Differentially expressed genes in resistant and susceptible Bombyx mori strains infected with a densonucleosis virus

Insect Biochemistry and Molecular Biology 38 (2008) 853–861

Contents lists available at ScienceDirect

Insect Biochemistry and Molecular Biology journal homepage: www.elsevier.com/locate/ibmb

Differentially expressed genes in resistant and susceptible Bombyx mori strains infected with a densonucleosis virus Yan-Yuan Bao a, Mu-Wang Li b, Yun-Po Zhao c, Jun-Qing Ge a, Cheng-Shu Wang c, Yong-Ping Huang c, Chuan-Xi Zhang a, * a b c

Institute of Insect Sciences, Zhejiang University, Kaixuan Road 268, Hangzhou 310029, China Sericultural Research Institute, Chinese Academy of Agricultural Sciences, Zhenjiang 212018, China Institute of Plant Physiology and Ecology, Shanghai Institutes for Biological Sciences, Chinese Academy of Sciences, Shanghai 200032, China

a r t i c l e i n f o

a b s t r a c t

Article history: Received 16 February 2008 Received in revised form 9 May 2008 Accepted 6 June 2008

We investigated variations in the gene expression of Bombyx mori following infection with a densonucleosis virus (BmDNV-Z). Two B. mori near-isogenic lines, Jingsong and Jingsong.nsd-Z.NIL, which are highly susceptible and completely resistant to BmDNV-Z, respectively, were used in this study. The infection profiles of BmDNV-Z in the midguts of the B. mori Jingsong and Jingsong.nsd-Z.NIL larvae revealed that the virus invaded the midguts of both of these strains. However, its proliferation was notably inhibited in the midgut of the resistant strain. By using the suppression subtractive hybridization method, three cDNA libraries were constructed to compare BmDNV-Z responsive gene expression between the two silkworm lines. In total, 151 differentially expressed genes were obtained. Real-time qPCR analysis confirmed that 11 genes were significantly up-regulated in the midgut of the Jingsong. nsd-Z.NIL strain following BmDNV-Z infection. Our results imply that these up-regulated genes might be involved in B. mori immune responses against BmDNV infection. Ó 2008 Elsevier Ltd. All rights reserved.

Keywords: Bombyx mori BmDNV-Z BmDNV-resistant silkworm strain Antiviral response Suppression subtractive hybridization

1. Introduction Unlike the immune responses of insects against bacteria or fungi, their responses to viral infections are poorly understood. Insect resistance to viruses has received extensive attention because it plays an important role in both the biological control of pests through the use of viral agents and the breeding of resistant strains of beneficial insects. The silkworm, Bombyx mori, exhibits high intraspecific variability in its resistance to viral diseases (Watanabe, 2002). The Bombyx densonucleosis virus (BmDNV) is a major pathogen that causes flacherie disease in the silkworm. Certain Bombyx strains are highly susceptible, while other strains exhibit complete resistance to BmDNV infection (Abe et al., 1998). BmDNVs are classified into two major types, type I and type II, based on their genomic characteristics. The genome of BmDNV type I, such as BmDNV-1 (Ina isolate), contains single-stranded complimentary DNA molecules that are 5.048 kb in length (Bando et al., 1990). In contrast, BmDNV type II possesses a split genome comprising two types of single-stranded linear DNA molecules. BmDNVs of this type include BmDNV-2 (Yamanashi isolate) that

* Corresponding author. Tel./fax: þ86 571 86971697. E-mail address: [email protected] (C.-X. Zhang). 0965-1748/$ – see front matter Ó 2008 Elsevier Ltd. All rights reserved. doi:10.1016/j.ibmb.2008.06.004

contains two ssDNA molecules, which are 6.542 and 6.032 kb in length (Bando et al., 1992, 1995), and BmDNV-Z (Zhenjiang isolate) that contains two ssDNA molecules, which are 6.543 and 6.022 kb in length (Wang et al., 2007). In addition, BmDNV type I is more pathogenic to the silkworm than type II (Watanabe, 2002). Genetic analysis has revealed that several major genes contribute to the complete resistance of Bombyx strains to BmDNV infection. A dominant Nid-1 (Eguchi et al., 1986) and a recessive nsd-1 gene (Watanabe and Maeda, 1978) appear to be responsible for conferring resistance to BmDNV-1, while two other recessive genes, nsd-2 (Seki, 1984) and nsd-Z (Hu et al., 1984), are likely to be functional against BmDNV-2 and BmDNV-Z infection. However, to date, the genes mentioned above have not been cloned from B. mori. The details of the mechanisms by which BmDNV specifically infects its host and the manner in which Bombyx strains effectively defend themselves against BmDNV infection remain unclear. To gain a better understanding of the mechanisms underlying resistance to BmDNV in some Bombyx strains, we first investigated the infection profiles of BmDNV-Z in the midguts of B. mori Jingsong and Jingsong.nsd-Z.NIL larvae by performing real-time quantitative PCR (qPCR) at different time points. Our results revealed that BmDNV-Z invaded the midgut tissue of both the Jingsong and Jingsong.nsd-Z.NIL strains. However, viral proliferation in the midgut of the resistant strain was inhibited by unknown mechanisms. In the susceptible Jingsong strain, the process of BmDNV-Z

