Distinct roles of prolactin, epidermal growth factor, and glucocorticoids in β-casein secretion pathway in lactating mammary epithelial cells

Molecular and Cellular Endocrinology 440 (2017) 16e24

Contents lists available at ScienceDirect

Molecular and Cellular Endocrinology journal homepage: www.elsevier.com/locate/mce

Distinct roles of prolactin, epidermal growth factor, and glucocorticoids in b-casein secretion pathway in lactating mammary epithelial cells Ken Kobayashi*, Shoko Oyama, Chinatsu Kuki, Yusaku Tsugami, Kota Matsunaga, Takahiro Suzuki, Takanori Nishimura Laboratory of Cell and Tissue Biology, Research Faculty of Agriculture, Hokkaido University, North 9, West 9, 060-8589, Sapporo, Japan

a r t i c l e i n f o

a b s t r a c t

Article history: Received 29 August 2016 Received in revised form 20 October 2016 Accepted 6 November 2016 Available online 9 November 2016

Beta-casein is a secretory protein contained in milk. Mammary epithelial cells (MECs) synthesize and secrete b-casein during lactation. However, it remains unclear how the b-casein secretion pathway is developed after parturition. In this study, we focused on prolactin (PRL), epidermal growth factor (EGF), and glucocorticoids, which increase in blood plasma and milk around parturition. MECs cultured with PRL, EGF and dexamethasone (DEX: glucocorticoid analog) developed the b-casein secretion pathway. In the absence of PRL, MECs hardly expressed b-casein. EGF enhanced the expression and secretion of bcasein in the presence of PRL and DEX. DEX treatment rapidly increased secreted b-casein concurrent with enhancing b-casein expression. DEX also up-regulated the expression of SNARE proteins, such as SNAP-23, VAMP-8 and Syntaxin-12. Furthermore, PRL and DEX regulated the expression ratio of as1-, band k-casein. These results indicate that PRL, EGF and glucocorticoids have distinct roles in the establishment of b-casein secretion pathway. © 2016 Elsevier Ireland Ltd. All rights reserved.

Keywords: Prolactin Epidermal growth factor Glucocorticoid Dexamethasone b-casein Mammary epithelial cell

1. Introduction The mammary gland is a highly specialized organ that produces milk during lactation. Milk contains sufficient doses of proteins, carbohydrates, and lipids as nutrition for suckling infants. Most of these components are synthesized by alveolar mammary epithelial cells (MECs) and are then secreted into the alveolar lumen in lactating mammary glands. Alveolar MECs proliferate during pregnancy and differentiate into mature milk-secreting cells to produce adequate quantities of milk after parturition (Neville et al., 2002). The milk production ability of MECs is regulated by several

Abbreviations: DEX, dexamethasone; EGF, epidermal growth factor; EGFr, EGF receptor; FBS, fetal bovine serum; GR, glucocorticoid receptor; JAK2, Janus kinase 2; MEC, mammary epithelial cell; PBST, PBS containing 0.05% Tween 20; PRL, prolactin; qPCR, quantitative PCR; RER, rough endoplasmic reticulum; RT, reverse transcription; SNARE, Soluble N-ethylmaleimide-sensitive factor activating protein receptor; STAT5, signal transducer and activator of transcription 5. * Corresponding author. E-mail addresses: [email protected] (K. Kobayashi), 09poyo29@ gmail.com (S. Oyama), [email protected] (C. Kuki), [email protected]. jp (Y. Tsugami), [email protected] (K. Matsunaga), tsuzuki@ anim.agr.hokudai.ac.jp (T. Suzuki), [email protected] (T. Nishimura). http://dx.doi.org/10.1016/j.mce.2016.11.006 0303-7207/© 2016 Elsevier Ireland Ltd. All rights reserved.

factors including systemic hormones and local growth factors (Weaver and Hernandez, 2016). Prolactin (PRL) and glucocorticoids, which are known as lactogenic hormones and induce milk production, increase in blood plasma around parturition (Edgerton and Hafs, 1973; Nguyen et al., 2001). EGF regulates alveolar development and the expression of milk proteins together with PRL in ex vivo mammary gland cultures (Plaut, 1993). MECs are exposed to epidermal growth factor (EGF) in milk around parturition and during lactation (Xiao et al., 2002). In particular, colostrum, which is secreted immediately after parturition, contains high concentrations of EGF at 300 ng/ml in humans (Read et al., 1984). Thus, PRL, glucocorticoids and EGF are abundant in mammary glands when MECs initiate milk production. Alveolar MECs synthesize and secrete various milk-specific proteins around parturition. Casein is the most major milkspecific protein and consists of multiple subtypes with some species-specific differences (Miller et al., 1990). For example, mouse milk contains aS1-, b-, g-, d-, and k-casein, while bovine milk contains aS1-, aS2-, b-, and k-casein. In addition, human milk contains a-, aS2-like-, b-, and k-casein. Beta-casein is commonly found in milk across mammalian species and shows typical expression patterns as a milk-specific protein in accordance with the lactation

