, three distinct BiP cDNAs have been isolated from a leaf library [20], and one has been identified in a seed cDNA expression library [21]. Recently, we have shown that the soybean BiP genes are differentially regulated by abiotic stresses [24]. In this paper, we extended the analysis on the soybean BiP gene family expression. We have used two-dimensional (2D) gel electrophoresis and reverse transcriptase-polymerase chain reaction (RT-PCR) assays to demonstrate that the soybean BiP genes are under organ-specific regulation.
2. Materials and methods
2.1. Plant materials Soybean plants (Glycine max cv. Cristalina) were germinated in 5-l pots containing a mixture of soil, sand and dung (3:1:1) and grown in standardized greenhouse conditions. Plant tissues were harvested, immediately frozen in liquid nitrogen and stored at −80°C.
2.2. Whole cell protein extraction Total protein was extracted from an acetone dry powder, using a protocol adapted from Go¨rg et al. [27]. Briefly, plant tissues were crushed in liquid nitrogen and 2 g of the powder were homogenized with 10% (w/v) trichloroacetic acid (TCA) in acetone containing 0.07% (v/v) 2-mercaptoethanol. Total protein was precipitated for 40 min at − 20°C, recovered by centrifugation at 16 000 × g for 15 min and washed two to three times with acetone containing 0.07% (v/v) 2-mercaptoethanol. The pellet was dried under vacuum and 30 mg of the acetone dry powder was resuspended in 1 ml of lysis buffer (9 M urea, 2% (v/v) Triton X-100, 2% (v/v) 2-mercaptoethanol, 0.8% (v/v) Ampholines (pH 5–7), 0.2% (v/v) Ampholines (pH 3.5– 10), 8 mM PMSF) followed by ultrasonication on ice. Cell debris was removed by centrifugation at 30 000 × g for 15 min and protein concentration was determined as described by Hill and Straka [28].
J.C.M. Cascardo et al. / Plant Science 160 (2001) 273–281
275
2.3. 2D gel electrophoresis and immunoblotting
2.5. RT-PCR
2D gel electrophoresis was performed as described by O’Farrell [29]. For the first dimension, 30 – 50 mg of protein were loaded on isoelectric focusing tube gels (Bio–Rad), in which the pH gradient was established with 80% pH 5–7 and 20% pH 3.5 – 10 Ampholines (Amersham Pharmacia Biotech.). After electrophoresis at 750 V for 3.5 h, the gels were equilibrated with buffer A (5 mM Tris– HCl pH 6.8, 6 M urea, 30% (v/v) glycerol and 2% (w/v) sodium dodecyl sulfate (SDS) and stored at −80°C. Prior to the second dimension, the gels were re-equilibrated for 15 min with buffer A containing 65 mM DTT and then for 15 min with buffer A containing 65 mM DTT and 260 mM iodoacetamide. SDS-polyacrylamide-gel electrophoresis (PAGE) was carried out as described previously [30], and the proteins were transferred from 10% SDS-polyacrylamide gels to nitrocellulose membranes by electroblotting. Immunoblot analyses were performed using polyclonal antiBiP-carboxy antibody [21] at a 1:1000 dilution and a goat anti-rabbit IgG alkaline phosphatase conjugate (Sigma) at a 1:5000 dilution. Alkaline phosphatase activity was assayed using 5-bromo-4-chloro-3-indolyl phosphate (Life Technologies, Inc.) and p-nitroblue tetrazolium (NBT) (Life Technologies, Inc.). The pH gradient of the isoelectric focusing gels was determined by incubating 0.2 cm mock loaded gel slices in 2 ml of H2O at room temperature for 12 h with shaking. The pH of each gel slice was measured and plotted as a function of the distance from the anode. Pre-stained molecular markers were electrophoresed in the second dimension and served as a reference point for comparison of the different gels.