854

Y.-Y. Bao et al. / Insect Biochemistry and Molecular Biology 38 (2008) 853–861

infection was demonstrated in the latent phase (3–24 h pi) and exponential phase (24–96 h pi), implying that the expression variations of genes that are involved in the inhibition of BmDNV-Z viral proliferation may occur during the latent phase. Based on our results and the understanding that BmDNV-Z exclusively invades the columnar cells of larval midgut epithelium at an early stage of infection (3–24 h pi) (Wang et al., 2007), we focused on clarifying the differentially expressed genes that respond early to infection in the midgut of Bombyx strains and chose 12 h pi as a time point to determine up-regulated genes. Then, we explored resistancerelated genes by performing suppression subtractive hybridization (SSH), an effective technique by which differentially expressed cDNA fragments can be selectively amplified (Diatchenko et al., 1996). Two near-isogenic lines (NILs), B. mori Jingsong (þnsd-Z/þnsd-Z) and Jingsong.nsd-Z.NIL (nsd-Z/nsd-Z), which are highly susceptible and completely resistant to BmDNV-Z, respectively, were used for comparing differentially expressed genes. Three subtracted cDNA libraries were constructed using a BmDNV-Z-infected and phosphate-buffered saline (PBS)-treated Jingsong strain, a BmDNVZ-infected and PBS-treated Jingsong.nsd-Z.NIL strain, and BmDNVZ-infected Jingsong.nsd-Z.NIL and Jingsong strains. A total of 151 cDNA clones that were expressed in response to BmDNV-Z infection were obtained from the libraries. Real-time qPCR analysis confirmed that 11 genes were significantly up-regulated following BmDNV-Z infection in the midgut of the Jingsong.nsd-Z.NIL strain when compared with the Jingsong strain. The aim of this study is to identify B. mori genes with potential anti-BmDNV-Z function in the larval midgut and to use these genes to understand the antiviral mechanisms involved in the immune responses of insects. 2. Materials and methods 2.1. Silkworm strains The B. mori Jingsong (þnsd-Z/þnsd-Z) and Jingsong.nsd-Z.NIL (nsd-Z/ nsd-Z) strains were provided by the Sericultural Research Institute of the Chinese Academy of Agricultural Sciences, Zhenjiang, China. The NILs are a group of strains that are genetically identical, except at one locus or a few loci. NILs resistant to BmDNV-Z were bred via successive backcrosses, using the B. mori L10 strain (nsd-Z/ nsd-Z), which is resistant to BmDNV-Z as the donor parent and the B. mori Jingsong strain (þnsd-Z/þnsd-Z), which is susceptible to BmDNV-Z, as the recurrent parent. In each generation, the individuals that were obtained were similar to the recurrent parent, except with regard to the nsd-Z gene, and were selected and backcrossed with the recurrent parent. Following 12 successive backcrosses, the traits of the NIL obtained were observed to be similar to those of the recurrent parent, i.e., the Jingsong strain, and this line was designated as Jingsong.nsd-Z.NIL (Li et al., 2007). All B. mori Jingsong (þnsd-Z/þnsd-Z) and Jingsong.nsd-Z.NIL (nsd-Z/ nsd-Z) larvae were reared on fresh mulberry leaves at 27  C. The newly exuviated fifth instar larvae were used for this experiment. 2.2. Virus BmDNV-Z was propagated in the fifth instar larvae of the susceptible B. mori Jingsong strain. The midguts were removed and

dried; those that were observed to contain BmDNV-Z were homogenized with distilled water, and the homogenate was filtered through gauze and centrifuged at 3500 rpm (3479g) for 20 min. The supernatant was supplemented with an equal volume of 7% acetic acid, the solution obtained was incubated at 25  C for 40 min, and its pH was then adjusted to 7.0 by using 1% NaCO3. This BmDNV-Z supernatant was diluted with distilled water to attain a 5% inoculum. Next, 100 ml of kanamycin (50 mg/ml) and 100 ml of gentamicin (7 mg/ml) were added to the viral suspension. Each newly exuviated fifth instar larva of the susceptible and resistant strains was orally administered 10 ml of the BmDNV-Z viral suspension by using an Eppendorf pipette, while the susceptible and resistant control larvae were treated with 10 ml of PBS. Oral administration of this viral volume produced 100% infection in the susceptible Jingsong strain. 2.3. Midgut collection The BmDNV-Z-infected fifth instar larvae were dissected, and the midguts were collected at different time points post infection (pi) (3, 12, 24, 48, 72, and 96 h pi). The midguts were quickly washed in diethylpyrocarbonate (DEPC)-treated PBS solution (137 mM NaCl, 2.68 mM KCl, 8.1 mM Na2HPO4, 1.47 mM KH2PO4 (pH 7.4)) and immediately frozen in liquid nitrogen. 2.4. Investigation of BmDNV-Z proliferation by performing real-time qPCR Total DNA was extracted from the midguts of the BmDNVZ-infected B. mori Jingsong and Jingsong.nsd-Z.NIL larvae at 3, 12, 24, 48, 72, and 96 h pi as well as from the PBS-treated larvae by using the Universal Genomic DNA Extraction Kit Ver 3.0 (TaKaRa). DNA samples obtained from five larvae per treatment group were used as the template for PCR amplification. The BmDNV-Z genome is composed of two kinds of different single-stranded linear DNA molecules (VD1 and VD2). VD1 (viral DNA 1) consists of 6543 nt including inverted terminal repeats (ITRs) of 224 nt, and VD2 (viral DNA 2) consists of 6022 nt including ITRs of 524 nt (Wang et al., 2007). Two pairs of primers were designed based on the ORF1 region of the BmDNV-Z VD1 genomic sequence (GenBank accession no. DQ017268) and the ORF2 region of the BmDNV-Z VD2 genomic sequence (GenBank accession no. DQ017269). The b-actin gene of B. mori was used as an internal control (Table 1). The specificity of the primers was confirmed using NCBI BLAST (BLASTN) algorithms. Real-time qPCR was conducted on an iCycler iQ instrument (BIO-RAD) using the SYBR Premix Ex Taq Kit (TaKaRa) according to the protocol prescribed by the manufacturer. Total DNA and specific BmDNV-Z primers were used for amplifying the ORF1 and ORF2 sequences of the viral VD1 and VD2 genome. Each amplification reaction was performed using a 25 ml reaction mixture under the following conditions: denaturation at 95  C for 1 min, followed by 40 cycles of treatment at 95  C for 10 s and at 60  C for 20 s. The fluorescent signals yielded by the PCR products were detected by subjecting the products to a heat-dissociation protocol (temperature range, 60–95  C) during the last step of each cycle. Following amplification, melting curves were constructed, and data analysis was performed using the iCycler iQ optical system software

Table 1 Primers used in real-time qPCR for determination of BmDNV-Z proliferation Target

Accession no.

Antisense primer

Sense primer

Size (bp)

