Diversity and antibiotic susceptibility pattern of cultivable anaerobic bacteria from soil and sewage samples of India

Infection, Genetics and Evolution 11 (2011) 64–77

Contents lists available at ScienceDirect

Infection, Genetics and Evolution journal homepage: www.elsevier.com/locate/meegid

Diversity and antibiotic susceptibility pattern of cultivable anaerobic bacteria from soil and sewage samples of India Nabonita Sengupta a, Syed Imteyaz Alam a,*, Ravi Bhushan Kumar a, Lokendra Singh b a b

Biotechnology Division, Defence Research & Development Establishment, Gwalior-474002, India Defence Research Laboratory, Tezpur, India

A R T I C L E I N F O

A B S T R A C T

Article history: Received 3 August 2010 Received in revised form 7 October 2010 Accepted 10 October 2010 Available online 20 October 2010

Soil and sewage act as a reservoir of animal pathogens and their dissemination to animals profoundly affects the safety of our food supply. Moreover, acquisition and further spread of antibiotic resistance determinants among pathogenic bacterial populations is the most relevant problem for the treatment of infectious diseases. Bacterial strains from soil and sewage are a potential reservoir for antimicrobial resistance genes. Accurate species determination for anaerobes from environmental samples has become increasingly important with the re-emergence of anaerobic bacteremia and prevalence of multiple-drug-resistant microorganisms. Soil samples were collected from various locations of planar India and the diversity of anaerobic bacteria was determined by 16S rRNA gene sequencing. Viable counts of anaerobic bacteria on anaerobic agar and SPS agar ranged from 1.0  102 cfu/g to 8.8  107 cfu/ g and nil to 3.9  106 cfu/g, respectively. Among clostrdia, Clostridium bifermentans (35.9%) was the most dominant species followed by Clostridium perfringens (25.8%). Sequencing and phylogenetic analysis of C. perfringens beta2 toxin gene (cpb2) fragment indicated specific phylogenetic affiliation with cluster Ia for 5 out of 6 strains. Antibiotic susceptibility for 30 antibiotics was tested for 74 isolates, revealing resistance for as high as 16–25 antibiotics for 35% of the strains tested. Understanding the diversity of the anaerobic bacteria from soil and sewage with respect to animal health and spread of zoonotic pathogen infections is crucial for improvements in animal and human health. ß 2010 Elsevier B.V. All rights reserved.

Keywords: Anaerobic bacteria Microbial diversity Antibiotic resistance

1. Introduction Alongside the many benefits people derive from animals, the latter can also contribute to public health risks that emerge at the human, animal and ecosystem interface. This human–animal– ecosystem interface can be described as a continuum of direct or indirect human exposure to animals, their products and their environments. More than 60% of the newly identified infectious agents that have affected people over the past few decades have been caused by pathogens originating from animals or animal products (Atlas et al., 2010). Soil and sewage act as a reservoir of animal pathogens that spread to the ruminants through grazing and skin abrasions. Microbial ecology of soil and sewage profoundly affects the safety of our food supply as related to pathogenic microbes. Zoonotic pathogenic bacteria, such as Salmonella enterica and Escherichia coli O157:H7 can live in the lower gut of cattle and cause human

* Corresponding author. E-mail addresses: [email protected] (N. Sengupta), [email protected] (S.I. Alam), [email protected] (R.B. Kumar), [email protected] (L. Singh). 1567-1348/$ – see front matter ß 2010 Elsevier B.V. All rights reserved. doi:10.1016/j.meegid.2010.10.009

illnesses through carcass contamination, farm run-off, or crop contamination (Jay et al., 2007; Rodriguez et al., 2006). Agricultural irrigation with wastewater is known to occur in many parts of the world (Scott et al., 2004) including India, although the extent of the practice is not determined. It is estimated that worldwide 20 million ha of irrigated agriculture uses raw, treated, and/or partially diluted wastewater. One of the most economically feasible agricultural uses of reclaimed water is the irrigation of high-value horticultural crops, posing risk to human and animal health via contamination of food with pathogenic microorganisms. The risk of illness to consumers of vegetables irrigated with reclaimed water may be reduced through the implementation of tertiary treatments and disinfection systems, such as activated carbon, chlorination, ozonation, and UV irradiation (Asano and Levine, 1998). However, such systems are often prohibitively expensive, particularly in developing nations, where only about 10% of wastewater undergoes treatment of any kind (Homsi, 2000). For instance, the resurgent dairy industry of India is based on cooperative based village farming where the animals are exposed to sewage and contaminated soil in their domesticated habitat. Many Gram-positive pathogenic bacteria such as those belonging to the genus Clostridium and Bacillus survive in the soil