Total RNA from seeds, leaves, roots and pods was extracted as described using an RNAeasy kit (Qiagen). The RNA was treated with 2 U of RNase-free DNase (Promega) in 20 mM Tris– HCl pH 8.4, 50 mM KCl and 2 mM MgCl2 at 37°C for 1 h and recovered by ethanol precipitation. First strand cDNA was synthesized from 2–5 mg total RNA using the SuperScript II Kit (Life Technologies, Inc.) according to the manufacturer’s instructions. PCR assays were performed with soyBiPA-, soyBiPB-, soyBiPC- [20] or soyBiPD[21] specific primers (Table 1). A typical reaction consisted of 2 ml of the reverse transcription reaction, 200 mM each of dNTPs, 100 nM each of sense and antisense gene-specific primers, 1 X PCR buffer (10 mM Tris–HCl pH 8.3, 50 mM KCl, 2.5 mM MgCl2) and 1 U of Taq DNA polymerase (Life Technologies, Inc.) in a total volume of 30 ml. The presence of contaminating DNA was assessed in control reactions conducted without reverse transcriptase. The reactions were performed for 35 cycles (30 s at 94°C, 30 s at 52°C, and 1 min at 72°C), with a final extension at 72°C for 10 min. For RNA abundance assays, the number of cycles was reduced to 25. The reaction products were separated by electrophoresis on 1% agarose/Tris – borate-ethylenediaminetetraacetic acid (EDTA) gels and visualized with ethidium bromide-staining under UV transillumination. PCR assays were also carried out with soybean Actin 3 gene-specific primers (GenBank™ accession number J01297) to assess the quantity and quality of the cDNA. The upstream primer 5%-cccctcaacccaaaggtcaacag-3% (coordinates 614–636) and the downstream primer 5%-ggaatctctctgccccaattgtg-3% (positions 2011–2024) amplify a 440-bp fragment from the Actin 3 cDNA and a 520-bp fragment, including an 81-bp intron, from genomic DNA.
2.4. Dephosphorylation assays For the dephosphorylation assays, total protein extracts were dialyzed against 10 mM Tris–HCl pH 7.5, 10 mM MgCl2, 50 mM potassium acetate and 4 mM PMSF and treated with 4 U of alkaline phosphatase (Amersham Pharmacia Biotech.) for 2 h at 37°C. Following phosphatase treatment, the proteins were dialyzed against 40 mM Tris–HCl pH 7.5 and 1 mM PMSF, concentrated by freezedrying and resuspended in lysis buffer. The integrity of the proteins was monitored by SDS-PAGE.
3. Results
3.1. 2D gel analysis of BiP isoforms and their relati6e organ distribution To identify and characterize the soybean BiP isoforms, total protein was extracted from different organs of soybean plants, resolved by 2D gel
J.C.M. Cascardo et al. / Plant Science 160 (2001) 273–281
276
electrophoresis, transferred to nitrocellulose and probed with an anti-soybean BiP serum. The polyclonal antibody, which recognizes the carboxy-terminus of soybean BiP, discriminates between BiP and the cytoplasmic HSP70 protein [21]. In Fig. 1, differential pattern of BiP isoform accumulation or modification was observed in seeds, roots, pods and leaves. Three isoforms with pI of 5.5–5.7 were detected in seed extracts (Fig. 1A), while at least four distinct BiP isoforms (pI 5.6, 5.7, 6.0 and 6.1) in approximately equimolar amounts were resolved in root extracts (Fig. 1C). BiP isoforms from pod (Fig. 1E) and leaf (Fig. 1G) extracts were resolved as clusters at slightly different isoelectric points (pI 5.6–6.1 and pI 5.7–6.1, respectively). We have recently demonstrated that soybean BiP exists in interconvertible phosphorylated and non-phosphorylated forms and the equilibrium can be shifted to either direction in response to different stimuli [24]. To identify whether the apparent isoforms are products of different genes or are differentially processed forms of the same polypeptide, the extracts were treated with alkaline phosphatase prior to electrophoresis. Dephosphorylation of the BiP isoforms from roots, leaves and pods caused a shift in their isoelectric focusing positions, but did not alter the number or staining intensity of the BiP polypeptides (Fig. 1C–H, compare AP − and +). The effectiveness of the alkaline phosphatase
treatment was confirmed by complete removal of radiolabeled phosphate incorporated into the protein (11, 12, 24 and data not shown). Thus, the multiplicity of BiP polypeptides on 2D gels is not due to different phosphorylation levels of the same protein in pods, leaves and roots. In contrast, after phosphatase treatment, the pI 5.5 and 5.6 BiP forms from seeds co-migrated as a single species, whereas the pI 5.7 BiP form remained distinct (compare Fig. 1A and B). These results indicate that the pI 5.5 and the pI 5.6 BiP isoforms are most likely variants of the same polypeptide. The pI 5.7 form does not constitute a non-phosphorylated version of the more acidic ones, but might represent a distinct BiP polypeptide. Since mammals and plant BiP are also modified by ADP-ribosylation [12,31] the removal of ADPribose by phosphodiesterase was included in the assays. These experiments showed that incorporation of ADP-ribose into the soybean BiP forms does not cause detectable shifts in their isoelectric states on IEF gels (data not shown). Thus, the charge heterogeneity of the resolved polypeptides is not likely due to ADP-ribosylation.
