- Email: [email protected]
Direct effect of curcumin on porcine ovarian cell functions
Animal Reproduction Science xxx (xxxx) xxx–xxx
Contents lists available at ScienceDirect
Animal Reproduction Science journal homepage: www.elsevier.com/locate/anireprosci
Direct effect of curcumin on porcine ovarian cell functions Attila Kádasia, Nora Maruniakováa, Aneta Štochmaľovác, Miroslav Bauerb,c, Roland Grossmannd, Abdel Halim Harrathe, Adriana Kolesárováa, ⁎ Alexander V. Sirotkinb,c,e, a
Slovak University of Agriculture in Nitra, Nitra, Slovak Republic Research Institute of Animal Production, Lužianky, Slovak Republic Constantine the Philosopher University, Nitra, Slovak Republic d Friedrich Loeffner Institute, Mariensee, Neustadt, Germany e King Saud University, Ryiadh, Saudi Arabia b c
AR TI CLE I NF O
AB S T R A CT
Keywords: Curcuma longa Ovary Proliferation Apoptosis Steroid hormone
Curcuma longa Linn (L.) is a plant widely used in cooking (in curry powder a.o.) and in folk medicine, but its action on reproductive processes and its possible mechanisms of action remain to be investigated. The objective of this study was to examine the direct effects of curcumin, the major Curcuma longa L. molecule, on basic ovarian cell functions such as proliferation, apoptosis, viability and steroidogenesis. Porcine ovarian granulosa cells were cultured with and without curcumin (at doses of 0, 1, 10 and 100 μg/ml of medium). Markers of proliferation (accumulation of PCNA) and apoptosis (accumulation of bax) were analyzed by immunocytochemistry. The expression of mRNA for PCNA and bax was detected by RT-PCR. Cell viability was detected by trypan blue exclusion test. Release of steroid hormones (progesterone and testosterone) was measured by enzyme immunoassay (EIA). It was observed that addition of curcumin reduced ovarian cell proliferation (expression of both PCNA and its mRNA), promoted apoptosis (accumulation of both bax and its mRNA), reduced cell viability, and stimulated both progesterone and testosterone release. These observations demonstrate the direct suppressive effect of Curcuma longa L./curcumin on female gonads via multiple mechanisms of action − suppression of ovarian cell proliferation and viability, promotion of their apoptosis (at the level of mRNA transcription and subsequent accumulation of promoters of genes regulating these activities) and release of anti-proliferative and pro-apoptotic progesterone and androgen. The potential anti-gonadal action of curcumin should be taken into account by consumers of Curcuma longa L.-containing products.
1. Introduction For a long time, humans have used medicinal and spicy herbs for cooking, for the treatment of physiological disorders, and for the regulation of physiological processes, including reproduction (Nadkarni, 1976; Hardy, 2000; Nayak et al., 2016). However, the mechanisms of action of these herbs and their possible side effects are not yet fully understood, and they require rigorous investigation. One of the plants often used in cooking and folk medicine is Curcuma longa L.— Indian Turmeric. This plant is a part of curry
⁎
Corresponding author at: Faculty of Natural Science, Constantine the Philosopher University, Tr. A. Hlinku 1, 949 74, Nitra, Slovak Republic. E-mail address: [email protected] (A.V. Sirotkin).
http://dx.doi.org/10.1016/j.anireprosci.2017.05.001 Received 22 February 2017; Received in revised form 2 May 2017; Accepted 10 May 2017 0378-4320/ © 2017 Elsevier B.V. All rights reserved.
Please cite this article as: Kádasi, A., Animal Reproduction Science (2017), http://dx.doi.org/10.1016/j.anireprosci.2017.05.001
Animal Reproduction Science xxx (xxxx) xxx–xxx
A. Kádasi et al.
powder and other spices currently considered functional food. A major biologically active component of Curcuma longa L. is the phenolic compound curcumin, with the chemical name 1, 7-bis (4-hydroxy-3-methoxyphenyl)-1, 6-heptadiene-3, 5-dione (Aggarwal et al., 2007; Ak and Gülçin, 2008). Owing to its pro-apoptotic, anti-proliferative, anti-oxidant, and anti-angiogenic properties, curcumin has been studied as a potentially useful agent in the treatment of cancer and other disorders (Tiwari-Pandey and Ram Sairam, 2009; Terlikovska et al., 2014; Vallianou et al., 2015; Nayak et al., 2016). There is a growing body of evidence that curcumin can affect ovarian functions. Numerous in-vitro and in-vivo studies demonstrated its ability to directly suppress proliferation and promote apoptosis in ovarian cancer cells (Shehzad et al., 2010; Watson et al., 2010; Terlikowska et al., 2014; Vallianou et al., 2015; Seo et al., 2016), and to prevent the adverse effects of aging, ovarian insufficiency (Tiwari-Pandey and Ram Sairam, 2009; Voznesens'ka et al., 2010; Alekseyeva et al., 2011), ionizing radiation (Aktas et al., 2012), ischemia (Eser et al., 2015), oxidative stress (Qin et al., 2015) and mycotoxins (Qin et al., 2015) on ovarian function. Despite its therapeutic action, curcuma/turmeric is currently consumed by healthy individuals mainly as a cooking additive and functional food for the prevention of various disorders and illnesses. Moreover, its beneficial effects could potentially be useful in agriculture for the maintenance of healthy farm animals. Nevertheless, in contrast to medical studies, the action of curcumin on function of healthy ovarian cells not exposed to any negative external factor is very poorly investigated. The available reports are scarce, contradictory, and involve mainly laboratory rodents. Only one study was performed on a farm animal, a pig (Nurcahyo and Soejono, 2007). Some in-vivo studies have demonstrated the stimulatory effect of curcumin or its analogue on ovarian functions—it promoted proliferation, reduced apoptosis in murine ovarian cells (Voznesens'ka et al., 2010; Aktas et al., 2012), and supported murine ovarian oogenesis (Voznesens'ka et al., 2010; Alekseyeva et al., 2011), folliculogenesis and steroidogenesis (Tiwari-Pandey and Ram Sairam, 2009); on the contrary, other authors have reported the ability of curcumin to suppress reproductive functions—to prolong puberty, to reduce fecundity (Murphy et al., 2012), and to suppress proliferation and progesterone release in cultured rat ovarian luteal cells (Purwaningsih et al., 2012), as well as to inhibit proliferation, stimulate apoptosis, and suppress progesterone and estradiol release by porcine ovarian follicular granulosa cells (Nurcahyo and Soejono, 2007). The mechanisms of action of curcumin on healthy ovarian cells, especially in farm animals, require further elucidation. It remains unknown whether curcumin affects accumulation of proliferation and apoptosis regulators/markers via their gene transcription (accumulation of their mRNA), translation (peptide production) or metabolism, whether curcumin-induced changes in rate of proliferation- and apoptosis-related molecules affect ovarian cell viability, whether curcumin can affect ovarian androgen release, and what the hormone-based mechanisms behind reproductive effects of curcumin could be. The aim of our in-vitro experiments was to examine the action of curcumin on basic ovarian cell functions—proliferation, apoptosis (accumulation of PCNA, bax and their mRNA), cell viability, and the release of progesterone and testosterone. 2. Materials and methods 2.1. Isolation and culture of granulosa cells Granulosa cells were collected from the ovaries of prepubertal (100–120 days old, weight 105–130 kg) Slovakian White gilts following their slaughter at a local abattoir. Ovaries were transported to the laboratory at 4 °C and washed in sterile physiological solution. Follicular fluid was aspirated from 3 to 5 mm follicles and granulosa cells were isolated by centrifugation for 10 min at 200g. Cells were then washed in sterile DMEM/F12 1:1 medium (BioWhittaker, Verviers, Belgium), and resuspended in the same medium supplemented with 10% fetal calf serum (BioWhittaker) and 1% antibiotic-antimycotic solution (Sigma, St. Louis, MO, USA) at a final concentration 106 cells/mL medium. 1 ml/well of the granulosa cell suspension was dispensed in 24-well culture plates (Nunc, Roskilde, Denmark, for EIA, trypan blue test and RT-PCR, see below) and 200 μl/well in 16-well chamber slides (Nunc Inc., International, Naperville, USA) for immunocytochemistry. Both the plate wells and chamber slides were incubated at 37 °C and 5% CO2 in humidified air until 60–75% confluent monolayer was formed (3–5 days), at which point medium was renewed. Further culture was performed in 2 ml culture medium in 24-well plates or 200 μl/medium in 16-well chamber slides as described previously. After medium replacement experimental cells were cultured in the presence of curcumin (Changsha Sunfull Bio-tech. Co, Hunan, China, purity 98.9%) at concentrations of 0, 1, 10 and 100 μg/ml for immunocytochemistry and EIA; at 0 and 100 μg/ml for trypan blue extrusion test; 0, 10 and 100 μg/ml for RT-PCR. These doses correspond to the curcumin doses used in previous in-vitro experiments performed on healthy and malignant ovarian cells (Nurcahyo and Soejono, 2007; Shehzad et al., 2010; Watson et al., 2010; Purwaningsih et al., 2012). Curcumin was dissolved first in DMSO (concentration 10 mg/ml) and than in culture medium just before their addition to the cells. The maximal concentration of DMSO in culture was 0.1%. This amount of DMSO was added to the cells of control group. After 2 days of culture with or without curcumin, the medium was removed. The cells in chamber slides were washed in ice-cold PBS (pH 7.5), fixed in paraformaldehyde (4% in PBS, pH 7.2–7.4; 60 min), dehydrated in alcohols (70%, 80%, 96%; 10 min each) and held at 4 °C in preparation for immunocytochemistry. The medium from the 24-well plates was gently aspirated and frozen at −24 °C to await RT-PCR and RIA. Some of the granulosa cells cultured in these plates cultured both with (100 μg/ml) and without curcumin were subjected to trypan blue extrusion test. 2.2. Immunocytochemical analysis After fixation and washing in PBS for 5 min, the cells were incubated in blocking solution (1% of goat serum in PBS) at room 2