K. Kobayashi et al. / Molecular and Cellular Endocrinology 440 (2017) 16e24

stage after parturition (Rijnkels, 2002; Edery et al., 1984; Rezaei et al., 2016). Beta-casein is also the most-investigated casein regarding gene expression regulatory mechanisms. PRL and glucocorticoids synergistically induce b-casein gene expression (Doppler et al., 1989; Kabotyanski et al., 2009). EGF enhances casein expression with PRL in cultured rat MECs (Sigurdson and Ip, 1993). These reports indicate that b-casein expression levels are regulated by PRL, glucocorticoids and EGF during parturition and lactation. However, it remains unclear how these factors are involved in the secretion of b-casein from MECs into the alveolar lumen. Caseins are secretory proteins that form micelle structures in MECs. Caseins are synthesized in the rough endoplasmic reticulum (RER) and are then transported to the Golgi apparatus. Casen serine residues are phosphorylated in the Golgi apparatus and casein micelles are formed by calcium phosphate-mediated aggregation between phosphorylated casein serines (Clermont et al., 1993). Kappa-casein is glycosylated in the Golgi apparatus. Glycosylated kcasein is predominantly located on the outer layer of the micelles due to its hydrophilic, phosphorylated and glycosylated C-terminal region (Day et al., 2015). Casein micelles are packaged into secretory vesicles and then transported into apical plasma membranes in alveolar MECs. Soluble N-ethylmaleimide-sensitive factor activating protein receptor (SNARE) proteins regulate the intracellular trafficking and exocytosis of casein micelles (Truchet et al., 2014). SNARE proteins are categorized as vesicular- and target-SNAREs. The vesicular-SNARE proteins (VAMPs) are localized on the vesicle membrane, while target-SNARE proteins (Syntaxins) are on the apical or basolateral membranes. The association of vesicularand target-SANRE proteins leads to the SNARE complex formation for exocytosis. SNAP-23 interacts with Syntaxins and VAMPs as a central player for casein micelle secretion (Chat et al., 2011). Casein micelles are finally secreted into the alveolar lumen together with other milk components such as lactose and water. Alveolar MECs develop the above intracellular b-casein secretion pathway after initiating b-casein expression during parturition and maintain it during lactation (Anderson et al., 2007). However, it remains unclear whether PRL, glucocorticoids and EGF regulate bcasein secretion in MECs. We have previously reported a cell culture model using primary MECs where casein secretion is induced in the presence of PRL, EGF, and dexamethasone (DEX) (Kobayashi et al., 2016). In this study, we investigated the influences of these factors on the b-casein secretion pathway using an MEC culture model.

17

centrifugation, the pellet was resuspended in 60% fetal bovine serum (FBS, Gibco®/Thermo Fisher Scientific, Waltham, MA) containing RPMI-1640 medium and then centrifuged at 5g for 5 min. The precipitants were used as the mammary epithelial fragments. The fragments were seeded on a culture dish with RPMI-1640 supplemented with 10% FBS, 10 mg/mL insulin (Sigma-Aldrich, St. Louis, MO), 10 ng/mL EGF (BD Biosciences, San Diego, CA), 100 U/mL penicillin, and 100 mg/mL streptomycin as the growth medium. For immunofluorescence staining, the fragments were seeded on a poly-L-lysine-coated glass coverslip. After the MECs spread outwards from the epithelial fragments and reached confluence, the culture medium was changed to the differentiation medium (RPMI1640 supplemented with 1% FBS, 10 mg/mL insulin, 10 ng/mL EGF, 0.5 U/mL PRL from sheep pituitary (Sigma-Aldrich), and 1 mM DEX (Sigma-Aldrich). Incomplete differentiation medium, which lacks either of EGF, PRL, or DEX, was also prepared. 2.3. Immunofluorescence staining

2. Materials and methods

MECs on glass coverslips were fixed with methanol for 10 min at 20
C followed by 1% formaldehyde in PBS for 10 min at 4
C. After treatment with 0.2% Triton X-100 in PBS for 5 min at room temperature, the fixed MECs were incubated with phosphatebuffered saline (PBS) containing 5% bovine serum albumin (BSA; Sigma-Aldrich) to block nonspecific interactions. They were then incubated with the primary antibody diluted in blocking solution overnight at 4
C. The following antibodies served as primary antibodies: (1) rabbit polyclonal antibodies against GPR78 (SigmaAldrich, #G9043, 1:400) and GM130 (Abcam, Cambridge, UK, #ab7970, 1:1000); (2) a mouse monoclonal antibody against cytokeratin 18 (CK18; Progen Biotechnik, Heidelberg, Germany, #61028, 1:50) and SNAP-23 (Sigma-Aldrich, #WH0008773M1, 1:100) and (3) a goat polyclonal antibody against b-casein (Santa Cruz Biotechnology, #sc-17969, 1:200). After washing with PBS containing 0.05% Tween 20 (PBST), the glass coverslips were incubated with secondary antibodies diluted in the blocking solution for 1 h at room temperature. The following secondary antibodies were purchased from Life Technologies (Gaithersburg, MD): (1) Alexa Fluor 546-conjugated donkey anti-rabbit IgG antibody, (2) Alexa Fluor 546-conjugated donkey anti-mouse IgG antibody, and (3) Alexa Fluor 488-conjugated donkey anti-goat IgG antibody. Control samples were processed in the same manner, with the exception that the primary antibody was absent. Immunofluorescence staining images were obtained with a confocal laser-scanning microscope (TCS SP5; Leica, Mannheim, Germany).

2.1. Animals

2.4. Western blot

Virgin female ICR mice were purchased from Japan SLC Inc. (Shizuoka, Japan) and were maintained under conventional conditions at 22e25
C. The mice were decapitated, and the fourth mammary glands were excised for isolation of MECs. All of the experimental procedures in this study were approved by the Animal Resource Committee of Hokkaido University and were conducted in accordance with Hokkaido University guidelines for the care and use of laboratory animals.