3.2. Soybean BiP gene family and gene-specific primers Although our results do not completely rule out the possibility that as yet uncharacterized post-
Table 1 Gene-specific primersa Primer
BiPAF BiPAR BiPBF BiPBR BiPCF BiPCR BiPDF BiPDR a
Sequence
CGAGCTCTAGAGATGTTGTTGCTT TACGTAGACGGCTGTAGTTCC TGAGCTCTAGTTAGTCGGAGTCTG CGATCGGCACGAGGAAGTTG CGAGCGCACCTTCAACTTAACC CAACATGGCCATTCTTGTAAACACCG ATCTGGAGGAGCCCTAGGCGGTGG CTTGAAGAAGCTTCGTCGTAAAACTAAG
Annealing sequence (% identity) BiPA
BiPB
BiPC
BiPD
100 100 45.8 40 22.7 92 62.9 44
46.2 0 100 100 27.3 46 100 70
ND ND ND ND 100 100 ND ND
41.7 0 58.3 45 9 92 100 100
Annealing Position (cognate cDNA)
2044 2317 2080 2259 12 260 1966 2184
The annealing position corresponds to the nucleotide position in the cognate cDNA in which the 5% nucleotide of the primer sequence anneals. The numbering scheme was taken considering the first nucleotide of the BiP cDNA sequence in the GeneBank™ (accessions U08384, U08383, U08382 and AF031241) as the nucleotide +1. F and R following the name of the primers refer to forward and reverse, respectively.
J.C.M. Cascardo et al. / Plant Science 160 (2001) 273–281
Fig. 1. Immunoblot analysis of BiP isoforms from different soybean organs. Soluble proteins extracted from seeds (A and B), roots (C and D), pods (E and F) and leaves (G and H), with ( +) and without ( −) alkaline phosphatase (AP) treatment, were resolved by 2D IEF/SDS-PAGE. The second dimension gels were 10% SDS-polyacrylamide gels, except for panels A and B, which were 8% SDS-polyacrylamide gels. After electrophoresis, the proteins were transferred to nitrocellulose and probed with an anti-soybean BiP serum. The pH gradient (pI) is shown at the bottom and pre-stained molecular markers (M) are on the left. Arrows show the position of individual BiP polypeptides. Absence of arrows indicates that BiP polypeptides were resolved as clusters.
translational modifications cause the relative shift in the isoelectric focusing position of the BiP forms, they are consistent with an organ-specific expression of the soybean BiP gene family. To address this possibility, we investigated the expression patterns of the four cloned BiP genes by RT-PCR with gene-specific primers. The gene-specific primers were designed to take advantage of the most divergent sequences of the known BiP cDNAs, which differ most in their 5% and the 3% untranslated sequences (Table 2). Consequently, primer sets were designed to amplify small frag-
277
ments from either 3% or 5% ends of the genes (Table 1). The set of forward and reverse primers were 100% complementary to the annealing sequences of their cognate cDNA, while they were a minimum of four mismatches to the other cDNAs. Fig. 2A indicates that the A primers amplified the correctly sized fragment from soyBiPA-specific plasmid DNA (lane 1), but did not amplify any fragment from recombinant lambda DNA harboring soyBiPD sequence (lane 8). Likewise the D primers amplified the predicted sized fragment from the soyBiPD-specific recombinant lambda DNA (lane 5), but failed to amplify any fragment from plasmid DNA harboring the soyBiPA sequence (lane 4). Both B and C primers failed to amplify soyBiPA (lanes 2 and 3) and soyBiPDspecific sequences (lanes 7 and 6), but not a soybean genomic DNA sequence (data not shown). These results indicate that under the conditions used for the PCR analyses, the A and D primers are gene-specific and do not cross-amplify a noncognate BiPA or BiPD gene sequence. The sets of B and C primers are capable of discriminating between sequences present in the soybean genome and BiPA or BiPD-specific sequences. Since soyBiPB and soyBiPC DNA are no longer available, the specificity of B and C primers was confirmed further by sequencing the amplified fragments from leaf cDNA. For the RT-PCR assays, the integrity and amount of the cDNA prepared from different organs of soybean plants were routinely assessed with actin-specific primers (Fig. 2B). The actin primers were designed to amplify a 580-bp fragment from genomic DNA (Fig. 2B, lane 1) and a 440-bp fragment from actin cDNA (lane 2), such that the presence of contaminating genomic DNA could be easily assessed in our cDNA preparations (lane 3). DNA contamination was also monitored in control reactions conducted without reverse transcriptase (lane 4).