BmDNV-Z VD1 ORF1 BmDNV-Z VD2 ORF2 Bombyx mori b-actin

DQ017268 DQ017269 AF422795

50 GACTTCATCTGCTGCTTTCC 30 50 GACCTGCACCAGATGGAAT 30 50 AATGGCTCCGGTATGTGC 30

50 ACATCTCATCTCCCTCAACG 30 50 CCTCGTTATGCTCAAGAAG 30 50 TTGCTCTGTGCCTCGTCT 30

109 115 150

Y.-Y. Bao et al. / Insect Biochemistry and Molecular Biology 38 (2008) 853–861

package version 3.1 (Bio-Rad). The concentrations of total DNAs of BmDNV-Z-infected and PBS-treated negative control samples were adjusted to 10 mg/ml. Two microliters of these samples (20 ng each) and 2 ml of no-template control (NTC) were used as templates and carried out in triplicate, and the average threshold cycle (Ct) value was used to quantify relative BmDNV-Z copy numbers. The results were standardized using b-actin expression levels. 2.5. Construction of the subtracted cDNA library through SSH Trizol reagent (Invitrogen) was used to extract total RNA from the midguts of the BmDNV-Z-infected and PBS-treated Jingsong and Jingsong.nsd-Z.NIL larvae at 12 h pi. Poly (A)þ RNA was purified by using an Oligotex mRNA Mini Kit (Qiagen) and 2 mg of Poly (A)þ RNA was used as the starting material for reverse transcription to construct the subtracted cDNA libraries. SSH was performed using a PCR-Select cDNA Subtraction Kit (Clontech). In keeping with the manufacturer’s protocol, we designated the cDNA samples containing specifically expressed transcripts, namely those that responded to BmDNV-Z infection, as ‘‘testers’’ and the reference cDNA samples as ‘‘drivers’’. The following three SSH libraries were constructed by performing hybridizations between strains that had been subjected to different treatments: the R library (corresponding to a resistant line), constructed using the PBS-treated (driver) and BmDNV-Z-infected (tester) Jingsong.nsd-Z.NIL strains; the S library (corresponding to a susceptible line), constructed by using the PBS-treated (driver) and BmDNV-Z-infected (tester) Jingsong strains; and the RS library (corresponding to a resistant line against a susceptible line), constructed by using the BmDNV-Z-infected Jingsong (driver) and Jingsong.nsd-Z.NIL (tester) strains. The subtracted cDNA libraries were generated by inserting the differentially expressed cDNA fragments into pGEM-T Easy vectors (Promega) and transforming these vectors in JM109 competent cells. Aliquots (100 ml) of the transformation mixture were then spread on Luria–Bertani (LB) agar plates containing 100 mg/ml ampicillin, 80 mg/ml X-gal, and 50 mM isopropyl 1-thio-b-Dgalactopyranoside (IPTG) and were incubated at 37  C overnight. All subtractive clones were subjected to sequencing, and the nucleotide and amino acid sequence homologies were determined by searching the GenBank/EMBL database using the BLASTX algorithm. 2.6. Confirmation of differentially expressed genes by performing real-time qPCR Trizol reagent (Invitrogen) was used to extract total RNA from the midguts of the BmDNV-Z-infected Jingsong and Jingsong.nsdZ.NIL larvae at 3, 12, 24, 48, 72, and 96 h pi as well as from PBStreated larvae. RNA was treated with 10 U of DNase I (TaKaRa)

855

following the manufacturer’s instructions. The concentration of DNase I-treated RNA was adjusted with DEPC H2O to 1 mg/ml and 1 mg of DNase I-treated RNA was reverse transcribed in a 10 ml of reaction system using the AMV RNA PCR Kit (TaKaRa). Real-time qPCR was performed using 2 ml of diluted first-strand cDNA (1/10) in each 25-ml reaction mixture. Specific primer sets were designed for genes encoding Bombyx NADPH oxidoreductase, ATP synthase, lysozyme, arylphorin, trypsin-like protease, transferrin, serpin5, membrane-bound alkaline phosphatase (m-ALP), sex-specific storageprotein 1 (SP1), secreted protein acidic and rich in cysteine (SPARC), and heat shock protein 1 (hsp1), and these primers are listed in Table 2. The conditions used for the real-time qPCR were as described in Section 2.4. The results were standardized to the expression level of the constitutive b-actin gene. An NTC sample was run to detect contamination and to determine the degree of dimer formation. A relative quantitative method (DDCt) was used to evaluate quantitative variation. 3. Results 3.1. Determination of BmDNV-Z proliferation by performing real-time qPCR To gain a better understanding of the invasion properties of BmDNV-Z, we monitored the dynamic proliferation of BmDNV-Z in the midguts of the B. mori-resistant and -susceptible strains by performing real-time qPCR. Melting curve analysis confirmed that specific amplification was achieved using two pairs of primers against BmDNV-Z VD1 and VD2 genomes (Table 1), for which no nonspecific amplification or primer-dimer artifacts were observed (data not shown). During the early stage of infection (3–24 h pi), the BmDNV-Z copy number was less than 10 in both the Jingsong and Jingsong.nsd-Z.NIL strains. However, with the development of infection, the viral proliferation levels rapidly increased in the midguts of the Jingsong larvae. The copy number corresponding to the VD1 genome increased from several copies to approximately 100 copies (Fig. 1a), while that corresponding to the VD2 genome increased from several copies to approximately 1000 copies within 24–72 h pi (Fig. 1b); for both genomes, the copy numbers then sharply increased to around 106 copies at 96 h pi (Fig. 1a and b). In contrast, the viral proliferation rate was extremely low in the midgut of the resistant Jingsong.nsd-Z.NIL strain; the copy numbers corresponding to the VD1 and VD2 genome remained below 10 until 72 h pi and then gradually increased to approximately 20 at 96 h pi (Fig. 1a and b). These results revealed that BmDNV-Z invaded the midgut tissue of both the Jingsong and Jingsong.nsdZ.NIL strains, however, viral proliferation in the midgut of the resistant strain was significantly inhibited by unknown mechanisms.

Table 2 Primers used in real-time qPCR for confirmation of differentially expressed genes Gene

Accession no.

Forward primer

Reverse primer

Bm Bm Bm Bm Bm Bm Bm Bm Bm Bm Bm Bm

ABF51402 BAA14420 CAA31417 AAS68506 ABF51358 ABF51459 ABD35289 ABK30932 ABF51447 AAB40947 ABD36284 AF422795

50 50 50 50 50 50 50 50 50 50 50 50

50 50 50 50 50 50 50 50 50 50 50 50

trypsin-like protease m-ALP SP1 serpin5 SPARC hsp1 transferrin NADPH oxidoreductase arylphorin lysozyme ATP synthase b-actin

GAGGTTGCCGTCAGATACACT 30 TCGAACAGTCCGAGCAGGTAG 30 GTCCGAGTCCAGGTAGGTGAG 30 CTGTTCCCGATTCCGTGACCT 30 GGAACAGCTCGTGACGGGACA 30 TGAAGAGCGAGGTCGAGGG 30 ATGGATTGACTTGAATTTCTC 30 TCAGGTTGAGTCCGTATGAGC 30 GCCACGGTTTCGTTGTTC 30 GGTTGTCCTCTGCGTTGGT 30 GGCTCCTTACTCTGGTTGTGC 30 AATGGCTCCGGTATGTGC 30

GGTGCTATTATCCAACAAGGTG 30 GAAGAATGGCAGAACGATAAGG 30 ATTGACATGGCGAGCTTCTTC 30 AGCCAGACTTAGCCAACTTCC 30 AGCGGGAGGCGGAATCAAACC 30 GTGGGATGACTGGGAGCGTAT 30 TTAGCACAGTTATTGGACACC 30 GCGTTTTGGATTTGCGTTTA 30 GCTGCGGCTTCAGGATTA 30 GACGTGTCACGGCTGCTCT 30 ACGGTAGGCTACGGCTTGTTT 30 TTGCTCTGTGCCTCGTCT 30

856

Y.-Y. Bao et al. / Insect Biochemistry and Molecular Biology 38 (2008) 853–861

Fig. 1. BmDNV-Z proliferation in the midguts of resistant and susceptible Bombyx strains. Total DNA was extracted from the fifth instar larval midguts of Jingsong and Jingsong.nsdZ.NIL strains at indicated time after BmDNV-Z infection and subjected to real-time qPCR analysis using BmDNV-Z VD1 primers (a) and BmDNV-Z VD2 primers (b) The relative genomic VD1 and VD2 copy numbers were calculated by using Bombyx b-actin as an internal control. Samples from each time point were tested in triplicate and the mean value was used for analysis relative to BmDNV-Z genomic copies.