Animal Reproduction Science xxx (xxxx) xxx–xxx
A. Kádasi et al.
temperature for 1 h to block nonspecific binding of antiserum. Afterwards, the cells were incubated with monoclonal antibodies against either PCNA, the proliferation marker (Ulrich and Takahashi, 2013) or bax, the marker of apoptosis (Elmort, 2007) (Santa Cruz Biotechnology, Inc., Santa Cruz, USA; dilution 1:500 in PBS) for 2 h at room temperature. For the detection of binding sites of the primary antibody, the cells were incubated in secondary swine antibody against mouse IgG labeled with horse-radish peroxidase (Sevac, Prague, Czech Republic, dilution 1:1000) for 1 h. Positive signals were visualized by staining with DAB-substrate (Roche Diagnostics GmbH, Manheim, Germany). Following DAB-staining, the cells on chamber slides were washed in PBS and covered with a drop of Glycergel mounting medium (DAKO, Glostrup, Denmark), following which coverslip was attached to a microslide. Presence and localization of PCNA or bax positivity in the cells was detected by DAB-peroxidase brown staining using light microscopy. Cells treated with secondary antibody and DAB but not the primary antibody were used as negative controls. A ratio of DAB-HRP-stained cells to the total cell count was calculated. 2.3. Trypan blue exclusion test Effect of curcumin on viability was detected by the trypan blue exclusion test according to Strober (2001). Briefly, after incubation of granulosa cells, the medium from the culture plates was removed. Subsequently, the cell monolayer was subjected to trypan blue staining (100 μl of 0.4% trypan blue in PBS) (Sigma Aldrich, Hamburg, Germany) for 30 min. Following removal of this dye, plates were washed twice with physiological solution and subjected to microscopic inspection (magnification: 400×). The ratio of dead (stained) cells to total cell count was calculated. 2.4. RT-PCR Total RNA from ovarian granulosa cells was isolated using Trizol reagent according to the manufacturer’s instructions (Invitrogen, Carlsbad, USA). All RNA samples were treated with RNase-free DNase I, amplification grade (Invitrogen) before reverse transcription in order to destroy contaminating DNA, if present. Purity of extracted total RNA was determined from the spectrophotometrically obtained 260/280 nm ratio, and the integrity was checked by electrophoresis in 1% agarose gel (Invitrogen). The cDNA was synthesized using oligo(dT)16 primer and 0.5 μg of total RNA from each sample in 20 μl reactions consisting of 1 × PCR buffer, 5 mM MgCl2, 4 mM dNTP, 2.5 μM oligo (dT)16, 20 U RNase inhibitor (Applied Biosystems, Foster City, USA) and 50 U M-MuLV reverse transcriptase (Applied Biosystems). The reaction was performed at 25 °C for 5 min, 42 °C for 15 min, 99 °C for 5 min, and 4 °C for 5 min. qPCR was performed in 15-μl parallel reactions containing 2 μl cDNA, Maxima SYBR Green qPCR Master Mix (Thermo Fisher Scientific, Schwerte, Germany) and 5 pmol each of primers corresponding to bax (5′–3′, gtcgcgcttttctactttgc; ctcagcccatcttcttccag, sequence no. XM_003127290.2) and PCNA (5′–3′, gtggagaactcggaaatgga; ggagagagtggagtggctttt, sequence no. XM_003359883.1) in Rotor-Gene 6000 real-time PCR system (Corbett Research, Sydney, Australia). Quantification of the expression of these genes was performed using primers for beta-actin (ACTB) (housekeeping gene) (Nygard et al., 2007). All samples were amplified in triplicate from the same RNA preparation, and the mean value was considered. A melting curve analysis was performed within temperature range 72 °C–95 °C to check the specificity of PCR products. Standard curves were generated for all genes using a serial dilution of template cDNA from control ovarian granulosa cells. A quantification of PCNA and bax gene expression based on correlation with the expression of the housekeeping genes was obtained using the threshold (CT) values and PCR reaction efficiencies according to Pfaffl (2001). 2.5. Immunoassay Concentrations of progesterone and testosterone were determined in duplicate in the incubation medium by EIA as described previously (Münster, 1989; Prakash et al., 1987). All EIAs were validated for use in samples of culture medium. Assay sensitivity of progesterone was 0.12 ng/ml, and the cross-reactivity of the antiserum to pregnenolone, androstenediol, testosterone, estradiol, and cortisol were less than 0.001%. Intra- and interassay coeficients of variation did not exceed 8% and 13%, respectively. Sensitivity of testosterone assay was 10 pg/ml. The antiserum cross-reacted < 96% with dihydrotestosterone, < 3% with androstenedione, < 0.01% with progesterone and estradiol, < 0.02% with cortisol and < 0.001% with corticosterone. Inter- and intra-assay coefficients of variation were 12.3% and 6.8% respectively. 2.6. Statistics 2.6.1. Immunocytochemistry Each experimental group was represented by 4-well chamber slides. The proportions of cells with specific immunoreactivity were calculated from at least 1000 cells per chamber. The percentage of cells containing antigen in different groups of cells was calculated. 2.6.2. Trypan blue exclusion test Each treatment group was represented by 4 wells. The dead (stained) cell: total cell ratio was calculated. The proportions of dead cells were calculated from at least 1000 cells per chamber 3
Animal Reproduction Science xxx (xxxx) xxx–xxx
A. Kádasi et al.
Fig. 1. Presence of proliferation- and apoptosis-related peptides PCNA (A) and bax (B) in cultured porcine ovarian granulosa cells. Antigens were detected by immunocytochemistry after 48 h culture, and visualized by DAB-reagent (brown staining) and light microscopy. Magnification ×400.