3.3. Members of the soybean BiP family display differential pattern of expression As previous work has demonstrated that soybean BiP is temporally regulated in seeds, leaves and roots, we analyzed the individual pattern of BiP transcript accumulation in these organs predominantly at mid-maturation stage [20,32]. The results of RT-PCR with gene-specific primers
J.C.M. Cascardo et al. / Plant Science 160 (2001) 273–281
278
Table 2 Nucleotide sequence identity between the soybean BiP cDNAsa Region
Full length cDNA Coding region 5%-untranslated 3%-untranslated
Pairwise comparison (% identity) A×B
A×C
A×D
B×C
B×D
80 90 41 61
83 89 37 ND
83 91 57 61
89 92 61 ND
96 97 65 93
C×D 88 93 71 ND
a
The degree of identity between the various regions of the soybean BiP genes was analyzed using the CLUSTAL-W program. A, B, C and D refer to soyBiPA, soyBiPB, soyBiPC and soyBiPD cDNAs, respectively (GeneBank™ accessions U08384, U08383, U08382 and AF031241).
show that the soybean BiP genes have different profiles of organ expression (Fig. 3). The four BiP genes are expressed in leaves, as judged by amplification of the expected sized fragment from unstressed leaf cDNA with our gene-specific primers (Fig. 3, lanes C). Nevertheless, except for the soyBiPD whose mRNA was detected in all organs analyzed (lanes BiPD), soyBiPA, soyBiPB and soyBiPC were differentially expressed. The soyBiPA mRNA was detected in leaves, roots and seeds but not in pods (lanes BiPA). Transcripts of the soyBiPC gene were absent in roots, but were detected in leaves, pods and seeds (lanes BiPC). The soyBiPB expression seems to be restricted to leaves because the soyBiPB-specific primers failed to amplify the cDNA from seeds, pods and roots (lanes BiPB). The general profile of organ expression was unchangeable at distinct stage of development. The integrity and amount of the cDNA from different organs were assessed with actin-specific primers (lanes actin).
different organs and we showed that the soybean BiP gene family is under organ-specific regulation. The results of our 2D gel electrophoresis demonstrated that the patterns displayed by the BiP forms from different soybean organs are distinct. Furthermore, RT-PCR experiments using genespecific primers established that three of the soybean BiP genes are differentially expressed in different organs.
4. Discussion In contrast to mammals and yeast, the genome of several plant species, such as maize, tobacco and soybean, is represented by multiple copies of BiP genes [20,25,26]. This observation has raised the possibility that individual members of the plant BiP gene family exhibit differential regulation, function or substrate specificity [20,26]. In support of this hypothesis, we have previously demonstrated that the soybean BiP gene family is differentially regulated in response to abiotic stress conditions [24]. Here we investigated the individual contribution of the members of this family to the general pattern of BiP expression observed in
Fig. 2. Specificity of the soyBiP primers. (A) PCR assays were performed using either soyBiPA plasmid DNA or soyBiPD l recombinant DNA as substrate for Taq polymerase and the BiPA primers (lanes 1 and 8), BiPB primers (lanes 2 and 7), BiPC primers (lanes 3 and 6) or BiPD primers (lanes 4 and 5). M corresponds to DNA standard markers indicated on the left in bp. P marks the position of the primers. (B) Soybean genomic DNA (lane 1), cDNA prepared from DNase-treated leaf RNA (lane 2) and cDNA prepared from untreated-leaf RNA (lane 3) were used as substrate for Taq polymerase in PCR assays with actin 3-specific primers. In lane 4, the reverse transcriptase was omitted from the RT-PCR assay. M corresponds to DNA standard markers whose sizes are shown on the left in bp.