3.2. Isolation and sequence determination of subtractive cDNA clones Following three SSH experiments, a total of 151 cDNA clones in the tester strains were isolated. There were 41 genes (69 clones) in the RS library, 28 genes (49 clones) in the R library and 23 genes (33 clones) in the S library, totaling 92 genes (151 clones) for all three libraries. The genes that were up-regulated following BmDNV-Z infection in the midgut of susceptible (S) and resistant (R) strains compared to PBS treatment, as well as those genes that, after infection, are more abundant in resistant than susceptible strains (RS) are listed in Table 3. According to the annotation of the Spodoptera frugiperda sequences (Barat-Houari et al., 2006), we classified the subtractive genes into five groups as follows: genes encoding proteins ubiquitously expressed by many cell types (AI– AIX), genes responsible for cell–cell communication (BIII), genes encoding transcription factors and gene-regulatory proteins (C), genes encoding molecules expressed in insects (DI–DIV), and others (EI–EIII) (Table 3). The distribution of the up-regulated genes was different in the three libraries, which is reflected by a few overlapping genes among the libraries, i.e., only three genes presented in all three libraries, which encode B. mori 30 kDa lipoprotein 6G1 precursor, Bmsqd-2, and alkaliphilic serine protease P-Iic; three genes encoding B. mori NADPH oxidoreductase, lebocin3 and serine protease precursor overlapped in the RS and R libraries; two genes encoding B. mori 30 kDa lipoprotein precursor and 35 kDa protease were isolated from the RS and S libraries; and two genes encoding B. mori alkaline nuclease and chlorophyllide A binding protein precursor were detected in the R and S libraries (Table 1 and Fig. 2). The differences in the gene distributions are also reflected by the most abundant transcripts in each library, i.e., ATP synthase and lysozyme in the RS library (7.25%, respectively); NADPH oxidoreductase in the R library (10.2%) and 35 kDa protease in the S library (9.09%). In terms of functional gene distribution, the most significant differences involved the antibacterial peptide gene group, which comprised 17.4% of all clones in the RS library, and was significantly higher than the number in the R library (4.08%), while none (0%) occurred in the S library. The serine protease and related inhibitor transcripts showed a high abundance that comprised 17.4, 18.4 and 12.1% of the clones in RS, R and S libraries, respectively. However, in contrast to the RS and R libraries, only alkaliphilic serine

protease P-Iic and the 35 KDa protease transcripts, and none of serine protease inhibitor transcripts, were found in the S library, suggesting that the serine protease and related inhibitor may play more important roles in B. mori-resistant strain than susceptible strain. In addition, some gene transcripts showed a relatively high abundance, i.e., the transcripts for the transport protein gene group including several 30 KDa lipoprotein and a 30 KDa hemolymph protein, which comprised a total of 5.8, 12.2 and 9.09% of all clones in the RS, R and S libraries, respectively. In addition, significant differences in gene distribution were observed between the R and S libraries. Twenty genes were isolated in the R library, but not in the S library, i.e., gag-like protein and chymotrypsin inhibitor CI-8A genes. Sixteen genes were only detected in the S library, but not in the R library, i.e., elongation factor 1 gamma, translation initiation factor 5A and two lipase1 genes, implied that the differential expression of these genes may represent their response to BmDNV-Z infection in resistant and susceptible strains, respectively (Table 3).

3.3. Determination of differentially expressed cDNAs by real-time qPCR To determine the up-regulated expression of those genes activated by BmDNV-Z infection and to understand gene expression variations coupled with viral proliferation, we performed time course analysis in the larval midgut by real-time qPCR (Fig. 3). We focused on the genes that were present in the RS library but not in S library as they are probably BmDNV-Z responsive genes in the resistant strain and may contribute to their resistance against BmDNV-Z infection. Based on this consideration, we selected 11 genes showing the different transcript abundances and functions from the RS library to determine their transcript levels following different treatment in the two B. mori strains. Among the genes, one gene encoding B. mori NADPH oxidoreductase with high abundance was present in both the RS (4.35%) and R libraries (10.2%), but not in the S library. Two genes encoding B. mori ATP synthase and lysozyme had the highest abundance (7.25%, respectively) in the RS library; two genes encoding B. mori serpin5 and arylphorin showed medium abundance (4.35%), respectively, and six genes showed low abundance (1.45%), which encode B. mori trypsin-like protease, transferrin, m-ALP, SP1, SPARC and hsp1, respectively. These genes are

Y.-Y. Bao et al. / Insect Biochemistry and Molecular Biology 38 (2008) 853–861

implicated in multiply biological processes, but little is known regarding their mechanism of action in antiviral responses. The transcripts of these genes were detected at a relatively low level in the midguts of the PBS-treated Jingsong and Jingsong.nsdZ.NIL strains compared to BmDNV-Z-infected strains (Fig. 3). The transcripts of lysozyme, trypsin-like protease and SP1 genes showed the same expression levels in the midguts of the PBS-treated susceptible and resistant larvae (Fig. 3c, h and i). The transcript expression levels of NADPH oxidoreductase, ATP synthase and arylphorin genes were slightly lower in the midguts of the PBS-treated susceptible larvae than resistant larvae (Fig. 3a, b and e). With regard to the serpin5, m-ALP, transferrin, hsp1 and SPARC genes, their transcript expression levels were higher in the midguts of the PBStreated susceptible larvae than resistant larvae, but this difference was not significant (Fig. 3d, f, g, j and k). Following BmDNV-Z infection, the transcript levels of all 11 genes increased in both the susceptible and resistant strains when compared with the PBStreated larvae. Moreover, throughout the time course, i.e., from 3 to 96 h pi, the expression levels of the 11 genes were consistently higher in the resistant larvae than the susceptible larvae, except for lysozyme at 24 h and SP1 at 96 h. The expression patterns of these genes differed among the strains. The expression of B. mori ATP synthase in the midguts of both susceptible and resistant strains reached a maximal level at 12 h and then gradually decreased, but increased slightly at 96 h (Fig. 3b). The expression pattern of B. mori serpin5, m-ALP and transferrin genes differed slightly from those of ATP synthase in that their highest expression levels in the resistant strain occurred at 12 h, but in the susceptible strain the maximal levels occurred at 24 h (Fig. 3d, f and g). The transcript levels of B. mori trypsin-like protease and hsp1 exhibited a mountain-like pattern, with the expression peaking at 24 h in both resistant and susceptible larvae (Fig. 3h and j). B. mori SP1 also exhibited a mountain-like pattern with expression peaking at 24 h in the resistant strain, but had the highest level at 12 h in the susceptible strain (Fig. 3i). B. mori lysozyme and SPARC transcripts attained maximum expression levels at 72 h, then decreased but still remained relatively high at 96 h in resistant larvae, while in susceptible larvae, their transcript levels attained the maximum at 24 and 48 h, respectively (Fig. 3c and k). The expression levels of B. mori arylphorin transcripts, from 3 to 12 h pi, did not change in susceptible larvae, but slightly increased in resistant larvae, then quickly increased in both strains from 24 h, and achieved their highest levels at 72 and 96 h in resistant and susceptible strains, respectively (Fig. 3e). The transcript levels of B. mori NADPH oxidoreductase sharply reached a maximum at 3 h in the resistant strain and attained a maximum at 12 h in the susceptible strain, then decreased but increased at 72 h again in both strains (Fig. 3a). 4. Discussion Although the mechanisms underlying the regulation of immune responses in the silkworm have been extensively studied, its antiviral immune mechanism remains unclear. In addition to numerous known antibacterial peptides and related recognition proteins, many other molecules exhibiting antiviral activities may be involved in the immune responses of insects, however, these molecules remain undefined. Our qPCR results revealed that BmDNV-Z invaded the midgut cells of both resistant and susceptible B. mori strains, however, its viral proliferation was inhibited by unknown mechanisms in the resistant strain. BmDNV-Z exclusively infects columnar cells of midgut epithelium of Bombyx larvae and multiplies only in the nuclei of the columnar cells (Guo et al., 1985). BmDNV-Z-infected columnar cells of Bombyx larval midgut were identified from 12 h pi, and at this time point, the nuclei of the columnar cells began to expand (Guo et al., 1985). Therefore, 12 h pi