2.6.3. RT-PCR Each in vitro experimental group was represented by 4 culture wells with granulosa cells. The signal has been normalized using housekeeping genes as control (see above). 2.6.4. EIA Each treatment group was represented by 4 wells. Assays for hormone concentration in the incubation medium were performed in duplicates. The values of blank controls (serum-supplemented medium incubated without cells) were subtracted from the specific value determined by EIA in cell-conditioned medium to exclude any non-specific background (less than 10% of total values). Rates of secretion were calculated per 106 cells per day. Each experiment was performed thrice. Significant differences between the experiments were evaluated using one-way ANOVA followed by paired Wilcoxon-Mann Whitney test by using Sigma Plot 11.0 software (Systat Software, GmbH, Erkhart, Germany). Differences from control at P < 0.05 were considered significant. 3. Results Cultured porcine granulosa cells formed a monolayer in culture, which contained markers of both proliferation (PCNA) and apoptosis (bax). Furthermore, they released hormones (progesterone and testosterone). Presence of PCNA was localized in the nuclear or perinuclear area, while bax occurred mainly in the cytoplasm (Fig. 1). The cells also contained mRNAs for proliferationand apoptosis-related peptides. The majority of cells were able to extrude trypan blue. These parameters were altered under the influence of curcumin. The results of immunocytochemistry (Fig. 2A) showed that the addition of curcumin at dose 10 μg/ml decreased the number of granulosa cells containing PCNA. Curcumin when added at lower (1 μg/ml) or higher (100 μg/ml) doses did not affect the expression of PCNA. The accumulation of bax (Fig. 2B) in granulosa cells was stimulated by curcumin at all doses (1, 10 and 100 μg/ml) in a
Fig. 2. Influence of curcumin on the accumulation of PCNA (A) and bax (B) in cultured porcine granulosa cells. Data from immunocytochemistry studies is presented. Values are means ± SEM.*indicates significant difference (P < 0.05) between curcumin treated and control (0 μg/ml) cells.
4
Animal Reproduction Science xxx (xxxx) xxx–xxx
A. Kádasi et al.
Fig. 3. Expression of PCNA (A) and bax (B) mRNA in cultured porcine ovarian granulosa cells cultured with and without curcumin. Data from RT-PCR normalized to ACTB is shown. Legends are the same as in Fig. 1.
dose-dependent manner. The results of RT-PCR showed that the addition of curcumin at all doses significantly inhibited the expression of PCNA mRNA, while stimulating the expression of bax mRNA in a dose-dependent manner (Fig. 3). Data from the trypan blue exclusion test showed that control cells have relatively high viability rate. Curcumin at dose 100 μg/ml reduced viability and increased mortality of porcine granulosa cells by more than two times (Fig. 4). A stimulatory effect of curcumin at doses of 1 and 10 μg/ml medium on progesterone output was detected using EIA (Fig. 5). On the contrary, curcumin at a dose of 100 μg/ml inhibited progesterone release. Stimulation of testosterone release was found to occur after addition of curcumin at a dose of 100 μg/ml but not at lower (1 and 10 μg/ml) doses.
4. Discussion Formation of cell monolayer, release of steroid hormones into culture medium, occurrence of proliferation marker (PCNA) and its mRNA, presence of bax (marker of apoptosis) and its mRNA in the cells, and relatively low inclusion of trypan blue into these cells suggest that the experimental porcine granulosa cells were viable and suitable for curcumin testing and analysis. Moreover, the observed changes in these indices allowed for conclusions concerning the effect of curcumin on them. In our study, curcumin addition significantly decreased both PCNA accumulation and the expression of its mRNA in granulosa cells. This suggests that curcumin can inhibit the proliferation of porcine ovarian cells via promotion of PCNA gene transcription, which in turn results in accumulation of PCNA — a promoter for DNA polymerase action and mitosis at S and G1 phases (Ulrich and Takahashi, 2013). Some quantitative differences between results obtained by immunocytochemistry and RT-PCR were however observed: curcumin when added at lower (1 μg/ml) or higher (100 μg/ml) doses did not affect the expression of PCNA whereas the results of RT-PCR showed that the addition of curcumin at all doses significantly inhibited the expression of PCNA mRNA. These differences might be explained either by higher sensitivity of RT-PCR or the primary action of curcumin on mRNA, which in turn resulted secondary (sometimes weaker) changes in peptide accumulation within the cells. These results do not corroborate those of previous studies reporting the ability of curcumin to promote proliferation of murine
Fig. 4. Influence of curcumin on the mortality of cultured porcine granulosa cells. Data from trypan blue extrusion test is shown. Legends are the same as in Fig. 1.
5
Animal Reproduction Science xxx (xxxx) xxx–xxx
A. Kádasi et al.
Fig. 5. Influence of curcumin on the release of steroid hormones: progesterone (A) and testosterone (B) in cultured porcine granulosa cells. EIA data is shown. Legends are the same as in Fig. 1.
ovarian cells (Voznesens'ka et al., 2010; Aktas et al., 2012) and consequently ovarian folliculogenesis (Tiwari-Pandey and Ram Sairam, 2009). In contrast, they are in line with a report by Nurcahyo and Soejono (2007) and Purwaningsih et al. (2012), who found that curcumin exhibited a suppressive effect on PCNA accumulation in porcine and rat ovarian cells. In our experiment, the accumulation of both bax and bax mRNA increased after curcumin addition. This suggests that curcumin induces apoptosis in porcine ovarian cells primarily via promotion of Bax gene transcription, while the translation of bax itself can be considered a secondary consequence of this transcription, which in turn promotes the accumulation of bax, a marker and promoter of cytoplasmic apoptosis (Gupta, 2003; Elmore, 2007). Our observations oppose reports of an anti-apoptotic action of curcumin in murine ovarian cells (Voznesens'ka et al., 2010; Aktas et al., 2012). On the other hand, they are in line with a report by Nurcahyo and Soejono (2007) that curcumin displays pro-apoptotic action in porcine ovarian granulosa cells. It is, however, notable that Nurcahyo and Soejono (2007) measured nuclear apoptosis (nuclear DNA fragmentation by using TUNEL), while we measured cytoplasmic apoptosis (bax using immunocytochemistry). Examination of the available data suggests that curcumin can promote both cytoplasmic and nuclear types of apoptosis in healthy porcine ovarian cells. Curcumin-induced reduction in ovarian cell proliferation and promotion of apoptosis can change the equilibration between these two processes and reduce ovarian cell viability, while also increasing their mortality. This hypothesis was confirmed by the substantial reduction in the viability of curcumin-treated cells observed in our experiments. The down-regulated proliferation markers and up-regulated apoptosis and mortality markers following curcumin addition reported in this and previous studies suggest that consumption of Curcuma longa L. products could potentially suppress ovarian follicular growth and development and thereby inhibit fertility and fecundity. Such anti-reproductive effects of curcumin were reported in mice (Murphy et al., 2012). This study shows that such effects occur in pigs as well. If these were confirmed by further in vivo experiments, curcumin could be useful for the inhibition of porcine reproduction; for example, for synchronization of ovarian cycles. Furthermore, the anti-reproductive effect of curcumin should be taken into account during its consumption as a food additive by both animals and humans. Moreover, the anti-reproductive side effect should be taken into account in the now popular application of curcumin for treatment of malignancies or other disorders (Terlikovska et al., 2014; Vallianou et al., 2015). Curcumin can affect ovarian functions via hormonal mechanisms. In our experiments, the release of progesterone was stimulated by curcumin at low doses and inhibited by it at high dose. This observation does not corroborate the report of Nurcahyo and Soejono (2007), who observed not stimulatory, but inhibitory effects of curcumin on the release of this hormone in cultured porcine ovarian granulosa cells. These differences in findings could be attributed to the differing state of the ovarian cells used: Nurcahyo and Soejono (2007) performed their experiments on granulosa cells isolated from large ovarian follicles of cycling pigs, while we used granulosa cells isolated from middle-sized follicles of young noncyclic swine ovaries. It is notable that the effect of curcumin on ovarian cell progesterone could depend on the stage of the ovarian cycle or ovarian folliculogenesis. In our experiments, curcumin stimulated not only progesterone, but also testosterone release. This is the first evidence for the influence of curcumin on ovarian androgen release. It is not to be excluded, that the inhibition of progesterone and stimulation of testosterone output could be due to curcumin-induced conversion of progesterone to testosterone. Progesterone is considered a marker of ovarian follicle luteinization, and testosterone of follicular atresia. Both progesterone and testosterone possess anti-proliferative and pro-apoptotic properties. These steroid hormones can suppress the growth of ovarian follicles, oogenesis, and fertility (Sirotkin, 2014). Therefore, it could be hypothesized that curcumin can affect ovarian cell proliferation, apoptosis, ovarian cell viability, folliculogenesis, puberty and fecundity, as suggested above, through the promotion of progesterone and testosterone release.