MECs were lysed in Laemmli SDS-sample buffer (62.5 mM Tris: pH 6.8, 5% b-mercaptoethanol, 2% SDS, 0.1% bromophenol blue, and 10% glycerol), incubated for 10 min at 70
C, and stored at 20
C as samples for western blotting. The MEC samples were electrophoresed using a 12.5% SDS-polyacrylamide gel and transferred onto polyvinylidene difluoride membranes (Bio-Rad Laboratories, Hercules, CA). The membranes were immersed for 1 h in PBST containing 5% BSA and then incubated overnight at 4
C with primary antibodies diluted in PBST containing 2.5% BSA. The following antibodies served as primary antibodies: (1) a mouse monoclonal antibody against b-actin (Sigma-Aldrich, #A5441, 1:10,000) and (2) a goat polyclonal antibody against b-casein (1:750). Subsequently, the membranes were washed in PBST and incubated for 45 min at room temperature with horseradish peroxidase -conjugated antimouse or anti-goat IgG antibodies diluted in PBST containing 2.5% BSA. The immunoreactive bands were detected using the Luminata Forte Western HRP substrate (Millipore, Billerica, MA). The images

2.2. Cell culture MECs were isolated by a previously described procedure (Kobayashi et al., 2016). Briefly, the mammary glands were minced with a scalpel and incubated with RPMI-1640 medium containing type III collagenase (Worthington Biochemical Corporation, Lakewood, NJ) at 1.5 mg/ml for 2 h at 37
C, followed by treatment with 0.2% trypsin in RPMI-1640 for 5 min at room temperature. After

18

K. Kobayashi et al. / Molecular and Cellular Endocrinology 440 (2017) 16e24

of the protein bands were obtained with a Bio-Rad ChemiDoc™ EQ densitometer and the Bio-Rad Quantity One® software (Bio-Rad). 2.5. Reverse transcription PCR Total RNA from MECs was extracted using the RNeasy Mini Kit (Qiagen, Valencia, CA). Reverse transcription (RT) was performed using ReverTra Ace qPCR RT Master Mix (Toyobo, Osaka, Japan). The quantitative PCR (qPCR) was conducted on a Light Cycler 480 (Roche Applied Science, Indianapolis, IN) with the Thunderbird SYBR qPCR Mix (Toyobo). We used the following cycling conditions: (1) 95
C for 1 min and (2) 40 cycles of 95
C for 15 s and 58
C for 1 min. Glyceraldehyde-3-phosphate dehydrogenase (Gapdh) served as an internal control. The primer sequences are listed in Table 1.

probably was encased in casein micelles in secretory vesicles (Fig. 1G and H). SNAP-23, which is a secretory vesicle marker, was partially co-localized with the granular b-casein (Fig. 1I) (Chat et al., 2011). Most of the granular b-casein was localized near or at the SNAP-23 positive regions. The fractions of MEC layers and the medium were examined by western blotting to confirm intracellular and secreted b-casein, respectively. The intracellular b-casein increased and peaked at 3 days after cultivation in differentiation medium (Fig. 2A and B). In contrast, secreted b-casein into the medium gradually increased and peaked at 5 days after cultivation (Fig. 2A, C). These results indicate that the differentiation medium containing PRL, DEX, and EGF induces b-casein expression in MECs, followed by the secretion of b-casein into the medium. 3.2. PRL, DEX and EGF are individually involved in b-casein expression and secretion

2.6. Statistical analysis Data are expressed as mean values (S.E.). Significance values were calculated by Bonferroni-corrected two-tailed Student's t-test following one-way analysis of variance. Differences were considered significant at p values < 0.05 or <0.005, which are indicated by asterisks or lowercase letters. All of the experiments were performed a minimum of four times using MECs originating from different culture dishes. 3. Results 3.1. MECs express b-casein and develop the secretion pathway in the presence of PRL, DEX and EGF To induce lactogenesis, MECs were cultured in differentiation medium containing PRL, DEX and EGF using a previously described method (Kobayashi et al., 2016). CK18, which is a marker for mammary luminal epithelial cells, was expressed in MECs cultured in both the growth and the differentiation media (Fig. 1A, D) (O'Hare et al., 1991). Most of the MECs were positive for b-casein 5 days after cultivation with the differentiation medium (Fig. 1DeF). In the case of the growth medium without PRL or DEX, b-casein positive cells were hardly observed (Fig. 1AeC). In MECs cultured in differentiation medium, b-casein was partially co-localized with GRP78, which is an ER marker (Fig. 1E). The Golgi marker, GM130, was observed around nuclei together with intensive positive reaction to b-casein in MECs cultured in the differentiation medium (Fig. 1F). MECs cultured in the growth medium did not show obvious differences in the localization of GRP78 and GM130 compared to those in the differentiation medium (Fig. 1B and C). The granular localization of b-casein was observed at the apical side of MECs in vertical Z-scan images by confocal microscopy and

MECs were cultured for 4 days in incomplete differentiation medium that lacked either PRL, DEX or EGF. The lack of PRL caused drastic decreases in b-casein expression at a comparable level to that in MECs cultured in the growth medium (Fig. 3A). Beta-casein expression levels were approximately 40% in the absence of EGF and 20% in the absence of DEX compared the complete differentiation medium. Intracellular b-casein was detected by western blotting in MECs cultured in medium containing PRL with EGF and/or DEX (Fig. 3B). The secreted b-casein bands were clearly observed in the medium containing PRL and DEX regardless of EGF. Lack of PRL, EGF or DEX in the differentiation medium influences the localization patterns of b-casein in MECs (Fig. 3C). The localization of b-casein was clearly observed in the presence of PRL, EGF and DEX. Beta-casein was hardly observed in MECs in the absence of PRL. The lack of DEX and EGF weakened the b-casein staining intensity in MECs compared to those cultured in the complete differentiation medium. To examine the time-dependent effects of PRL, DEX and EGF, MECs were first cultured in incomplete differentiation medium lacking one factor and then with complete differentiation medium for a total of 5 days. Intracellular and secreted b-casein gradually increased depending on the PRL treatment time (Fig. 4A, D). MECs required PRL treatment for more than 3 days to significantly increase intracellular and secreted b-casein. EGF treatment induced a time-dependent increase in b-casein expression and secretion (Fig. 4B, E). DEX treatment for 1 day induced a significant increase in both intracellular and secreted b-casein at a comparable level to MECs cultured with DEX for 5 days (Fig. 4C, F). The secreted bcasein in MECs treated with DEX for 3 days was approximately two-