J.C.M. Cascardo et al. / Plant Science 160 (2001) 273–281
Fig. 3. Organ-specific expression of the soybean BiP gene family. RT-PCR assays were performed with cDNA prepared from leaf (L), pod (P), root (R) or seed (S) polyA+mRNA using the soyBiPB- (BiPB), soyBiPA- (BiPA), soyBiPC(BiPC) or soyBiPD- (BiPD) specific primers. Numbers on the left correspond to the sizes of DNA standard markers in bp.
Since precise information about the copy number of BiP genes in the soybean genome is not available, we can not rule out the possibility that the gene-specific primers recognized as yet uncharacterized BiP genes in the RT-PCR assays. Nevertheless, this possibility does not invalidate the interpretation that expression of the soybean BiP gene family is differentially regulated for two reasons. First, despite size differences of soyBiP 3% untranslated regions, the fragment sizes that were amplified by the gene-specific primers were consistently identical to the ones predicted from their cognate cDNAs. Second, some primers failed to recognize any transcripts from some organs. These data demonstrated that neither the cognate gene nor a putative closely related uncharacterized BiP gene is expressed in that particular organ. The 2D profile of BiP isoforms observed in distinct organs did not correlate reasonably well with the transcript accumulation of individual members of the gene family. Although four distinct BiP species from roots could be detected in our 2D electrophoresis (Fig. 1D), only the soyBiPA and soyBiPD transcripts were detected in this organ. This result may reflect the existence of additional copies of uncharacterized BiP genes in the soybean genome. Alternatively or additionally, it might indicate that differential post-translational modification other than phosphorylation would be responsible for the charge heterogeneity of BiP species detected in roots. This latter alternative is further supported by the fact that the number of unphosphorylated BiP species (Fig. 1B) was lower than the individual BiP transcripts detected in seeds (Fig. 3). In fact, the differences in the predicted isoelectric points of the soyBiPA-, soyBiPB-
279
and soyBiPD- full-length cDNA encoded products, which differ by only 0.03 or at maximum 0.06 pI units to each other, support the notion that some BiP isoforms may not be resolved in our 2D gel system. While these observations are consistent with the poor resolution of pod and leaf soybean BiP isoforms (Fig. 1F and H), they do not allow us to identify the BiP isoforms displayed in the 2D gel profiles of different organs. Further studies will be necessary to recognize and designate the different BiP isoforms in our 2D gel system. The members of the soybean BiP gene family have been isolated from leaf and seed cDNA libraries prepared from RNA populations of different soybean varieties [20,21]. Among them, the soyBiPB and soyBiPD are the most conserved (96% identical) and were isolated from cDNA libraries derived from different genotypes. The possibility that soyBiPB and soyBiPD are allelic forms of the same gene has not been completely ruled out [21]. In fact, the interpretation that soyBiPB and soyBiPD cDNAs map to different loci in the soybean genome and constitute distinct genes is based on the reduced conservation of their 5% and 3% untranslated region in comparison with the coding region (Table 1). However, their 3% untranslated sequence keeps a high degree of sequence identity (93%) and the soyBiPD cDNA (GeneBank™ accession AF031241) does not contain enough 5% untranslated sequence to support a conclusive sequence comparison analysis. On the other hand, the use of gene-specific primers in RT-PCR assays has indicated that all four of the soybean BiP genes are transcriptionally active and appear to be differentially regulated. More specifically, the comparison of the expression profiles of soyBiPB and soyBiPD transcripts in the same genetic background confirmed that they are different genes. While the soyBiPD is expressed in all organs analyzed, the soyBiPB is only detected in leaves (Fig. 3). Thus, although these cDNAs share a high degree of sequence conservation that extends to include their 3% untranslated region, the soyBiPB and soyBiPD exhibit different pattern of gene expression. The data presented in this study have shown the differential expression of the soybean BiP gene family and indicated that plant BiP has evolved independent regulatory mechanisms, possibly to maximize BiP expression according to cell require-
280
J.C.M. Cascardo et al. / Plant Science 160 (2001) 273–281
ments or under specific stress conditions which is sensed differently by distinct plant organs. Alternatively, these results might be correlated with distinct functions or substrate specificity of the individual members of the family. The questions regarding substrate specificity and the role of each isoform in the ER-stress response and protein processing will be the focus for further experiments.