5. Conclusion The possible species-specific and ovarian cycle-specific effects of curcumin, its endocrine and intracellular mechanisms of action, 6
Animal Reproduction Science xxx (xxxx) xxx–xxx
A. Kádasi et al.
and its potential therapeutic application require further studies. Nevertheless, the present observations demonstrate the direct suppressive effect of Curcuma longa L., or its component curcumin, on female gonads via multiple mechanisms of action—suppression of ovarian cell proliferation and viability, promotion of their apoptosis (at the level of mRNA transcription and subsequent accumulation of anti-proliferation and pro-apoptosis promoters), and the release of anti-proliferative and pro-apoptotic progesterone and androgen. The potential anti-gonadal action of curcumin must be taken into account while consuming Curcuma longa L.containing products. Acknowledgements We would like to thank Mrs. Katarína Tóthová and Ing. Žofia Kuklová (Animal Production Research Centre in Nitra − Lužianky), to Mrs. Iris Stelter (Institute of Animal Science, Neustadt, Germany) for technical collaboration and to Mr. Yani Deng (Changsha Sunfull Bio-tech. Co, Hunan, China) for kind providing of curcumin. This work was financially supported by Slovak Agency for Promotion of Research and Development (APVV, projects No. 0137-10, 0854-11 and 0304-12), Scientific Grant Agency of Ministry of education, science and sport od SR (VEGA, project No. 1/0392/17), Operational Programme Research and Development funded from the European Regional Development Fund (project no. 26220220176) and the International Scientific Partnership Program ISPP at King Saud University (project no. ISPP 0013). References Aggarwal, B.B., Sundaram, C., Malani, N., Ichikawa, H., 2007. Curcumin: the Indian solid gold. Adv. Exp. Med. Biol. 595, 1–75. Ak, T., Gülçin, I., 2008. Antioxidant and radical scavenging properties of curcumin. Chem. Biol. Interact. 174, 27–37. Aktas, C., Kanter, M., Kocak, Z., 2012. Antiapoptotic and proliferative activity of curcumin on ovarian follicles in mice exposed to whole body ionizing radiation. Toxicol. Ind. Health. 28, 852–863. Alekseyeva, I.N., Makogon, N.V., Bryzgina, T.M., Voznesenskaya, T.Y., Sukhina, V.S., 2011. Effects of NF-κB blocker curcumin on oogenesis and immunocompetent organ cells in immune ovarian injury in mice. Bull. Exp. Biol. Med. 151, 432–435. Elmort, S., 2007. Apoptosis: a review of programmed cell death. Toxicol. Pathol. 35, 495–516. Eser, A., Hizli, D., Haltas, H., Namuslu, M., Kosus, A., Kosus, N., Kafali, H., 2015. Effects of curcumin on ovarian ischemia-reperfusion injury in a rat model. Biomed. Rep. 3, 807–813. Gupta, S., 2003. Molecular signaling in death receptor and mitochondrial pathways of apoptosis (Review). Int. J. Oncol. 22, 15–20. Hardy, M.L., 2000. Herbs of special interest to women. J. Am. Pharm. Assoc. (Wash). 40, 234–242. Münster, E., 1989. Entwicklung Von Emzymimmunologischen Messverfahren Auf Mikrotirationspatten Zur Bestimmung Von Testosteron Und Progesteron Im Blutplazma. Thesis. Institute for Animal Production and Breeding of the University of Hohenheimpp. 154. Murphy, C.J., Tang, H., Van Kirk, E.A., Shen, Y., Murdoch, W.J., 2012. Reproductive effects of a pegylated curcumin. Reprod. Toxicol. 34, 120–124. Nadkarni, K.M., 1976. Indian Materia Medica. Popular Prakashan, Bombay. Nayak, A.P., Mills, T., Norton, I., 2016. Lipid based nanosystems for curcumin: past, present and future. Curr. Pharm. Des. 22 (27), 4247–4256 ([Epub ahead of print] PubMed PMID: 27306091.). Nurcahyo, H., Soejono, S.K., 2007. Effect of curcumin and pentagamavunon-0 on the steroidogenesis, proliferation activity and apoptosis in cultured porcine granulosa cells at varying stages of follicular growth, In: Pudjono, G.I.G., Sismindari, Riyanto S., Meiyanto, E., Susidarti, R.A., Ikawati, Nugroho A.K., Ritmaleni, (Eds.), Recent development in curcumin pharmaco-chemistry. Proceedings of the International Symposium on Recent Progress in Curcumin Research; 2007, 11–12 September 2006, Yogyakarta. Faculty of Pharmacy Gadjah Mada University, 2007. p. 227-241. Pfaffl, M.W., 2001. A new mathematical model for relative quantification in real-time RT-PCR. Nucleic Acids Res. 29, e45. Prakash, B.S., Meyer, H.H., Schallenberger, E., Van de Wiel, D.F., 1987. Development of a sensitive enzymeimmunoassay (EIA) for progesterone determination in unextracted bovine plasma using the secondary antibody technique. J. Steroid. Biochem. 28, 623–627. Purwaningsih, E., Soejono, S.K., Dasuki, D., Meiyanto, E., 2012. Curcumin inhibits luteal cell steroidogenesis by suppression of extracellular signal regulated kinase. Universa Medicina. 31, 73–80. Qin, X., Cao, M., Lai, F., Yang, F., Ge, W., Zhang, X., Cheng, S., Sun, X., Qin, G., Shen, W., Li, L., 2015. Oxidative stress induced by zearalenone in porcine granulosa cells and its rescue by curcumin in vitro. PLoS One 10 (6), e0127551. Seo, J.A., Kim, B., Dhanasekaran, D.N., Tsang, B.K., Song, Y.S., 2016. Curcumin induces apoptosis by inhibiting sarco/endoplasmic reticulum Ca2+ ATPase activity in ovarian cancer cells. Cancer Lett. 371, 30–37. Shehzad, A., Wahid, F., Lee, Y.S., 2010. Curcumin in cancer chemoprevention: molecular targets, pharmacokinetics, bioavailability, and clinical trials. Arch. Pharm. (Weinheim) 343, 489–499. Sirotkin, A.V., 2014. Regulators of Ovarian Functions. Nova Science Publishers, Inc New York ISBN 978-1 −61324-468-5. Strober W., Trypan blue exclusion test of cell viability. Curr Protoc Immunol. 2001 Appendix C:Appendix CB. 10.1002/0471142735. ima03bs21. Terlikowska, K.M., Witkowska, A.M., Zujko, M.E., Dobrzycka, B., Terlikowski, S.J., 2014. Potential application of curcumin and its analogues in the treatment strategy of patients with primary epithelial ovarian cancer. Int. J. Mol. Sci. 15, 21703–21722. Tiwari-Pandey, R., Ram Sairam, M., 2009. Modulation of ovarian structure and abdominal obesity in curcumin- and flutamide-treated aging FSH-R haploinsufficient mice. Reprod. Sci. 16, 539–550. Ulrich, H.D., Takahashi, T., 2013. Readers of PCNA modifications. Chromosoma 122, 259–274. Vallianou, N.G., Evangelopoulos, A., Schizas, N., Kazazis, C., 2015. Potential anticancer properties and mechanisms of action of curcumin. Anticancer Res. 35, 645–651. Voznesens'ka, T., Iu Bryzhina, T.M., Sukhina, V.S., Makohon, N.V., Aleksieieva, I.M., 2010. Effect of NF-kappaB activation inhibitor curcumin on the oogenesis and follicular cell death in immune ovarian failure in mice. Fiziol. Zh. 56, 96–101. Watson, J.L., Greenshields, A., Hill, R., Hilchie, A., Lee, P.W., Giacomantonio, C.A., Hoskin, D.W., 2010. Curcumin-induced apoptosis in ovarian carcinoma cells is p53independent and involves p38 mitogen-activated protein kinase activation and downregulation of Bcl-2 and survivin expression and Akt signaling. Mol. Carcinog. 49, 13–24.