Table 1 Primer Sequences for real-time PCR in mouse mammary glands. Gene

as1-casein b-casein k-casein Snap-23 Vamp-3 Vamp-4 Vamp-8 Syntaxln-3 Syntaxin-6 Syntaxin-7 Syntaxin-12 Gapdh

Accession number

NM_007784 NM_009972 NM_007786 NM_001177792 NM_009498 NM_016796 NM_016794.3 NM_001025307.1 NM_021433 NM_016797.4 NM_133887.4 NM_008084

Primers

Product size

Forward

Reverse

cctttcccctttgggcttac cttcagaaggtgaatctcatggg tcgaccccattactcccattgtgt gtgttgtggcctctgcatct gctgccactggcagtaatcgaagac gggaccatctggaccaagatttgg tttgagaggcccaagtgctc ggacgaggttgagattgcca cgactggacaacgtgatgaa ccgtgttcccattctctgtca catttgacagccatgaagagtgg gagcgagaccccactaacatc

tgaggtggatggagaatgga cagattagcaagactggcaagg tgtaaaaggtaagggaagacgagaaagat ccatctcatcttctctggcatc gagagcttctggtctctttc catccacgccaccacatttgcctt ttgaagtgttcagacgtggc ctttggtttttggctctggga ctgggcgaggaatgtaagtg atttccacggagcattgtgtg cgagctttccacattggctt gcggagatgatgaccctttt

193 330 289 254 113 225 202 96 216 239 218 144

K. Kobayashi et al. / Molecular and Cellular Endocrinology 440 (2017) 16e24

19

Fig. 1. The intracellular localization of b-casein in MECs cultured in differentiation media. Immunofluorescence staining images show the localization of b-casein (green, A-I); CK18 (A, D), as a marker for mammary luminal epithelial cells; GRP78 (B, E), as a marker for ER; GM130 (C, F, G, H), as a marker for Golgi apparatus; SNAP23 (I), as a marker for secretory vesicles in MECs cultured in the growth (AeC) or the differentiation (DeI) medium for 5 days. The granular localization of b-casein on the apical side of MECs was observed by horizontal (G) and vertical Z-scan (H) images from confocal microscopy. Scale bars: 10 mm. (For interpretation of the references to colour in this figure legend, the reader is referred to the web version of this article.)

Fig. 2. Influence of the differentiation media on b-casein expression and secretion. (A) The intracellular b-casein in MECs and the secreted b-casein into the medium were detected by western blotting. MECs were cultured for 0, 1, 3 and 5 days with differentiation medium containing PRL (0.5 U/mL), EGF (10 ng/ml) and DEX (1 mM) following 5 days of culture with the growth medium. (B, C) Graphs show the results from the densitometry analysis of intracellular and secreted b-casein. Beta-actin was used as an internal control (n ¼ 8). Different lowercase letters show significant differences (p < 0.05).

fold higher than that treated for 5 days. DEX treatment induced a rapid increase in secreted b-casein than EGF or PRL treatment. 3.3. Lack of DEX causes down-regulation of genes relevant to the intracellular trafficking pathway Lactating MECs express SNARE proteins and some SNARE regulatory proteins (SNAP-23, Syntaxin-3, -6, -7, and -12, VAMP-3, -4 and -8) and parts of them have been suggested to be involved in intracellular trafficking of casein vesicles (Chat et al., 2011). Differentiation medium containing PRL, DEX and EGF induced a 2-5fold up-regulation of these genes compared to growth medium (Fig. 5). Lacking PRL or EGF did not significantly influence in the expression level of these genes. However, differentiation medium lacking DEX caused significant decreases in Snap-23, Vamp-3, -8, Syntaxin-3 and -7 mRNA expression. Syntaxin-6 and -12 also

showed decreasing tendencies, whereas Vamp-4 expression was hardly affected.

3.4. PRL and DEX are involved in SNAP-23 expression and localization SNAP-23 has been reported to be involved in trafficking casein micelles in secretory vesicles (Chat et al., 2011). In the presence of PRL and DEX, the localization of SNAP-23 was clearly observed in peripheral regions in parts of MECs (Fig. 6A, C). In the absence of PRL, scattered localization of SNAP-23 was observed through MECs (Fig. 6B). The staining intensity of SNAP-23 became weak in the absence of EGF (Fig. 6D). MECs were also double-stained with bcasein and SNAP-23 (Fig. 6EeL). Most b-casein-expressing MECs were SNAP-23 positive.

20

K. Kobayashi et al. / Molecular and Cellular Endocrinology 440 (2017) 16e24

Fig. 3. Lack of PRL, EGF or DEX in the differentiation medium causes adverse effects on b-casein expression and secretion. MECs were cultured in growth medium (GM), complete differentiation medium (DM) containing PRL (0.5 U/mL), EGF (10 ng/ml) or DEX (1 mM) or incomplete differentiation medium lacking PRL, EGF and/or DEX for 3 days. (A) Beta-casein expression levels were determined by qPCR. The data are presented as the mean (SEM) (n ¼ 5). Different lowercase letters show significant differences (p < 0.05). (B) The western blotting analysis results for intracellular b-casein in MECs, secreted b-casein into the culture medium, and b-actin. (C) Immunostaining images for b-casein (green) with DAPI (blue). Scale bars: 10 mm. (For interpretation of the references to colour in this figure legend, the reader is referred to the web version of this article.)