Acknowledgements We thank Dr Becky Boston and Dr Jeff Gillikin for helpful discussions and critical reading of the manuscript. We are grateful to Dr Eliot Herman for kindly providing the soyBiPA clone. This research was supported by the Brazilian Government Agency, FINEP/FNDCT Grant 64.94.0113.00 (to E.P.B. Fontes) and FAPEMIG Grant CBB 2598/98 (to E.P.B. Fontes). J.C.M. Cascardo and R.A.A. Buzeli were supported by a graduate CNPq fellowship from the Brazilian Government. R.S. Almeida was the recipient of FAPEMIG scholarships from the Minas Gerais State, Brazil.
References [1] R.J. Ellis, S.M. van der Vies, Molecular chaperones, Annu. Rev. Biochem. 60 (1991) 321–347. [2] C. Hammond, A. Helenius, Quality control in the secretory pathway, Curr. Opin. Cell Biol. 7 (1995) 523 – 529. [3] B.D. Hamman, L.M. Hendershot, A.E. Johnson, BiP maintains the permeability barrier of the ER membrane by sealing the lumenal end of the translocon pore before and early in translocation, Cell 92 (1998) 747–758. [4] M.-J. Gething, J. Sambrook, Protein folding in the cell, Nature 355 (1992) 33–45. [5] J.P. Hendrick, F.-U. Hartl, Molecular chaperone functions of heat-shock proteins, Annu. Rev. Biochem. 62 (1993) 349–384. [6] A.S. Lee, Mammalian stress response: induction of the glucose-regulated protein family, Curr. Opin. Cell Biol. 4 (1992) 267–273. [7] C.E. Shamu, Signal transduction: splicing together the unfolded-protein response, Curr. Biol. 7 (1997) R67 – R70. [8] J. Denecke, Soluble endoplasmic reticulum resident proteins and their function in protein synthesis and transport, Plant Physiol. Biochem. 34 (1996) 197– 205. [9] R.S. Boston, P.V. Viitanen, E. Vierling, Molecular chaperones and protein folding in the plants, Plant Mol. Biol. 34 (1996) 191–222.
[10] G. Galili, C. Sengupta-Gopalam, A. Ceriotti, The endoplasmic reticulum of plant cells and its role in protein maturation and biogenesis of oil bodies, Plant Mol. Biol. 38 (1998) 1 – 29. [11] R.S. Boston, E.P.B. Fontes, B.B. Shank, R.L. Wrobel, Increased expression of the maize immunoglobulin binding protein homolog b-70 in three zein regulatory mutants, Plant Cell 3 (1991) 497 – 505. [12] E.P.B. Fontes, B.B. Shank, R.L. Wrobel, S.P. Moose, G.R. O’Brian, E.T. Wurtzel, R.S. Boston, Characterization of an immunoglobulin binding protein homolog in the maize floury-2 endosperm mutant, Plant Cell 3 (1991) 483 – 496. [13] C.E. Coleman, M.A. Lopes, J.W. Gillikin, R.S. Boston, B.A. Larkins, A defective signal peptide in the maize high-lysine mutant floury-2, Proc. Natl. Acad. Sci. USA 92 (1995) 6828 – 6831. [14] J.W. Gillinkin, F. Zhang, C.E. Coleman, H.W. Bass, B.A. Larkins, R.S. Boston, A defective signal peptide tethers the floury-2 zein to the endoplasmic reticulum membrane, Plant Physiol. 114 (1997) 345 – 352. [15] E. Pedrazzini, G. Giovinazzo, R. Bollini, A. Ceriotti, A. Vitale, Binding of BiP to an assembly-defective protein in plant cells, Plant J. 5 (1994) 103 – 110. [16] L. D’amico, B. Valsania, M.G. Daminati, M.S. Fabrini, G. Nitti, R. Bollini, A. Ceriotti, A. Vitale, Bean homologues of the mammalian glucose regulated proteins: induction by tunicamycin and interaction with newlysynthesized storage proteins in the endoplasmic reticulum, Plant J. 2 (1992) 443 – 445. [17] N. Leborgne-Castel, E.P.W.M. Jelitto-Van Dooren, A.J. Crofts, J. Denecke, Overexpression of BiP in tobacco alleviates endoplasmic reticulum stress, Plant Cell 11 (1999) 459 – 469. [18] J.V. Anderson, Q.B. Li, D.W. Haskell, C.L. Guy, Structural organization of the spinach endoplasmic reticulumlumenal 70-kilodalton heat-shock cognate gene and expression of 70-kilodalton heat-shock genes during cold acclimation, Plant Physiol. 