7
Contents lists available at ScienceDirect
Animal Reproduction Science journal homepage: www.elsevier.com/locate/anireprosci
Direct effect of curcumin on porcine ovarian cell functions Attila Kádasia, Nora Maruniakováa, Aneta Štochmaľovác, Miroslav Bauerb,c, Roland Grossmannd, Abdel Halim Harrathe, Adriana Kolesárováa, ⁎ Alexander V. Sirotkinb,c,e, a
Slovak University of Agriculture in Nitra, Nitra, Slovak Republic Research Institute of Animal Production, Lužianky, Slovak Republic Constantine the Philosopher University, Nitra, Slovak Republic d Friedrich Loeffner Institute, Mariensee, Neustadt, Germany e King Saud University, Ryiadh, Saudi Arabia b c
AR TI CLE I NF O
AB S T R A CT
Keywords: Curcuma longa Ovary Proliferation Apoptosis Steroid hormone
Curcuma longa Linn (L.) is a plant widely used in cooking (in curry powder a.o.) and in folk medicine, but its action on reproductive processes and its possible mechanisms of action remain to be investigated. The objective of this study was to examine the direct effects of curcumin, the major Curcuma longa L. molecule, on basic ovarian cell functions such as proliferation, apoptosis, viability and steroidogenesis. Porcine ovarian granulosa cells were cultured with and without curcumin (at doses of 0, 1, 10 and 100 μg/ml of medium). Markers of proliferation (accumulation of PCNA) and apoptosis (accumulation of bax) were analyzed by immunocytochemistry. The expression of mRNA for PCNA and bax was detected by RT-PCR. Cell viability was detected by trypan blue exclusion test. Release of steroid hormones (progesterone and testosterone) was measured by enzyme immunoassay (EIA). It was observed that addition of curcumin reduced ovarian cell proliferation (expression of both PCNA and its mRNA), promoted apoptosis (accumulation of both bax and its mRNA), reduced cell viability, and stimulated both progesterone and testosterone release. These observations demonstrate the direct suppressive effect of Curcuma longa L./curcumin on female gonads via multiple mechanisms of action − suppression of ovarian cell proliferation and viability, promotion of their apoptosis (at the level of mRNA transcription and subsequent accumulation of promoters of genes regulating these activities) and release of anti-proliferative and pro-apoptotic progesterone and androgen. The potential anti-gonadal action of curcumin should be taken into account by consumers of Curcuma longa L.-containing products.
1. Introduction For a long time, humans have used medicinal and spicy herbs for cooking, for the treatment of physiological disorders, and for the regulation of physiological processes, including reproduction (Nadkarni, 1976; Hardy, 2000; Nayak et al., 2016). However, the mechanisms of action of these herbs and their possible side effects are not yet fully understood, and they require rigorous investigation. One of the plants often used in cooking and folk medicine is Curcuma longa L.— Indian Turmeric. This plant is a part of curry
⁎
Corresponding author at: Faculty of Natural Science, Constantine the Philosopher University, Tr. A. Hlinku 1, 949 74, Nitra, Slovak Republic. E-mail address: [email protected] (A.V. Sirotkin).
http://dx.doi.org/10.1016/j.anireprosci.2017.05.001 Received 22 February 2017; Received in revised form 2 May 2017; Accepted 10 May 2017 0378-4320/ © 2017 Elsevier B.V. All rights reserved.
Please cite this article as: Kádasi, A., Animal Reproduction Science (2017), http://dx.doi.org/10.1016/j.anireprosci.2017.05.001
Animal Reproduction Science xxx (xxxx) xxx–xxx
A. Kádasi et al.
powder and other spices currently considered functional food. A major biologically active component of Curcuma longa L. is the phenolic compound curcumin, with the chemical name 1, 7-bis (4-hydroxy-3-methoxyphenyl)-1, 6-heptadiene-3, 5-dione (Aggarwal et al., 2007; Ak and Gülçin, 2008). Owing to its pro-apoptotic, anti-proliferative, anti-oxidant, and anti-angiogenic properties, curcumin has been studied as a potentially useful agent in the treatment of cancer and other disorders (Tiwari-Pandey and Ram Sairam, 2009; Terlikovska et al., 2014; Vallianou et al., 2015; Nayak et al., 2016). There is a growing body of evidence that curcumin can affect ovarian functions. Numerous in-vitro and in-vivo studies demonstrated its ability to directly suppress proliferation and promote apoptosis in ovarian cancer cells (Shehzad et al., 2010; Watson et al., 2010; Terlikowska et al., 2014; Vallianou et al., 2015; Seo et al., 2016), and to prevent the adverse effects of aging, ovarian insufficiency (Tiwari-Pandey and Ram Sairam, 2009; Voznesens'ka et al., 2010; Alekseyeva et al., 2011), ionizing radiation (Aktas et al., 2012), ischemia (Eser et al., 2015), oxidative stress (Qin et al., 2015) and mycotoxins (Qin et al., 2015) on ovarian function. Despite its therapeutic action, curcuma/turmeric is currently consumed by healthy individuals mainly as a cooking additive and functional food for the prevention of various disorders and illnesses. Moreover, its beneficial effects could potentially be useful in agriculture for the maintenance of healthy farm animals. Nevertheless, in contrast to medical studies, the action of curcumin on function of healthy ovarian cells not exposed to any negative external factor is very poorly investigated. The available reports are scarce, contradictory, and involve mainly laboratory rodents. Only one study was performed on a farm animal, a pig (Nurcahyo and Soejono, 2007). Some in-vivo studies have demonstrated the stimulatory effect of curcumin or its analogue on ovarian functions—it promoted proliferation, reduced apoptosis in murine ovarian cells (Voznesens'ka et al., 2010; Aktas et al., 2012), and supported murine ovarian oogenesis (Voznesens'ka et al., 2010; Alekseyeva et al., 2011), folliculogenesis and steroidogenesis (Tiwari-Pandey and Ram Sairam, 2009); on the contrary, other authors have reported the ability of curcumin to suppress reproductive functions—to prolong puberty, to reduce fecundity (Murphy et al., 2012), and to suppress proliferation and progesterone release in cultured rat ovarian luteal cells (Purwaningsih et al., 2012), as well as to inhibit proliferation, stimulate apoptosis, and suppress progesterone and estradiol release by porcine ovarian follicular granulosa cells (Nurcahyo and Soejono, 2007). The mechanisms of action of curcumin on healthy ovarian cells, especially in farm animals, require further elucidation. It remains unknown whether curcumin affects accumulation of proliferation and apoptosis regulators/markers via their gene transcription (accumulation of their mRNA), translation (peptide production) or metabolism, whether curcumin-induced changes in rate of proliferation- and apoptosis-related molecules affect ovarian cell viability, whether curcumin can affect ovarian androgen release, and what the hormone-based mechanisms behind reproductive effects of curcumin could be. The aim of our in-vitro experiments was to examine the action of curcumin on basic ovarian cell functions—proliferation, apoptosis (accumulation of PCNA, bax and their mRNA), cell viability, and the release of progesterone and testosterone. 2. Materials and methods 2.1. Isolation and culture of granulosa cells Granulosa cells were collected from the ovaries of prepubertal (100–120 days old, weight 105–130 kg) Slovakian White gilts following their slaughter at a local abattoir. Ovaries were transported to the laboratory at 4 °C and washed in sterile physiological solution. Follicular fluid was aspirated from 3 to 5 mm follicles and granulosa cells were isolated by centrifugation for 10 min at 200g. Cells were then washed in sterile DMEM/F12 1:1 medium (BioWhittaker, Verviers, Belgium), and resuspended in the same medium supplemented with 10% fetal calf serum (BioWhittaker) and 1% antibiotic-antimycotic solution (Sigma, St. Louis, MO, USA) at a final concentration 106 cells/mL medium. 1 ml/well of the granulosa cell suspension was dispensed in 24-well culture plates (Nunc, Roskilde, Denmark, for EIA, trypan blue test and RT-PCR, see below) and 200 μl/well in 16-well chamber slides (Nunc Inc., International, Naperville, USA) for immunocytochemistry. Both the plate wells and chamber slides were incubated at 37 °C and 5% CO2 in humidified air until 60–75% confluent monolayer was formed (3–5 days), at which point medium was renewed. Further culture was performed in 2 ml culture medium in 24-well plates or 200 μl/medium in 16-well chamber slides as described previously. After medium replacement experimental cells were cultured in the presence of curcumin (Changsha Sunfull Bio-tech. Co, Hunan, China, purity 98.9%) at concentrations of 0, 1, 10 and 100 μg/ml for immunocytochemistry and EIA; at 0 and 100 μg/ml for trypan blue extrusion test; 0, 10 and 100 μg/ml for RT-PCR. These doses correspond to the curcumin doses used in previous in-vitro experiments performed on healthy and malignant ovarian cells (Nurcahyo and Soejono, 2007; Shehzad et al., 2010; Watson et al., 2010; Purwaningsih et al., 2012). Curcumin was dissolved first in DMSO (concentration 10 mg/ml) and than in culture medium just before their addition to the cells. The maximal concentration of DMSO in culture was 0.1%. This amount of DMSO was added to the cells of control group. After 2 days of culture with or without curcumin, the medium was removed. The cells in chamber slides were washed in ice-cold PBS (pH 7.5), fixed in paraformaldehyde (4% in PBS, pH 7.2–7.4; 60 min), dehydrated in alcohols (70%, 80%, 96%; 10 min each) and held at 4 °C in preparation for immunocytochemistry. The medium from the 24-well plates was gently aspirated and frozen at −24 °C to await RT-PCR and RIA. Some of the granulosa cells cultured in these plates cultured both with (100 μg/ml) and without curcumin were subjected to trypan blue extrusion test. 2.2. Immunocytochemical analysis After fixation and washing in PBS for 5 min, the cells were incubated in blocking solution (1% of goat serum in PBS) at room 2