Fig. 4. Lack of PRL, EGF or DEX in the differentiation medium influences the amount of intracellular and secreted b-casein in MECs. MECs were cultured in incomplete differentiation media lacking either PRL (A, D; 0.5 U/mL), EGF (B, E; 10 ng/ml) or DEX (C, F; 1 mM) and then with the complete differentiation medium (DM) for a total of 5 days. (AeC) The bands show intracellular b-casein in MECs and secreted b-casein in the culture medium by western blotting. (DeF) The graphs show the results for the densitometry analysis for intracellular and secreted b-casein. Beta-actin was used as an internal control. The data are presented as the mean (SEM) (n ¼ 4e6). Different lowercase letters show significant differences (p < 0.05).

3.5. PRL, DEX and EGF influence the expression ratio of casein subtypes Beta-caseins form micelle structures with other casein subtypes in MECs. In particular, a- and k-caseins contribute to efficient secretion of b-casein (Shekar et al., 2006; Chanat et al., 1999). PRL, DEX and EGF distinctly influenced the mRNA expression of the as1and k-casein subtypes in addition to b-casein. In the absence of PRL, as1-, b- and k-casein expression levels showed significant decreases

compared to the control, especially b-casein (Fig. 7A). Lack of EGF evenly decreased as1-, b- and k-casein expression by approximately 25% compared with the control. In the absence of DEX, b- and kcasein expression was decreased by 8% and 58%, respectively, though as1-casein expression levels were comparable with the control. MECs cultured in media lacking PRL or DEX showed different as1-, b-, and k-casein expression ratios from the control, whereas media lacking EGF hardly changed the casein ratios (Fig. 7B).

K. Kobayashi et al. / Molecular and Cellular Endocrinology 440 (2017) 16e24

21

Fig. 5. Lack of PRL, EGF or DEX in the differentiation medium influences SNARE protein expression. The graph shows the relative expression levels of Snap-23, Vamp-3, -4, -8, Syntaxin-3, -6, -7 and -12 in MECs cultured in growth medium (GM), complete (DM) or incomplete differentiation media lacking either PRL (0.5 U/mL), EGF (10 ng/ml) or DEX (1 mM) for 4 days. The data are presented as the mean (SEM) (n ¼ 6). Asterisks show significant differences among the different media (*p < 0.05 and **p < 0.005).

Fig. 6. Lack of PRL and DEX influences the localization patterns of SNAP-23. Immunofluorescence staining images show the localization of SNAP-23 (red, A-D) and b-casein (green, E-H) in MECs cultured in complete (DM) or incomplete differentiation media lacking either PRL (0.5 U/mL), EGF (10 ng/ml) or DEX (1 mM) for 3 days. Merged images of SNAP-23 and b-casein with DAPI (blue, I-L). Scale bars: 10 mm. (For interpretation of the references to colour in this figure legend, the reader is referred to the web version of this article.)

4. Discussion Beta-casein is a secretory protein contained in milk and is a primary source of essential amino acids and calcium for suckling infants (Rezaei et al., 2016). Beta-casein expression is drastically induced around parturition and is maintained during lactation in alveolar MECs (Anderson et al., 2007). PRL, glucocorticoids and EGF, which increase around parturition in milk and blood, have been reported to regulate b-casein expression (Edgerton and Hafs, 1973; Nguyen et al., 2001; Xiao et al., 2002; Doppler et al., 1989; Kabotyanski et al., 2009; Sigurdson and Ip, 1993). However, it remains unclear how the b-casein secretion pathway in alveolar MECs is developed after parturition. In this study, we investigated the role of PRL, glucocorticoids and EGF in b-casein secretion in vitro. In the presence of PRL, EGF and DEX, the amount of secreted b-casein gradually increased following the increase in intracellular

b-casein in MECs. MECs also showed b-casein localization in the ER, Golgi apparatus and secretory vesicles in the presence of PRL, EGF and DEX. Beta-casein-positive vesicles were observed beneath the apical membrane in MECs. These results suggest that b-casein is secreted into the extracellular space through the ER, Golgi apparatus, secretory vesicles and the apical membrane in MECs treated with PRL, DEX and EGF. This b-casein trafficking pathway is observed in lactating mammary glands (Burgoyne and Duncan, 1998). The lack of PRL, DEX or EGF caused adverse effects in both bcasein expression and secretion in MECs. In the absence of PRL, MECs hardly express b-casein. The amount of intracellular and secreted b-casein increased depending on the treatment time with PRL. Suckling stimuli activate PRL-release from the mammotrope in the anterior pituitary gland during lactation (Nagy and Frawley, 1990). The inhibition of PRL secretion from the anterior pituitary

22

K. Kobayashi et al. / Molecular and Cellular Endocrinology 440 (2017) 16e24

Fig. 7. Lack of PRL, EGF and DEX influences the expression patterns of casein subtypes. (A) The graphs show the relative expression levels of as1-, b-, and k-casein in MECs cultured for 4 days with complete (DM) or incomplete differentiation media lacking PRL (0.5 U/mL), EGF (10 ng/ml) or DEX (1 mM) by qPCR. The data are presented as the mean (SEM) (n ¼ 6). Asterisks show significant differences among the different media (**p < 0.005). (B) The graph indicates the as1-, b-, and k-caseins ratios.