857

might be a key time point that is closely linked to the viral proliferation in larval midgut cells. We constructed three 12 h pi cDNA libraries as they are complementary: The R and S library can display BmDNV-Z responsive genes upon the viral infection in resistant and susceptible strains, respectively, while the RS library can facilitate the identification of those genes related to BmDNV-Z resistance. Here, we focused on the identification of those genes present in the RS library but not in the S library, as it provides the possibility that they are not only BmDNV-Z responsive genes, but also affect BmDNV-Z proliferation in the Jingsong.nsd-Z.NIL strain. Among the three genes detected in the RS and R libraries (Table 1 and Fig. 2), B. mori NADPH oxidoreductase transcripts showed a significantly high abundance in both the RS (4.35%) and R (10.2%) libraries when compared to the transcripts of lebocin3 (1.45% in RS and 4.08% in R library) and highly basic serine protease (1.45% in RS and 2.04% in R library), suggesting that NADPH oxidoreductase is more likely to play an important role than the other two genes in defense against BmDNV-Z infection. Recently, an NADPH oxidoreductase exhibiting antiviral activity against BmNPV was purified from B. mori, and its expression levels were relatively higher in the gut juices of strains tolerant to BmNPV infection (Selot et al., 2007). This report led us to conjecture that NADPH oxidoreductase may be an antiviral factor in B. mori immune systems, whose activities are not only against BmNPV, but also against some other viral infections, i.e., BmDNVZ. The time course analysis provides a clearer explanation of NADPH oxidoreductase expression under different treatment conditions. The transcript levels were very low in both susceptible and resistant strains, but sharply reached maximal level at 3 h after BmDNV-Z infection, although its transcript level also increased from 3 h in susceptible larvae. However, this was much lower than that in resistant strain, suggesting that NADPH oxidoreductase is an early response gene and might contribute to its resistance against BmDNV-Z infection in the B. mori-resistant strain. Among the genes that were present in the RS library, the transcripts of three genes encoded by B. mori 30 kDa lipoprotein 6G1 protein, Bmsqd-2 and alkaliphilic serine protease P-Iic were also detected in the R and S libraries (Table 1 and Fig. 2), indicating that they are the common BmDNV-Z responsive genes in susceptible and resistant larvae, but may not be necessary for resistance against BmDNV-Z infection. The isolation of other 30 kDa lipoprotein and 35 kDa serine protease transcripts from the RS and S libraries provided further support for that some of 30 kDa lipoproteins and some of serine proteases commonly respond to BmDNV-Z infection in the two B. mori strains. In addition, two gene transcripts encoding B. mori alkaline nuclease and chlorophyllide A binding protein were detected in both the R and S libraries, but not in the RS library, most likely because they had similar up-regulated expression levels in response to BmDNV-Z infection in the two B. mori strains (Table 1 and Fig. 2). As the transcripts for the seven genes above were detected in susceptible larvae, we suppose that they did not contribute much to the inhibition of viral proliferation. However, as potential BmDNV-Z responsive factors, they are probably involved in B. mori immune responses of midgut cells with unknown function. The genes isolated from the RS library signify more abundant transcript levels in resistant than susceptible larvae upon BmDNV-Z infection. This is reflected by the time course analysis of gene expression (Fig. 3). Within the time course of 3–96 h pi, almost all transcript levels of the 11 genes were higher in resistant than susceptible larvae, implying that to a certain extent they may contribute to resistance against BmDNV-Z infection (Fig. 3). When BmDNV-Z invaded B. mori larval midguts, its proliferations did not change much at the early stage of infection (3–24 h) in either B. mori

858

Y.-Y. Bao et al. / Insect Biochemistry and Molecular Biology 38 (2008) 853–861

Table 3 Distribution of subtracted cDNA clones in the major functional categories Gene name

Bombyx mori scaffold

Functional class

Clone number (percentage) of subtracted cDNA clones in each library Library RS

Library R

Library S

NADPH oxidoreductase NADH dehydrogenase 1 beta subcomplex 10 cytochrome c oxidase subunit II cytochrome c ADP/ATP translocase phosphate transport protein potassium coupled amino acid transporter gag-like protein muscle LIM protein annexin transferrin chlorophyllide A binding protein precursor alanine-glyoxylate transaminase 1 C-1-tetrahydrofolate synthase, cytoplasmic Sop2 protein alkaline nuclease methylated DNA-protein cysteine methyltransferase cell division protein syntaxin 5A peritrophin membrane protein 1 transmembrane emp24 protein myosin 1 light chain tropomyosin isoform 5 elongation factor 1 gamma translation initiation factor 5A vacuolar ATP synthase subunit G vacuolar ATP synthase 21 kDa proteolipid subunit ATP synthase enolase cytosolic malate dehydrogenase triosephosphate isomerase (TIM) serine carboxypeptidase 1 leukotriene A4 hydrolase beta-N-acetylglucosaminidase 2 lipase1 lipase1 carboxylesterase glucosidase membrane-bound alkaline phosphatase heat shock protein 1 heat shock 70 kDa protein cognate 30 kDa lipoprotein 6G1 precursor 30 kDa lipoprotein 19G1 precursor 30 kDa lipoprotein precursor 30 kDa hemolymph protein mitochondrial intermembrane space translocase Tim10 transport protein Sec61 gamma subunit chromobox-like protein 5 Bmsqd-2 STIP signal recognition particle 14 kDa protein-like protein

008293 001987 019209 014380 009566 002767 007946 008728 000742 004361 001331 000572 015623 001812 009824 004936 001847 000465 011714 005383 009031 008479 000805 001809 002932 004483 007661 000976 004512 005686 000966 001535 006350 006401 No hit 007814 002571 003745 012587 008409 002434 005297 010759 006074 001751 000383 000312 003653 005497 001138 No hit