Animal Reproduction Science xxx (xxxx) xxx–xxx
A. Kádasi et al.
temperature for 1 h to block nonspecific binding of antiserum. Afterwards, the cells were incubated with monoclonal antibodies against either PCNA, the proliferation marker (Ulrich and Takahashi, 2013) or bax, the marker of apoptosis (Elmort, 2007) (Santa Cruz Biotechnology, Inc., Santa Cruz, USA; dilution 1:500 in PBS) for 2 h at room temperature. For the detection of binding sites of the primary antibody, the cells were incubated in secondary swine antibody against mouse IgG labeled with horse-radish peroxidase (Sevac, Prague, Czech Republic, dilution 1:1000) for 1 h. Positive signals were visualized by staining with DAB-substrate (Roche Diagnostics GmbH, Manheim, Germany). Following DAB-staining, the cells on chamber slides were washed in PBS and covered with a drop of Glycergel mounting medium (DAKO, Glostrup, Denmark), following which coverslip was attached to a microslide. Presence and localization of PCNA or bax positivity in the cells was detected by DAB-peroxidase brown staining using light microscopy. Cells treated with secondary antibody and DAB but not the primary antibody were used as negative controls. A ratio of DAB-HRP-stained cells to the total cell count was calculated. 2.3. Trypan blue exclusion test Effect of curcumin on viability was detected by the trypan blue exclusion test according to Strober (2001). Briefly, after incubation of granulosa cells, the medium from the culture plates was removed. Subsequently, the cell monolayer was subjected to trypan blue staining (100 μl of 0.4% trypan blue in PBS) (Sigma Aldrich, Hamburg, Germany) for 30 min. Following removal of this dye, plates were washed twice with physiological solution and subjected to microscopic inspection (magnification: 400×). The ratio of dead (stained) cells to total cell count was calculated. 2.4. RT-PCR Total RNA from ovarian granulosa cells was isolated using Trizol reagent according to the manufacturer’s instructions (Invitrogen, Carlsbad, USA). All RNA samples were treated with RNase-free DNase I, amplification grade (Invitrogen) before reverse transcription in order to destroy contaminating DNA, if present. Purity of extracted total RNA was determined from the spectrophotometrically obtained 260/280 nm ratio, and the integrity was checked by electrophoresis in 1% agarose gel (Invitrogen). The cDNA was synthesized using oligo(dT)16 primer and 0.5 μg of total RNA from each sample in 20 μl reactions consisting of 1 × PCR buffer, 5 mM MgCl2, 4 mM dNTP, 2.5 μM oligo (dT)16, 20 U RNase inhibitor (Applied Biosystems, Foster City, USA) and 50 U M-MuLV reverse transcriptase (Applied Biosystems). The reaction was performed at 25 °C for 5 min, 42 °C for 15 min, 99 °C for 5 min, and 4 °C for 5 min. qPCR was performed in 15-μl parallel reactions containing 2 μl cDNA, Maxima SYBR Green qPCR Master Mix (Thermo Fisher Scientific, Schwerte, Germany) and 5 pmol each of primers corresponding to bax (5′–3′, gtcgcgcttttctactttgc; ctcagcccatcttcttccag, sequence no. XM_003127290.2) and PCNA (5′–3′, gtggagaactcggaaatgga; ggagagagtggagtggctttt, sequence no. XM_003359883.1) in Rotor-Gene 6000 real-time PCR system (Corbett Research, Sydney, Australia). Quantification of the expression of these genes was performed using primers for beta-actin (ACTB) (housekeeping gene) (Nygard et al., 2007). All samples were amplified in triplicate from the same RNA preparation, and the mean value was considered. A melting curve analysis was performed within temperature range 72 °C–95 °C to check the specificity of PCR products. Standard curves were generated for all genes using a serial dilution of template cDNA from control ovarian granulosa cells. A quantification of PCNA and bax gene expression based on correlation with the expression of the housekeeping genes was obtained using the threshold (CT) values and PCR reaction efficiencies according to Pfaffl (2001). 2.5. Immunoassay Concentrations of progesterone and testosterone were determined in duplicate in the incubation medium by EIA as described previously (Münster, 1989; Prakash et al., 1987). All EIAs were validated for use in samples of culture medium. Assay sensitivity of progesterone was 0.12 ng/ml, and the cross-reactivity of the antiserum to pregnenolone, androstenediol, testosterone, estradiol, and cortisol were less than 0.001%. Intra- and interassay coeficients of variation did not exceed 8% and 13%, respectively. Sensitivity of testosterone assay was 10 pg/ml. The antiserum cross-reacted < 96% with dihydrotestosterone, < 3% with androstenedione, < 0.01% with progesterone and estradiol, < 0.02% with cortisol and < 0.001% with corticosterone. Inter- and intra-assay coefficients of variation were 12.3% and 6.8% respectively. 2.6. Statistics 2.6.1. Immunocytochemistry Each experimental group was represented by 4-well chamber slides. The proportions of cells with specific immunoreactivity were calculated from at least 1000 cells per chamber. The percentage of cells containing antigen in different groups of cells was calculated. 2.6.2. Trypan blue exclusion test Each treatment group was represented by 4 wells. The dead (stained) cell: total cell ratio was calculated. The proportions of dead cells were calculated from at least 1000 cells per chamber 3
Animal Reproduction Science xxx (xxxx) xxx–xxx
A. Kádasi et al.
Fig. 1. Presence of proliferation- and apoptosis-related peptides PCNA (A) and bax (B) in cultured porcine ovarian granulosa cells. Antigens were detected by immunocytochemistry after 48 h culture, and visualized by DAB-reagent (brown staining) and light microscopy. Magnification ×400.