gland by bromocriptine causes a drastic decrease in milk components containing b-casein (Rudolph et al., 2011). PRL binds to the PRL receptor and activates the signal transducer and activator of transcription 5 (STAT5)/Janus kinase 2 (JAK2) pathway (Hynes et al., 1997). Activation of the STAT5/JAK2 pathway induces the transcription of specific sets of lactogenesis-related genes, including bcasein (Buitenhuis et al., 2004; Groner and Gouilleux, 1995). PRLreceptor expression and STAT5 activation are required for both mammary development and b-casein expression (Gallego et al., 2001; Inuzuka et al., 1999). Therefore, STAT5 activation by PRL is indispensable for initiating b-casein expression. In contrast, the lack of PRL did not significantly influence SNARE protein mRNA expression. SNAP-23, VAMP-4, VAMP-8 and Syntaxin-12 have been suggested to be involved in trafficking casein micelles in secretory vesicles (Chat et al., 2011). Therefore, it has been suggested that PRL mainly contributes to the initiation and maintenance of b-casein expression rather than the b-casein secretory pathway. In the presence of PRL and DEX, EGF treatment increased the amount of intracellular and secreted b-casein. However, b-casein localization in MECs did not change regardless of the presence EGF, though the staining intensity became weak in the absence of EGF. The expression levels of trafficking proteins were substantially unaffected by EGF. These results suggest that EGF enhances bcasein expression without influencing the b-casein secretory pathway. Alveolar MECs express EGF receptor (EGFr) during lactation (Sankaran and Topper, 1987). MECs are exposed to EGF in milk during lactation. In particular, the colostrum contains high concentrations of EGF. EGF receptor activation and EGF/EGFr involvement in the onset of lactation have also been suggested (Fu et al., 2015). However, the role of EGF in lactating MECs remains controversial. Some reports indicate inhibitory effects for EGF on bcasein expression. For example, EGF suppresses PRL-induced bcasein expression by interfering with STAT5a-mediated gene expression (Haines et al., 2009). Casein expression is inhibited by EGF when insulin is present in the culture medium at nonphysiologically high concentrations (Sankaran and Topper, 1987). The effects of EGF on b-casein expression may change according to the presence of other lactogenesis-related factors. Glucocorticoids bind to the intracellular glucocorticoid receptor (GR) to form the glucocorticoid/GR complex, which acts as a transcriptional coactivator of STAT5 to enhance STAT5-dependent transcription in lactogenesis (Stocklin et al., 1996; Cairns et al., 1991; Cella et al., 1998; Presman et al., 2014). In this study, a lack of DEX caused a significant decrease in b-casein expression at the

mRNA and protein levels in the presence of PRL. We have previously reported that DEX and PRL synergistically induce b-casein expression in MECs concurrent with lactation-specific tight junctions, which also block the leakage of milk components into the alveolar lumen through paracellular pathways (Kobayashi et al., 2016; Stelwagen and Singh, 2014). In this study, DEX treatment showed a rapid increase in secreted b-casein together with intracellular b-casein. DEX mostly influenced the expression of SNARE proteins including SNAP-23, VAMP-4, VAMP-8 and Syntaxin-12, which have been suggested to be involved in trafficking casein micelles in secretory vesicles (Chat et al., 2011). The lack of DEX also influenced the localization pattern of SNAP-23 with weak staining. Therefore, it is suggested that DEX (glucocorticoid) facilitates both b-casein expression and secretion. DEX and glucocorticoids are also known as NFkB inhibitors (Wissink et al., 1998). Activation of NFkB occurs by short-time weaning and inhibits milk production (Connelly et al., 2010). Glucocorticoid/GR signaling may regulate the expression and secretion of b-casein through NFkB activation/ inactivation after weaning in vivo. Beta-casein is secreted as casein micelles with other casein subtypes. In mice, casein subtypes consist of the calcium-sensitive caseins (a-, b, g and d-casein) and a calcium-insensitive glycosylated casein (k-casein) (Rijnkels, 2002). Hydrophilic k-casein is predominantly located on the outer layer of casein micelles and is indispensable for the organization of stable micelle structures (Day et al., 2015). The k-casein contents per total caseins are negatively correlated with the size of casein micelles (McGann et al., 1980). Kappa-casein-deficient mice fail to lactate due to destabilization of the micelles in the alveolar lumen of the mammary gland without affecting the expression of other caseins (Shekar et al., 2006). Alphas1-casein is involved in the efficient transport of b- and k-casein from the ER to the Golgi apparatus (Chanat et al., 1999). Thus, k- and a-casein expression levels influence b-casein secretion. In this study, the lack of PRL or DEX specifically decreased the ratio of bcasein as opposed to a- and k-caseins, although EGF does not influence the ratio of the casein subtypes. These data indicate that PRL and glucocorticoids regulate b-casein secretion by affecting the expression ratio of each casein subtype. In mice and bovines, b-casein accounts for approximately 20% of total milk proteins (Hallen et al., 2008; Kumar et al., 1994). Alveolar MECs synthesize and secrete b-casein as nutrition for suckling infants. Beta-casein secretion requires appropriate processes for casein micelle formation and intracellular trafficking (Truchet et al., 2014). In this study, we showed that PRL, EGF and DEX