AI electron transport AI electron transport AI electron transport AI electron transport AI transport protein AI phosphate transport AI amino acid transport AI zinc ion binding AI zinc ion binding AI Ca ion binding AI iron ion transport AI small molecule binding AI biosynthesis AI biosynthesis AII mRNA processing AIII DNA/RNA endonuclease AIII DNA repair AIII cell cycle AIV membrane receptor AIV membrane protein AIV membrane protein AIV muscle contraction AIV muscle contraction AV protein synthesis AV protein synthesis AVI ATP synthesis enzyme AVI ATP synthesis enzyme AVI ATP synthesis enzyme AVI glycolysis AVI glycolysis AVI glycolysis AVI proteolysis AVI hydrolysis AVI peptidoglycan hydrolysis AVI lipolysis AVI lipolysis AVI catalytic enzyme AVI carbohydrate metabolism AVI metabolism AVII stress response AVII stress response AIX transport protein AIX transport protein AIX transport protein AIX transport protein AIX protein transport AIX protein transport AIX chromatin binding AIX nucleic acid binding AIX RNA binding AIX protein targeting

3 (4.35) 0 (–) 2 (2.90) 0 (–) 0 (–) 0 (–) 0 (–) 0 (–) 1 (1.45) 0 (–) 1 (1.45) 0 (–) 0 (–) 0 (–) 2 (2.90) 0 (–) 0 (–) 1 (1.45) 2 (2.90) 2 (2.90) 1 (1.45) 0 (–) 1 (1.45) 0 (–) 0 (–) 2 (2.90) 0 (–) 5 (7.25) 2 (2.90) 1 (1.45) 0 (–) 1 (1.45) 0 (–) 0 (–) 0 (–) 0 (–) 1 (1.45) 0 (–) 1 (1.45) 1 (1.45) 0 (–) 2 (2.90) 1 (1.45) 1 (1.45) 0 (–) 1 (1.45) 0 (–) 1 (1.45) 1 (1.45) 0 (–) 0 (–)

5 (10.2) 0 (–) 0 (–) 0 (–) 0 (–) 1 (2.04) 0 (–) 3 (6.12) 0 (–) 1 (2.04) 0 (–) 1 (2.04) 1 (2.04) 0 (–) 0 (–) 2 (4.08) 0 (–) 0 (–) 0 (–) 0 (–) 0 (–) 1 (2.04) 0 (–) 0 (–) 0 (–) 0 (–) 0 (–) 0 (–) 0 (–) 0 (–) 1 (2.04) 0 (–) 1 (2.04) 0 (–) 0 (–) 0 (–) 0 (–) 2 (4.08) 0 (–) 0 (–) 2 (4.08) 4 (8.16) 0 (–) 0 (–) 2 (4.08) 0 (–) 0 (–) 0 (–) 1 (2.04) 1 (2.04) 0 (–)

0 (–) 2 (6.06) 0 (–) 1 (3.03) 1 (3.03) 0 (–) 1 (3.03) 0 (–) 0 (–) 0 (–) 0 (–) 1 (3.03) 0 (–) 1 (3.03) 0 (–) 1 (3.03) 1 (3.03) 0 (–) 0 (–) 0 (–) 0 (–) 0 (–) 0 (–) 2 (6.06) 2 (6.06) 0 (–) 2 (6.06) 0 (–) 0 (–) 0 (–) 0 (–) 0 (–) 0 (–) 1 (3.03) 1 (3.03) 1 (3.03) 0 (–) 0 (–) 0 (–) 0 (–) 0 (–) 1 (3.03) 0 (–) 2 (6.06) 0 (–) 0 (–) 2 (6.06) 0 (–) 1 (3.03) 0 (–) 2 (6.06)

type IV collagen peritrophin 1 secreted protein acidic and rich in cysteine

004680 No hit 002143

BIII ECM protein BIII extracellular matrix protein BIII extracellular matrix protein

0 (–) 0 (–) 1 (1.45)

0 (–) 3 (6.12) 0 (–)

2 (6.06) 0 (–) 0 (–)

bolA-like 3

006282

C transcription regulator

1 (1.45)

lysozyme gloverin3 cecropin B lebocin3 like moricin calreticulin arylphorin SP1 nitrile-specifier protein phosphatidylethanolamine binding protein isoform 2 alkaliphilic serine protease P-Iic 35 kDa protease serine protease (SP2) trypsin-like protease serine protease precursor (highly basic protease) chymotrypsin-like serine protease

005945 001124 001093 005659 000359 010759 003127 002535 003828 001229 000915 013163 000596 019644 004999 002161

DI AMP DI AMP DI AMP DI AMP DI AMP DI multi-function DII storage molecule DII storage molecule DIII unknown function DIII multi function DIV protease DIV protease DIV protease DIV protease DIV protease DIV protease

5 (7.25) 3 (4.35) 2 (2.90) 1 (1.45) 1 (1.45) 0 (–) 3 (4.35) 1 (1.45) 0 (–) 0 (–) 4 (5.80) 2 (2.90) 0 (–) 1 (1.45) 1 (1.45) 1 (1.45)

0 (–) 0 (–) 0 (–) 0 (–) 2 (4.08) 0 (–) 0 (–) 0 (–) 0 (–) 1 (2.04) 0 (–) 1 (2.04) 0 (–) 1 (2.04) 0 (–) 1 (2.04) 0 (–)

0 (–) 0 (–) 0 (–) 0 (–) 0 (–) 0 (–) 1 (3.03) 0 (–) 0 (–) 0 (–) 0 (–) 1 (3.03) 3 (9.09) 0 (–) 0 (–) 0 (–) 0 (–)

Y.-Y. Bao et al. / Insect Biochemistry and Molecular Biology 38 (2008) 853–861

859

Table 3 (continued ) Gene name

Bombyx mori scaffold

Functional class

putative serine protease-like protein 2 trypsin Ia precursor serpin5 chymotrypsin inhibitor CI-8A putative protease inhibitor 4

008330 012571 002283 No hit 019579

DIV DIV DIV DIV DIV

HMG176 putative senescence-associated protein unknown unknown

004056 015679 000488 014233

EI EI EIII EIII

Clone numbers

protease protease protease inhibitor protease inhibitor protease inhibitor

Clone number (percentage) of subtracted cDNA clones in each library Library RS

Library R

0 (–) 0 (–) 3 (4.35) 0 (–) 0 (–)

1 (2.04) 1 (2.04) 0 (–) 3 (6.12) 1 (2.04)

Library S 0 0 0 0 0

(–) (–) (–) (–) (–)

0 (–) 1 (1.45) 1 (1.45) 0 (–)

3 (6.12) 0 (–) 0 (–) 2 (4.08)

0 0 0 0

(–) (–) (–) (–)