N. Sengupta et al. / Infection, Genetics and Evolution 11 (2011) 64–77

environment in the form of resistant spores and are adapted for survival and dispersal under a wide range of environmental conditions (Stephenson and Lewis, 2005). Clostridium perfringens is an etiological agent, causing several diseases in humans (Rood and Cole, 1991) and animals (Songer, 1996, 2010); the former include gas gangrene, food poisoning, necrotizing enterocolitis of infants and enteritis necroticans. It is commonly found in the gastrointestinal tracts of both animals and humans and is widely distributed in soil and sewage. C. perfringens type A strains cause gas gangrene which is characterized by rapid destruction of tissue and usually results from severe traumatic injury. Entry of organic material from the soil or faecal matter results in contamination of the wound with vegetative cells or spores of the bacterium. The ability of C. perfringens to cause disease is associated with the production of a variety of extracellular toxins. Beta2-toxin is encoded by cpb2 gene and is lethal to mice when administered intravenously (Gibert et al., 1997). The cpb2-positive C. perfringens strains are associated with the occurrence of enteric disease in domestic animals, notably pigs, horses, and dogs (Songer, 1996; Thiede et al., 2001; Bacciarini et al., 2003). The acquisition and further spread of antibiotic resistance determinants among pathogenic bacterial populations is the most relevant problem for the treatment of infectious diseases. The bacterial strains from soil and sewage are a potential reservoir for antimicrobial resistance genes and play an important role in the ecology of antimicrobial resistance of bacterial populations. In addition, enteric faecal flora from food-producing animals such as poultry and swine can transfer antimicrobial resistance to human pathogens via the food chain (Phillips et al., 2004; Wright, 2010). Class 1 integrons play central role in the worldwide problem of antibiotic resistance, because they can capture and express diverse resistance genes. They are often embedded in promiscuous plasmids and transposons, facilitating the lateral transfer of the

65

antimicrobial resistance genes into a wide range of pathogens (Recchia and Hall, 1995; Gillings et al., 2008). The present investigation was carried out with the following objectives (1) to determine the biodiversity of culturable anaerobic bacteria isolated from the soil and sewage samples from environmental samples of northern India, using 16S rRNA gene sequence analysis; (2) phylogenetic relationships of the isolates of C. perfringens, Clostridium bifermentans, and Clostridium sordelli obtained from these sources; (3) to determine the distribution of the cpb2 gene among C. perfringens isolates and their phylogenetic analysis; and (4) to study prevalence of antibiotic resistance among the anaerobic strains. Understanding of the ecology of the major populations of bacteria in the soil and sewage samples would allow for a better understanding of ways in which the soil microbiome contributes to animal health, productivity and wellbeing. Moreover, accurate species determination for anaerobes from environmental samples has become increasingly important with the re-emergence of anaerobic bacteremia (Brook, 2010) and prevalence of multiple-drug-resistant microorganisms. 2. Materials and methods 2.1. Collection of sample Bacterial strains were isolated from environmental samples obtained from diverse ecological niches from the plains of northern India, situated between 268140 N to 278300 N and 788050 E to 798400 E (Table 1). The samples included moist and sandy soil from waste sites near butchery or from sewage canal. One soil sample (H2) was obtained from the pristine environment of western Himalayas situated at 348100 N and 778400 E. Soil samples were collected in airtight, sterile containers and carried to the laboratory on ice (2–6 h) and stored at 20 8C. The temperature of the soil ranged from

Table 1 Characteristics of environmental samples collected from various locations of Northern India. Values in parenthesis indicate log value with standard error. S. no.

Sample code

Site of sampling

Specific gravity (mg/ml)

Moisture (%)

Volatile solid (mg/l)

pH

Viable bacterial count (cfu/g) at

AG01

Dry fine soil from a butchery waste dumping site at Agra, India Deep brown, moist fine soil near sewage canal at Agra, India Dry fine soil from a butchery waste dumping site at Agra, India Dry sandy soil near Jamuna river at Agra, India Dry clay from a butchery at Agra, India Dry fine sandy soil from a butchery waste dumping site at Agra, India Dry coarse soil near a sewage canal at Agra, India Fine clay near a sewage canal at Morena, India Sandy soil from the bed of a dry sewage canal at Morena, India Moist black soil near a sewage canal at Aligarh, India Moist clay from a butchery waste dumping site at Aligarh, India Sandy soil near sewage canal at Aligarh, India Moist clay from a butchery waste dumping site at Aligarh, India Humic moist soil from a butchery at Aligarh, India Moist soil from a sewage canal at Aligarh, India Clay from a butchery at Aligarh, India Moist, clay soil from magnetic hill, Siachen, Alt.-11300 ft