K. Kobayashi et al. / Molecular and Cellular Endocrinology 440 (2017) 16e24

(glucocorticoid analog) have distinct roles in b-casein expression and secretion. PRL was a key regulator for initiating b-casein expression. EGF was an enhancer for b-casein expression in the presence of PRL and DEX. DEX contributed the formation of the bcasein trafficking pathway concurrent with enhancing b-casein expression with PRL and EGF. PRL, glucocorticoids and EGF are abundant in mammary glands when MECs initiate milk production around parturition. Our results indicate that PRL, glucocorticoids and EGF are involved in b-casein expression and secretion. In particular, glucocorticoids would have an important role in initiation of b-casein secretion after parturition. Beta-casein-deficient mice showed a reduction in total protein concentrations in milk, with a reduction in pup growth without affecting the assembly of casein micelles (Kumar et al., 1994). PRL, EGF and glucocorticoids may regulate the total protein concentration in milk by regulating the expression levels of b-casein during lactation. Funding This work was supported by a Grant-in-Aid for Scientific Research from the Japan Society for the Promotion of Science (KAKENHI, 2645044104). Declaration of interest The authors who have taken part in this study declared that they do not have anything to disclose regarding funding or conflict of interest with respect to this manuscript. Acknowledgments We are grateful to Prof. Fumio Nakamura, Hokkaido University, Japan for his helpful research advice. References Anderson, S.M., Rudolph, M.C., McManaman, J.L., Neville, M.C., 2007. Key stages in mammary gland development. Secretory activation in the mammary gland: it's not just about milk protein synthesis! Breast Cancer Res. 9, 204. Buitenhuis, M., Coffer, P.J., Koenderman, L., 2004. Signal transducer and activator of transcription 5 (STAT5). Int. J. Biochem. Cell Biol. 36, 2120e2124. Burgoyne, R.D., Duncan, J.S., 1998. Secretion of milk proteins. J. Mammary Gland. Biol. Neoplasia 3, 275e286. Cairns, W., Cairns, C., Pongratz, I., Poellinger, L., Okret, S., 1991. Assembly of a glucocorticoid receptor complex prior to DNA binding enhances its specific interaction with a glucocorticoid response element. J. Biol. Chem. 266, 11221e11226. Cella, N., Groner, B., Hynes, N.E., 1998. Characterization of Stat5a and Stat5b homodimers and heterodimers and their association with the glucocortiocoid receptor in mammary cells. Mol. Cell Biol. 18, 1783e1792. Chanat, E., Martin, P., Ollivier-Bousquet, M., 1999. Alpha(S1)-casein is required for the efficient transport of beta- and kappa-casein from the endoplasmic reticulum to the Golgi apparatus of mammary epithelial cells. J. Cell Sci. 112 (Pt 19), 3399e3412. Chat, S., Layani, S., Mahaut, C., Henry, C., Chanat, E., Truchet, S., 2011. Characterisation of the potential SNARE proteins relevant to milk product release by mouse mammary epithelial cells. Eur. J. Cell Biol. 90, 401e413. Clermont, Y., Xia, L., Rambourg, A., Turner, J.D., Hermo, L., 1993. Transport of casein submicelles and formation of secretion granules in the Golgi apparatus of epithelial cells of the lactating mammary gland of the rat. Anat. Rec. 235, 363e373. Connelly, L., Barham, W., Pigg, R., Saint-Jean, L., Sherrill, T., Cheng, D.S., Chodosh, L.A., Blackwell, T.S., Yull, F.E., 2010. Activation of nuclear factor kappa B in mammary epithelium promotes milk loss during mammary development and infection. J. Cell Physiol. 222, 73e81. Day, L., Williams, R.P., Otter, D., Augustin, M.A., 2015. Casein polymorphism heterogeneity influences casein micelle size in milk of individual cows. J. Dairy Sci. 98, 3633e3644. Doppler, W., Groner, B., Ball, R.K., 1989. Prolactin and glucocorticoid hormones synergistically induce expression of transfected rat beta-casein gene promoter constructs in a mammary epithelial cell line. Proc. Natl. Acad. Sci. U. S. A. 86, 104e108. Edery, M., Houdebine, L.M., Djiane, J., Kelly, P.A., 1984. Studies of beta-casein content of normal and neoplastic rat mammary tissues by a homologous