69

49

33

List of B. mori genes responsive to BmDNV-Z infection in library RS, R and S. Gene name: annotation of the subtracted cDNA sequences was based on GenBank/EMBL database using the BLASTX algorithm. Scaffolds identify the genes in the Bombyx mori database (http://silkworm.genomics.org.cn/index.jsp). Number and percentage of clones: distribution of the cDNA clones corresponding to the given gene with available sequences in the three subtracted libraries (library RS, R and S), respectively.

strain, then exponentially increased in the susceptible strain, but remained at very low levels even at 96 h in the resistant strain (Fig. 1). The reason that BmDNV-Z proliferation was notably. inhibited in the resistant strain may be explained by the up-regulated expression of some early responsive host genes. Upon BmDNV-Z invasion, ATP synthase, serpin5, m-ALP and transferrin quickly increased their transcript levels from 3 h and reached maximal levels at 12 h pi in resistant larvae, despite the fact that transcript levels also increased in the susceptible strain, but not significantly so when compared to the resistant strain (Fig. 3b, d, f and g). Similarly, three host genes, trypsin-like protease, SP1 and hsp1, were quickly up-regulated upon BmDNV-Z infection, but their expression peaks occurred at 24 h pi despite their transcript levels also reaching maximum levels around 12–24 h, which were much lower than in the resistant strain (Fig. 3h, i and j). In addition, NADPH oxidoreductase expression sharply reached its highest level at 3 h pi in the resistant strain (Fig. 3a). The simultaneously increased expression of many host genes at an early stage of infection (3–24 h) in resistant larvae may affect BmDNV-Z gene duplication or expression in B. mori host cells and could result in inhibition of BmDNV-Z proliferation. The expression patterns of other host genes were somehow different, i.e., arylphorin, lysozyme and SPARC. They also responded to BmDNV-Z infection, but their expression peaks occurred at 72 h pi in the resistant strain (Fig. 3c, e and k), implying that they probably do not contribute largely to the inhibition of BmDNV-Z viral proliferation at an early stage of infection, but rather play an important role during the late stages of infection. The expression of immune genes in insects is regulated at the level of transcription (Engstrom, 1999). In Drosophila melanogaster, the Toll and Imd pathways control the majority of genes activated by microbial infection and are involved in nearly all known Drosophila innate immune reactions (Gregorio et al., 2002), i.e., proteases and proteases inhibitors are involved in the prophenoloxidase activation cascade and Toll-signaling pathway activation during insect immune responses (Zhu et al., 2003). In the RS library, the antibacterial peptide gene group, and serine proteases with related inhibitor group had the most abundant transcript levels (17.4%, respectively). These immune-related genes, except lysozyme, showed a similar expression pattern after BmDNV-Z infection, suggesting the possibility that BmDNV-Z invasion activated the Toll and/or Imd pathways, and resulted in rapid expression of early response genes, i.e., their expression peaks simultaneously presented at around 3–24 h pi (Fig. 3). These early expressed genes probably play different roles in defending against BmDNV-Z infection. Some genes may function to inhibit BmDNV-Z replication, i.e., B. mori hsp1 exhibits 75.1–79.5% structural identity with small heat shock proteins of B. mori (Sakano et al., 2006) and the

small heat shock protein hsp27 has been shown to inhibit viral replication in T lymphocytes (Liang et al., 2007). While the products of some genes perhaps have potential antiviral activities, i.e., transferrin possesses antimicrobial properties against bacterial and fungal infection (Yoshiga et al., 1997, 1999; Yun et al., 1999; Seitz et al., 2003; Thompson et al., 2003; Kucharski and Maleszka, 2003) and a member of the transferrin gene family, lactoferrin, exhibits its activities against DNA and RNA viruses (van der Strate et al., 2001; Wakabayashi et al., 2006). The up-regulated expression of some late response genes probably affect the spreading of BmDNV-Z virus between the midgut cells, i.e., SPARC modulates interactions between cells and the extracellular matrix during wound healing and tumor growth (Motamed, 1999). In conclusion, the antiviral mechanism occurring in resistant B. mori strains are not due to resistance against BmDNV-Z invasion, but due to the inhibition of BmDNV-Z proliferation in larval midgut cells. This process may be regulated via interactions involving multiple genes. The pathways involved in these reactions are currently unclear. Our data provide a global view of host responses to viral infection and insights for further investigation of the complex interactions between BmDNV and its host, B. mori. Subsequent investigations should include the functional determination of individual genes implicated by differential expression, i.e., direct or indirect antiviral activities. The information obtained in this study could be used to gain a better understanding of defense strategies elicited by the host against viral infection in lepidopteran insects. Furthermore, it provides useful insight into the infection properties of insect viruses.

Fig. 2. Gene distribution between three subtracted cDNA libraries. Numbers in parentheses are total cDNA clones from each library. Details for the genes are listed in Table 3.

860

Y.-Y. Bao et al. / Insect Biochemistry and Molecular Biology 38 (2008) 853–861

Fig. 3. Expression time course of BmDNV-Z responsive genes in Bombyx midguts. Fifth instar larvae of Jingsong and Jingsong.nsd-Z.NIL strains were infected with BmDNV-Z. Total RNA was extracted from the midgut at indicated times after infection and subjected to DNase I treatment and reverse transcription. Two microliters of each 10-fold diluted firststrand cDNA (20 ng) reaction were analyzed in each real-time qPCR reaction. The reaction was performed with the specific primers for amplifying Bombyx (a) NADPH oxidoreductase, (b) ATP synthase, (c) lysozyme, (d) serpin5, (e) arylphorin, (f) m-ALP, (g) transferrin, (h) trypsin-like protease, (i) SP1, (j) hsp1, (k) and SPARC. The relative expression levels of each gene at different time points were normalized using the Ct values obtained for the b-actin amplifications run in the same plate. In each assay, the expression level is shown relative to the lowest expression level, which is arbitrarily set to one. All samples were tested in triplicate. The mean value  SD was used for analysis of relative transcript levels for each time point using the DDCt method. The Bombyx Jingsong and Jingsong.nsd-Z.NIL strains are shown on the left (blue) and right (purple), respectively. (For interpretation of the references to color in this figure legend, the reader is referred to the web version of this article.)