104 (1994) 1370 – 1395. [19] J. Denecke, L.E. Carlsson, S. Vidal, A.-S. Ho¨glund, B. Ek, M.J. van Zeiji, K.M.C. Sinjorgo, E.T. Palva, The tobacco homolog of mammalian calreticulin is present in protein complexes in vivo, Plant Cell 7 (1995) 391–406. [20] A. Kalinski, D.L. Rowley, D.S. Loer, C. Foley, G. Buta, E.M. Herman, Binding-protein expression is subject to temporal, developmental and stress-induced regulation in terminally differentiated soybean organs, Planta 195 (1995) 611 – 621. [21] J.E.F. Figueiredo, J.C.M. Cascardo, S.M.B. Carolino, F. Alvim, E.P.B. Fontes, Water-stress regulation and molecular analysis of the soybean BiP gene family, Braz. J. Plant Physiol. 9 (1997) 103 – 110. [22] M.A. Fontes, W.C. Otoni, S.M.B. Carolino, S.H. Brommonshenkel, E.P.B. Fontes, M. Fari, R.P. Louro, Hyperhydricity in pepper plants regenerated in vitro: involvement of BiP (binding protein) and ultrastructural aspects, Plant Cell Rep. 19 (1999) 81 – 87. [23] E.P.W.M. Jelitto-Van Dooren, S. Vidal, J. Denecke, Anticipating endoplasmic reticulum stress: a novel early response before pathogenesis-related gene induction, Plant Cell 11 (1999) 1935 – 1943.
J.C.M. Cascardo et al. / Plant Science 160 (2001) 273–281
[24] J.C.M. Cascardo, R.S. Almeida, R.A.A. Buzeli, S.M.B. Carolino, W.C. Otoni, E.P.B. Fontes, The phosphorylation state and expression of soybean BiP isoforms are differentially regulated following abiotic stresses, J. Biol. Chem. 275 (2000) 14494–14500. [25] J. Denecke, M.H.S. Goldman, J. Demolder, J. Seurinck, J. Botterman, The tobacco luminal binding protein is encoded by a multigene family, Plant Cell 3 (1991) 1025–1035. [26] R.L. Wrobel, G.R. O’Brian, R.S. Boston, Comparative analysis of BiP gene expression in maize endosperm, Gene 204 (1997) 105–113. [27] A. Go¨rg, W. Postel, S. Gu¨nther, Two-dimensional electrophoresis. The current state of two-dimensional electrophoresis with immobilized pH gradients, Electrophoresis 9 (1988) 531–546. [28] H.D. Hill, J.G. Straka, Protein determination using
.
[29]
[30]
[31]
[32]
281
bicinchonic acid, Anal. Biochem. 170 (1988) 203– 208. P.H. O’Farrell, High resolution two-dimensional electrophoresis of protein, J. Biol. Chem. 250 (1975) 4007– 4021. U. Laemmli, Cleavage of structural proteins during the assembly of the head of the bacteriophage T4, Nature 227 (1970) 680 – 685. L. Carlsson, E. Lazarides, ADP-ribosylation of the Mr 83 000 stress-inducible and glucose-regulated protein in avian and mammalian cells: modulation by heat shock and glucose starvation, Proc. Natl. Acad. Sci. USA 80 (1983) 4664 – 4668. E.P.B. Fontes, C.J. Silva, S.M.B. Carolino, J.E.F. Figueiredo, D.P.O. Batista, A soybean BiP protein (BiP) homolog is temporally regulated in soybean seeds and associates detectably with normal storage proteins in vitro, Braz. J. Genet. 19 (1996) 305 – 312.