2.6.3. RT-PCR Each in vitro experimental group was represented by 4 culture wells with granulosa cells. The signal has been normalized using housekeeping genes as control (see above). 2.6.4. EIA Each treatment group was represented by 4 wells. Assays for hormone concentration in the incubation medium were performed in duplicates. The values of blank controls (serum-supplemented medium incubated without cells) were subtracted from the specific value determined by EIA in cell-conditioned medium to exclude any non-specific background (less than 10% of total values). Rates of secretion were calculated per 106 cells per day. Each experiment was performed thrice. Significant differences between the experiments were evaluated using one-way ANOVA followed by paired Wilcoxon-Mann Whitney test by using Sigma Plot 11.0 software (Systat Software, GmbH, Erkhart, Germany). Differences from control at P < 0.05 were considered significant. 3. Results Cultured porcine granulosa cells formed a monolayer in culture, which contained markers of both proliferation (PCNA) and apoptosis (bax). Furthermore, they released hormones (progesterone and testosterone). Presence of PCNA was localized in the nuclear or perinuclear area, while bax occurred mainly in the cytoplasm (Fig. 1). The cells also contained mRNAs for proliferationand apoptosis-related peptides. The majority of cells were able to extrude trypan blue. These parameters were altered under the influence of curcumin. The results of immunocytochemistry (Fig. 2A) showed that the addition of curcumin at dose 10 μg/ml decreased the number of granulosa cells containing PCNA. Curcumin when added at lower (1 μg/ml) or higher (100 μg/ml) doses did not affect the expression of PCNA. The accumulation of bax (Fig. 2B) in granulosa cells was stimulated by curcumin at all doses (1, 10 and 100 μg/ml) in a
Fig. 2. Influence of curcumin on the accumulation of PCNA (A) and bax (B) in cultured porcine granulosa cells. Data from immunocytochemistry studies is presented. Values are means ± SEM.*indicates significant difference (P < 0.05) between curcumin treated and control (0 μg/ml) cells.
4
Animal Reproduction Science xxx (xxxx) xxx–xxx
A. Kádasi et al.
Fig. 3. Expression of PCNA (A) and bax (B) mRNA in cultured porcine ovarian granulosa cells cultured with and without curcumin. Data from RT-PCR normalized to ACTB is shown. Legends are the same as in Fig. 1.
dose-dependent manner. The results of RT-PCR showed that the addition of curcumin at all doses significantly inhibited the expression of PCNA mRNA, while stimulating the expression of bax mRNA in a dose-dependent manner (Fig. 3). Data from the trypan blue exclusion test showed that control cells have relatively high viability rate. Curcumin at dose 100 μg/ml reduced viability and increased mortality of porcine granulosa cells by more than two times (Fig. 4). A stimulatory effect of curcumin at doses of 1 and 10 μg/ml medium on progesterone output was detected using EIA (Fig. 5). On the contrary, curcumin at a dose of 100 μg/ml inhibited progesterone release. Stimulation of testosterone release was found to occur after addition of curcumin at a dose of 100 μg/ml but not at lower (1 and 10 μg/ml) doses.
4. Discussion Formation of cell monolayer, release of steroid hormones into culture medium, occurrence of proliferation marker (PCNA) and its mRNA, presence of bax (marker of apoptosis) and its mRNA in the cells, and relatively low inclusion of trypan blue into these cells suggest that the experimental porcine granulosa cells were viable and suitable for curcumin testing and analysis. Moreover, the observed changes in these indices allowed for conclusions concerning the effect of curcumin on them. In our study, curcumin addition significantly decreased both PCNA accumulation and the expression of its mRNA in granulosa cells. This suggests that curcumin can inhibit the proliferation of porcine ovarian cells via promotion of PCNA gene transcription, which in turn results in accumulation of PCNA — a promoter for DNA polymerase action and mitosis at S and G1 phases (Ulrich and Takahashi, 2013). Some quantitative differences between results obtained by immunocytochemistry and RT-PCR were however observed: curcumin when added at lower (1 μg/ml) or higher (100 μg/ml) doses did not affect the expression of PCNA whereas the results of RT-PCR showed that the addition of curcumin at all doses significantly inhibited the expression of PCNA mRNA. These differences might be explained either by higher sensitivity of RT-PCR or the primary action of curcumin on mRNA, which in turn resulted secondary (sometimes weaker) changes in peptide accumulation within the cells. These results do not corroborate those of previous studies reporting the ability of curcumin to promote proliferation of murine
Fig. 4. Influence of curcumin on the mortality of cultured porcine granulosa cells. Data from trypan blue extrusion test is shown. Legends are the same as in Fig. 1.
5
Animal Reproduction Science xxx (xxxx) xxx–xxx
A. Kádasi et al.
Fig. 5. Influence of curcumin on the release of steroid hormones: progesterone (A) and testosterone (B) in cultured porcine granulosa cells. EIA data is shown. Legends are the same as in Fig. 1.
ovarian cells (Voznesens'ka et al., 2010; Aktas et al., 2012) and consequently ovarian folliculogenesis (Tiwari-Pandey and Ram Sairam, 2009). In contrast, they are in line with a report by Nurcahyo and Soejono (2007) and Purwaningsih et al. (2012), who found that curcumin exhibited a suppressive effect on PCNA accumulation in porcine and rat ovarian cells. In our experiment, the accumulation of both bax and bax mRNA increased after curcumin addition. This suggests that curcumin induces apoptosis in porcine ovarian cells primarily via promotion of Bax gene transcription, while the translation of bax itself can be considered a secondary consequence of this transcription, which in turn promotes the accumulation of bax, a marker and promoter of cytoplasmic apoptosis (Gupta, 2003; Elmore, 2007). Our observations oppose reports of an anti-apoptotic action of curcumin in murine ovarian cells (Voznesens'ka et al., 2010; Aktas et al., 2012). On the other hand, they are in line with a report by Nurcahyo and Soejono (2007) that curcumin displays pro-apoptotic action in porcine ovarian granulosa cells. It is, however, notable that Nurcahyo and Soejono (2007) measured nuclear apoptosis (nuclear DNA fragmentation by using TUNEL), while we measured cytoplasmic apoptosis (bax using immunocytochemistry). Examination of the available data suggests that curcumin can promote both cytoplasmic and nuclear types of apoptosis in healthy porcine ovarian cells. Curcumin-induced reduction in ovarian cell proliferation and promotion of apoptosis can change the equilibration between these two processes and reduce ovarian cell viability, while also increasing their mortality. This hypothesis was confirmed by the substantial reduction in the viability of curcumin-treated cells observed in our experiments. The down-regulated proliferation markers and up-regulated apoptosis and mortality markers following curcumin addition reported in this and previous studies suggest that consumption of Curcuma longa L. products could potentially suppress ovarian follicular growth and development and thereby inhibit fertility and fecundity. Such anti-reproductive effects of curcumin were reported in mice (Murphy et al., 2012). This study shows that such effects occur in pigs as well. If these were confirmed by further in vivo experiments, curcumin could be useful for the inhibition of porcine reproduction; for example, for synchronization of ovarian cycles. Furthermore, the anti-reproductive effect of curcumin should be taken into account during its consumption as a food additive by both animals and humans. Moreover, the anti-reproductive side effect should be taken into account in the now popular application of curcumin for treatment of malignancies or other disorders (Terlikovska et al., 2014; Vallianou et al., 2015). Curcumin can affect ovarian functions via hormonal mechanisms. In our experiments, the release of progesterone was stimulated by curcumin at low doses and inhibited by it at high dose. This observation does not corroborate the report of Nurcahyo and Soejono (2007), who observed not stimulatory, but inhibitory effects of curcumin on the release of this hormone in cultured porcine ovarian granulosa cells. These differences in findings could be attributed to the differing state of the ovarian cells used: Nurcahyo and Soejono (2007) performed their experiments on granulosa cells isolated from large ovarian follicles of cycling pigs, while we used granulosa cells isolated from middle-sized follicles of young noncyclic swine ovaries. It is notable that the effect of curcumin on ovarian cell progesterone could depend on the stage of the ovarian cycle or ovarian folliculogenesis. In our experiments, curcumin stimulated not only progesterone, but also testosterone release. This is the first evidence for the influence of curcumin on ovarian androgen release. It is not to be excluded, that the inhibition of progesterone and stimulation of testosterone output could be due to curcumin-induced conversion of progesterone to testosterone. Progesterone is considered a marker of ovarian follicle luteinization, and testosterone of follicular atresia. Both progesterone and testosterone possess anti-proliferative and pro-apoptotic properties. These steroid hormones can suppress the growth of ovarian follicles, oogenesis, and fertility (Sirotkin, 2014). Therefore, it could be hypothesized that curcumin can affect ovarian cell proliferation, apoptosis, ovarian cell viability, folliculogenesis, puberty and fecundity, as suggested above, through the promotion of progesterone and testosterone release.