23

radioimmunoassay. Mol. Cell Endocrinol. 34, 145e151. Edgerton, L.A., Hafs, H.D., 1973. Serum luteinizing hormone, prolactin, glucocorticoid, and progestin in dairy cows from calving to gestation. J. Dairy Sci. 56, 451e458. Fu, N.Y., Rios, A.C., Pal, B., Soetanto, R., Lun, A.T., Liu, K., Beck, T., Best, S.A., Vaillant, F., Bouillet, P., Strasser, A., Preiss, T., Smyth, G.K., Lindeman, G.J., Visvader, J.E., 2015. EGF-mediated induction of Mcl-1 at the switch to lactation is essential for alveolar cell survival. Nat. Cell Biol. 17, 365e375. Gallego, M.I., Binart, N., Robinson, G.W., Okagaki, R., Coschigano, K.T., Perry, J., Kopchick, J.J., Oka, T., Kelly, P.A., Hennighausen, L., 2001. Prolactin, growth hormone, and epidermal growth factor activate Stat5 in different compartments of mammary tissue and exert different and overlapping developmental effects. Dev. Biol. 229, 163e175. Groner, B., Gouilleux, F., 1995. Prolactin-mediated gene activation in mammary epithelial cells. Curr. Opin. Genet. Dev. 5, 587e594. Haines, E., Minoo, P., Feng, Z., Resalatpanah, N., Nie, X.M., Campiglio, M., Alvarez, L., Cocolakis, E., Ridha, M., Di Fulvio, M., Gomez-Cambronero, J., Lebrun, J.J., Ali, S., 2009. Tyrosine phosphorylation of Grb2: role in prolactin/epidermal growth factor cross talk in mammary epithelial cell growth and differentiation. Mol. Cell Biol. 29, 2505e2520. Hallen, E., Wedholm, A., Andren, A., Lunden, A., 2008. Effect of beta-casein, kappacasein and beta-lactoglobulin genotypes on concentration of milk protein variants. J. Anim. Breed. Genet. 125, 119e129. Hynes, N.E., Cella, N., Wartmann, M., 1997. Prolactin mediated intracellular signaling in mammary epithelial cells. J. Mammary Gland. Biol. Neoplasia 2, 19e27. Inuzuka, H., Yamanouchi, K., Tachi, C., Tojo, H., 1999. Expression of milk protein genes is induced directly by exogenous STAT5 without prolactin-mediated signal transduction in transgenic mice. Mol. Reprod. Dev. 54, 121e125. Kabotyanski, E.B., Rijnkels, M., Freeman-Zadrowski, C., Buser, A.C., Edwards, D.P., Rosen, J.M., 2009. Lactogenic hormonal induction of long distance interactions between beta-casein gene regulatory elements. J. Biol. Chem. 284, 22815e22824. Kobayashi, K., Kuki, C., Oyama, S., Kumura, H., 2016. Pro-inflammatory cytokine TNF-alpha is a key inhibitory factor for lactose synthesis pathway in lactating mammary epithelial cells. Exp. Cell Res. 340, 295e304. Kumar, S., Clarke, A.R., Hooper, M.L., Horne, D.S., Law, A.J., Leaver, J., Springbett, A., Stevenson, E., Simons, J.P., 1994. Milk composition and lactation of beta-caseindeficient mice. Proc. Natl. Acad. Sci. U. S. A. 91, 6138e6142. McGann, T.C., Donnelly, W.J., Kearney, R.D., Buchheim, W., 1980. Composition and size distribution of bovine casein micelles. Biochim. Biophys. Acta 630, 261e270. Miller, M.J., Witherly, S.A., Clark, D.A., 1990. Casein: a milk protein with diverse biologic consequences. Proc. Soc. Exp. Biol. Med. 195, 143e159. Nagy, G.M., Frawley, L.S., 1990. Suckling increases the proportions of mammotropes responsive to various prolactin-releasing stimuli. Endocrinology 127, 2079e2084. Neville, M.C., McFadden, T.B., Forsyth, I., 2002. Hormonal regulation of mammary differentiation and milk secretion. J. Mammary Gland. Biol. Neoplasia 7, 49e66. Nguyen, D.A., Parlow, A.F., Neville, M.C., 2001. Hormonal regulation of tight junction closure in the mouse mammary epithelium during the transition from pregnancy to lactation. J. Endocrinol. 170, 347e356. O'Hare, M.J., Ormerod, M.G., Monaghan, P., Lane, E.B., Gusterson, B.A., 1991. Characterization in vitro of luminal and myoepithelial cells isolated from the human mammary gland by cell sorting. Differentiation 46, 209e221. Plaut, K., 1993. Role of epidermal growth factor and transforming growth factors in mammary development and lactation. J. Dairy Sci. 76, 1526e1538. Presman, D.M., Ogara, M.F., Stortz, M., Alvarez, L.D., Pooley, J.R., Schiltz, R.L., Grontved, L., Johnson, T.A., Mittelstadt, P.R., Ashwell, J.D., Ganesan, S., Burton, G., Levi, V., Hager, G.L., Pecci, A., 2014. Live cell imaging unveils multiple domain requirements for in vivo dimerization of the glucocorticoid receptor. PLoS Biol. 12, e1001813. Read, L.C., Upton, F.M., Francis, G.L., Wallace, J.C., Dahlenberg, G.W., Ballard, F.J., 1984. Changes in the growth-promoting activity of human milk during lactation. Pediatr. Res. 18, 133e139. Rezaei, R., Wu, Z., Hou, Y., Bazer, F.W., Wu, G., 2016. Amino acids and mammary gland development: nutritional implications for milk production and neonatal growth. J. Anim. Sci. Biotechnol. 7, 20. Rijnkels, M., 2002. Multispecies comparison of the casein gene loci and evolution of casein gene family. J. Mammary Gland. Biol. Neoplasia 7, 327e345. Rudolph, M.C., Russell, T.D., Webb, P., Neville, M.C., Anderson, S.M., 2011. Prolactinmediated regulation of lipid biosynthesis genes in vivo in the lactating mammary epithelial cell. Am. J. Physiol. Endocrinol. Metab. 300, E1059eE1068. Sankaran, L., Topper, Y.J., 1987. Is EGF a physiological inhibitor of mouse mammary casein synthesis? Unphysiological responses to pharmacological levels of hormones. Biochem. Biophys. Res. Commun. 146, 121e125. Shekar, P.C., Goel, S., Rani, S.D., Sarathi, D.P., Alex, J.L., Singh, S., Kumar, S., 2006. kappa-casein-deficient mice fail to lactate. Proc. Natl. Acad. Sci. U. S. A. 103, 8000e8005. Sigurdson, S.L., Ip, M.M., 1993. Casein accumulation by rat mammary epithelial cells grown within a reconstituted basement membrane is modulated by fatty acids in a hormone- and time-dependent manner. Exp. Cell Res. 208, 333e343. Stelwagen, K., Singh, K., 2014. The role of tight junctions in mammary gland function. J. Mammary Gland. Biol. Neoplasia 19, 131e138. Stocklin, E., Wissler, M., Gouilleux, F., Groner, B., 1996. Functional interactions between Stat5 and the glucocorticoid receptor. Nature 383, 726e728.

24

K. Kobayashi et al. / Molecular and Cellular Endocrinology 440 (2017) 16e24

Truchet, S., Chat, S., Ollivier-Bousquet, M., 2014. Milk secretion: the role of SNARE proteins. J. Mammary Gland. Biol. Neoplasia 19, 119e130. Weaver, S.R., Hernandez, L.L., 2016. Autocrine-paracrine regulation of the mammary gland. J. Dairy Sci. 99, 842e853. Wissink, S., van Heerde, E.C., vand der Burg, B., van der Saag, P.T., 1998. A dual

mechanism mediates repression of NF-kappaB activity by glucocorticoids. Mol. Endocrinol. 12, 355e363. Xiao, X., Xiong, A., Chen, X., Mao, X., Zhou, X., 2002. Epidermal growth factor concentrations in human milk, cow's milk and cow's milk-based infant formulas. Chin. Med. J. Engl. 115, 451e454.