Y.-Y. Bao et al. / Insect Biochemistry and Molecular Biology 38 (2008) 853–861

Acknowledgments This work was supported by the National Program of High-tech Research and Development (863 High-Tech Program, No. 2006AA10A119) from the Ministry of Science and Technology of China; National Natural Science Foundation of China (Grant No.30570074, 30400327), Natural Science Foundation of Zhejiang Province, China (Grant No.Y307049) and Scientific Research Fund of Zhejiang Provincial Education Department (Grant No. 20070167). References Abe, H., Harada, T., Kanehara, M., Shimada, T., Ohbayashi, F., Oshiki, T., 1998. Genetic mapping of RAPD markers linked to the densonucleosis refractoriness gene, nsd-1, in the silkworm, Bombyx mori. Genes Genet. Syst. 73, 237–242. Bando, H., Choi, H., Ito, Y., Kawase, S., 1990. Terminal structure of a densovirus implies a hairpin transfer replication which is similar to the model for AAV. Virology 179, 57–63. Bando, H., Choi, H., Ito, Y., Nakagaki, M., Kawase, S., 1992. Structural analysis on the single-stranded genomic DNAs of the virus newly isolated from silkworm: the DNA molecules share a common terminal sequence. Arch. Virol. 124, 187–193. Bando, H., Hayakawa, T., Asano, S., Sahara, K., Nakagaki, M., Iizuka, T., 1995. Analysis of the genetic information of a DNA segment of a new virus from silkworm. Arch. Virol. 140, 1147–1155. Barat-Houari, M., Hilliou, F., Jousset, F.X., Sofer, L., Deleury, E., Rocher, J., Ravallec, M., Galibert, L., Delobel, P., Feyereisen, R., Fournier, P., Volkoff, A.N., 2006. Gene expression profiling of Spodoptera frugiperda hemocytes and fat body using cDNA microarray reveals polydnavirus-associated variations in lepidopteran host genes transcript levels. BMC Genomics 7, 160. Diatchenko, L., Lau, Y.F., Campbell, A.P., Chenchik, A., Moqadam, F., Huang, B., Lukyanov, S., Lukyanov, K., Gurskaya, N., Sverdlov, E.D., Siebert, P.D., 1996. Suppression subtractive hybridization: a method for generating differentially regulated or tissue-specific cDNA probes and libraries. Proc. Natl. Acad. Sci. U.S.A. 93, 6025–6030. Eguchi, R., Furuta, Y., Ninaki, O., 1986. Dominant nonsusceptibility to densonucleosis virus in the silkworm, Bombyx mori. J. Seric. Sci. Jpn. 55, 177–178. Engstrom, Y., 1999. Induction and regulation of antimicrobial peptides in Drosophila. Dev. Comp. Immunol. 23, 345–358. Gregorio, E.D., Spellman, P.T., Tzou, P., Rubin, G.M., Lemaitre, B., 2002. The Toll and Imd pathways are the major regulators of the immune response in Drosophila. EMBO J. 21, 2568–2579. Guo, X.J., Qian, Y.J., Hu, X.F., Wang, H.L., 1985. The research of parasitized location of BmDNV in silkworm. Acta Seric. Sin. 11, 93–98 (in Chinese). Hu, X.F., Qian, Y.J., Wang, H.L., 1984. Studies on infectivity of silkworm densonucleosis virus to some silkworm races. Acta Seric. Sin. 10, 87–90.

861

Kucharski, R., Maleszka, R., 2003. Transcriptional profiling reveals multifunctional roles for transferring in the honeybee, Apis mellifera. J. Insect Sci. 3, 27. Li, M., Hou, C., Zhao, Y., Xu, A., Guo, X., Huang, Y., 2007. Detection of homozygosity in near isogenic lines of non-susceptible to Zhenjiang strain of densonucleosis virus in silkworm. Afr. J. Biotechnol. 6, 1629–1633. Liang, D., Benko, Z.B., Agbottah, E., Bukrinsky, M., Zhao, R.Y., 2007. Anti-Vpr activities of heat shock protein 27. Mol. Med. 13, 229–239. Motamed, K., 1999. Molecules in focus SPARC (osteonectin/BM-40). Int. J. Biochem. Cell Biol. 31, 1363–1366. Sakano, D., Li, B., Xia, Q., Yamamoto, K., Banno, Y., Fujii, H., Aso, Y., 2006. Genes encoding small heat shock proteins of the silkworm, Bombyx mori. Biosci. Biotechnol. Biochem. 70, 2443–2450. Seitz, V., Clermont, A., Wedde, M., Hummel, M., Vilcinskas, A., Schlatterer, K., Podsiadlowski, L., 2003. Identification of immunorelevant genes from greater wax moth (Galleria mellonella) by a subtractive hybridization approach. Dev. Comp. Immunol. 27, 207–215. Seki, H., 1984. Mode of inheritance of the resistance to the infection with the densonucleosis virus (Yamanashi isolate) in the silkworm, Bombyx mori. J. Seric. Sci. Jpn. 53, 472–475 (in Japanese with English summary). Selot, R., Kumar, V., Shukla, S., Chandrakuntal, K., Brahmaraju, M., Dandin, S.B., Laloraya, M., Kumar, P.G., 2007. Identification of a soluble NADPH oxidoreductase (BmNOX) with antiviral activities in the gut juice of Bombyx mori. Biosci. Biotechnol. Biochem. 71, 200–205. van der Strate, B.W., Beljaars, L., Molema, G., Harmsen, M.C., Meijer, D.K., 2001. Antiviral activities of lactoferrin. Antiviral Res. 52, 225–239. Thompson, G.J., Crozier, Y.C., Crozier, R.H., 2003. Isolation and characterization of a termite transferrin gene up-regulated on infection. Insect Mol. Biol. 12, 1–7. Wang, Y.J., Yao, Q., Chen, K.P., Wang, Y., Lu, J., Han, X., 2007. Characterization of the genome structure of Bombyx mori densovirus (China isolate). Virus Genes 35, 103–108. Wakabayashi, H., Yamauchi, K.Y., Takase, M., 2006. Lactoferrin research, technology and applications. Int. Dairy J. 16, 1241–1251. Watanabe, H., Maeda, S., 1978. Genetic resistance to peroral infection with a densonucleosis virus in the silkworm, Bombyx mori. J. Seric. Sci. Jpn. 47, 209–214 (in Japanese with English summary). Watanabe, H., 2002. Genetic resistance of the silkworm, Bombyx mori to viral diseases. Curr. Sci. 83, 439–446. Yoshiga, T., Hernandez, V.P., Fallon, A.M., Law, J.H., 1997. Mosquito transferrin, an acute-phase protein that is up-regulated upon infection. Proc. Natl. Acad. Sci. U.S.A. 94, 12337–12342. Yoshiga, T., Georgieva, T., Dunkov, B.C., Harizanova, N., Ralchev, K., Law, J.H., 1999. Drosophila melanogaster transferrin. Cloning, deduced protein sequence, expression during the life cycle, gene localization and up-regulation on bacterial infection. Eur. J. Biochem. 260, 414–420. Yun, E.Y., Kang, S.W., Hwang, J.S., Goo, T.W., Kim, S.H., Jin, B.R., Kwon, O.Y., Kim, K.Y., 1999. Molecular cloning and characterization of a cDNA encoding a transferrin homolog from Bombyx mori. Biol. Chem. 380, 1455–1459. Zhu, Y., Johnson, T.J., Myers, A.A., Kanost, M.R., 2003. Identification by subtractive suppression hybridization of bacteria-induced genes expressed in Manduca sexta fat body. Insect Biochem. Mol. Biol. 33, 541–559.