5. Conclusion The possible species-specific and ovarian cycle-specific effects of curcumin, its endocrine and intracellular mechanisms of action, 6
Animal Reproduction Science xxx (xxxx) xxx–xxx
A. Kádasi et al.
and its potential therapeutic application require further studies. Nevertheless, the present observations demonstrate the direct suppressive effect of Curcuma longa L., or its component curcumin, on female gonads via multiple mechanisms of action—suppression of ovarian cell proliferation and viability, promotion of their apoptosis (at the level of mRNA transcription and subsequent accumulation of anti-proliferation and pro-apoptosis promoters), and the release of anti-proliferative and pro-apoptotic progesterone and androgen. The potential anti-gonadal action of curcumin must be taken into account while consuming Curcuma longa L.containing products. Acknowledgements We would like to thank Mrs. Katarína Tóthová and Ing. Žofia Kuklová (Animal Production Research Centre in Nitra − Lužianky), to Mrs. Iris Stelter (Institute of Animal Science, Neustadt, Germany) for technical collaboration and to Mr. Yani Deng (Changsha Sunfull Bio-tech. Co, Hunan, China) for kind providing of curcumin. This work was financially supported by Slovak Agency for Promotion of Research and Development (APVV, projects No. 0137-10, 0854-11 and 0304-12), Scientific Grant Agency of Ministry of education, science and sport od SR (VEGA, project No. 1/0392/17), Operational Programme Research and Development funded from the European Regional Development Fund (project no. 26220220176) and the International Scientific Partnership Program ISPP at King Saud University (project no. ISPP 0013). References Aggarwal, B.B., Sundaram, C., Malani, N., Ichikawa, H., 2007. Curcumin: the Indian solid gold. Adv. Exp. Med. Biol. 595, 1–75. Ak, T., Gülçin, I., 2008. Antioxidant and radical scavenging properties of curcumin. Chem. Biol. Interact. 174, 27–37. Aktas, C., Kanter, M., Kocak, Z., 2012. Antiapoptotic and proliferative activity of curcumin on ovarian follicles in mice exposed to whole body ionizing radiation. Toxicol. Ind. Health. 28, 852–863. Alekseyeva, I.N., Makogon, N.V., Bryzgina, T.M., Voznesenskaya, T.Y., Sukhina, V.S., 2011. Effects of NF-κB blocker curcumin on oogenesis and immunocompetent organ cells in immune ovarian injury in mice. Bull. Exp. Biol. Med. 151, 432–435. Elmort, S., 2007. Apoptosis: a review of programmed cell death. Toxicol. Pathol. 35, 495–516. Eser, A., Hizli, D., Haltas, H., Namuslu, M., Kosus, A., Kosus, N., Kafali, H., 2015. Effects of curcumin on ovarian ischemia-reperfusion injury in a rat model. Biomed. Rep. 3, 807–813. Gupta, S., 2003. Molecular signaling in death receptor and mitochondrial pathways of apoptosis (Review). Int. J. Oncol. 22, 15–20. Hardy, M.L., 2000. Herbs of special interest to women. J. Am. Pharm. Assoc. (Wash). 40, 234–242. Münster, E., 1989. Entwicklung Von Emzymimmunologischen Messverfahren Auf Mikrotirationspatten Zur Bestimmung Von Testosteron Und Progesteron Im Blutplazma. Thesis. Institute for Animal Production and Breeding of the University of Hohenheimpp. 154. Murphy, C.J., Tang, H., Van Kirk, E.A., Shen, Y., Murdoch, W.J., 2012. Reproductive effects of a pegylated curcumin. Reprod. Toxicol. 34, 120–124. Nadkarni, K.M., 1976. Indian Materia Medica. Popular Prakashan, Bombay. Nayak, A.P., Mills, T., Norton, I., 2016. Lipid based nanosystems for curcumin: past, present and future. Curr. Pharm. Des. 22 (27), 4247–4256 ([Epub ahead of print] PubMed PMID: 27306091.). Nurcahyo, H., Soejono, S.K., 2007. Effect of curcumin and pentagamavunon-0 on the steroidogenesis, proliferation activity and apoptosis in cultured porcine granulosa cells at varying stages of follicular growth, In: Pudjono, G.I.G., Sismindari, Riyanto S., Meiyanto, E., Susidarti, R.A., Ikawati, Nugroho A.K., Ritmaleni, (Eds.), Recent development in curcumin pharmaco-chemistry. Proceedings of the International Symposium on Recent Progress in Curcumin Research; 2007, 11–12 September 2006, Yogyakarta. Faculty of Pharmacy Gadjah Mada University, 2007. p. 227-241. Pfaffl, M.W., 2001. A new mathematical model for relative quantification in real-time RT-PCR. Nucleic Acids Res. 29, e45. Prakash, B.S., Meyer, H.H., Schallenberger, E., Van de Wiel, D.F., 1987. Development of a sensitive enzymeimmunoassay (EIA) for progesterone determination in unextracted bovine plasma using the secondary antibody technique. J. Steroid. Biochem. 28, 623–627. Purwaningsih, E., Soejono, S.K., Dasuki, D., Meiyanto, E., 2012. Curcumin inhibits luteal cell steroidogenesis by suppression of extracellular signal regulated kinase. Universa Medicina. 31, 73–80. Qin, X., Cao, M., Lai, F., Yang, F., Ge, W., Zhang, X., Cheng, S., Sun, X., Qin, G., Shen, W., Li, L., 2015. Oxidative stress induced by zearalenone in porcine granulosa cells and its rescue by curcumin in vitro. PLoS One 10 (6), e0127551. Seo, J.A., Kim, B., Dhanasekaran, D.N., Tsang, B.K., Song, Y.S., 2016. Curcumin induces apoptosis by inhibiting sarco/endoplasmic reticulum Ca2+ ATPase activity in ovarian cancer cells. Cancer Lett. 371, 30–37. Shehzad, A., Wahid, F., Lee, Y.S., 2010. Curcumin in cancer chemoprevention: molecular targets, pharmacokinetics, bioavailability, and clinical trials. Arch. Pharm. (Weinheim) 343, 489–499. Sirotkin, A.V., 2014. Regulators of Ovarian Functions. Nova Science Publishers, Inc New York ISBN 978-1 −61324-468-5. Strober W., Trypan blue exclusion test of cell viability. Curr Protoc Immunol. 2001 Appendix C:Appendix CB. 10.1002/0471142735. ima03bs21. Terlikowska, K.M., Witkowska, A.M., Zujko, M.E., Dobrzycka, B., Terlikowski, S.J., 2014. Potential application of curcumin and its analogues in the treatment strategy of patients with primary epithelial ovarian cancer. Int. J. Mol. Sci. 15, 21703–21722. Tiwari-Pandey, R., Ram Sairam, M., 2009. Modulation of ovarian structure and abdominal obesity in curcumin- and flutamide-treated aging FSH-R haploinsufficient mice. Reprod. Sci. 16, 539–550. Ulrich, H.D., Takahashi, T., 2013. Readers of PCNA modifications. Chromosoma 122, 259–274. Vallianou, N.G., Evangelopoulos, A., Schizas, N., Kazazis, C., 2015. Potential anticancer properties and mechanisms of action of curcumin. Anticancer Res. 35, 645–651. Voznesens'ka, T., Iu Bryzhina, T.M., Sukhina, V.S., Makohon, N.V., Aleksieieva, I.M., 2010. Effect of NF-kappaB activation inhibitor curcumin on the oogenesis and follicular cell death in immune ovarian failure in mice. Fiziol. Zh. 56, 96–101. Watson, J.L., Greenshields, A., Hill, R., Hilchie, A., Lee, P.W., Giacomantonio, C.A., Hoskin, D.W., 2010. Curcumin-induced apoptosis in ovarian carcinoma cells is p53independent and involves p38 mitogen-activated protein kinase activation and downregulation of Bcl-2 and survivin expression and Akt signaling. Mol. Carcinog. 49, 13–24.
7