0.94

17.02

11.53

8.0

6.1  107 (7.77  0.17)

AA 1 2

AG02

3

AG03

4

AG04

5 6

AG05 AG06

7

AG07

8

MU01

9

MU02

10

AL01

11

AL02

12

AL03

13

AL04

14

AL05

15

AL06

16 17

AL08 H2

SPS

7

0.0 (0.0  0.0)

0.52

39.80

33.87

7.8

1.8  10 (7.25  0.85)

3.9  106 (6.59  0.64)

0.62

2.42

28.22

7.7

1.0  102 (2.0  0.05)

0.0 (0.0  0.0)

0.87

3.47

9.58

6.5

4.0  103 (3.60  0.09)

2.0  103 (3.30  0.06)

0.55 0.92

17.27 7.53

90.80 0.74

6.9 6.7

5.2  107 (7.71  0.02) 2.3  106 (6.36  0.23)

0.0 (0.0  0.0) 4.0  101 (1.60  0.05)

0.76

9.93

0.85

6.3

2.1  105 (5.32  0.11)

3.0  102 (2.47  0.05)

0.91

10.49

0.61

6.1

5.0  107 (7.69  0.17)

1.0  102 (2.0  0.18)

1.05

17.70

3.49

6.9

8.7  106 (5.94  0.21)

4.0  105 (5.60  0.65)

0.56

42.34

19.44

8.9

3.9  103 (3.59  0.17)

1.0  102 (2.0  0.04)

0.43

72.62

78.26

7.3

8.8  107 (7.94  0.76)

3.9  106 (6.59  0.48)

0.54

48.11

23.63

7.9

8.0  105 (5.90  0.08)

2.5  105 (5.39  0.23)

0.71

75.37

93.93

7.9

1.3  106 (6.11  0.16)

5.0  103 (3.69  0.06)

0.19

31.50

77.77

8.4

2.0  104 (4.30  0.21)

1.0  104 (4.0  0.10)

0.39

77.57

78.38

8.1

3.2  106 (6.50  0.40)

2.0  105 (5.30  0.04)

0.53 1.13

35.46 4.85

9.89 35

7.7 6.2

1.0  105 (5.0  0.19) 1.2  105 (5.07  0.12)

2.2  105 (5.34  0.12) 2.6  104 (4.41  0.10)

66

Table 2 Identification of bacterial strains obtained from soil samples from northern India on the basis of 16S rRNA gene sequence similarity. S. no.a

Isolate (accession no.)b

Gram-negative bacteria Class: g-Proteobacteria Enterobacter 1 AG06-12 (FM865933) 2 AG06-20 (FM865934) Escherichia 3 MU01-13 (FM865954) 4 MU01-16 (FM865955) 5 MU01-20 (FM865956)

No. of identical isolatesc

Dilution of isolation

Nearest phylogenetic neighbord (accession number)

811 721

1 1

101 101

Enterobacter cloacae (AJ251469) Enterobacter cloacae (AJ251469)

801 807 708

1 1 4

104 104 104

Escherichia coli (CP000970) Escherichia coli (CP000800) Escherichia coli (CP001368)

582 360 501 801 766 933 1020 355 585 420

1 5 1 1 1 1 1 1 1 1

103 102 104 104 104 102 104 104 104 104

Bacillus Bacillus Bacillus Bacillus Bacillus Bacillus Bacillus Bacillus Bacillus Bacillus

637 763 801 793 785 794 790 818 589 785 804

1 1 1 1 1 1 1 1 2 1 1

104 103 103 102 103 103 102 101 101 104 104

Staphylococcus Staphylococcus Staphylococcus Staphylococcus Staphylococcus Staphylococcus Staphylococcus Staphylococcus Staphylococcus Staphylococcus Staphylococcus

790 775 775 749 800 800 803 863 795 801 793 793 801 801 800

2 1 1 1 2 1 2 1 2 2 1 9 1 4 1

104 102 104 104 103 103 103 103 103 101 104 101 103 102 101

Clostridium Clostridium Clostridium Clostridium Clostridium Clostridium Clostridium Clostridium Clostridium Clostridium Clostridium Clostridium Clostridium Clostridium Clostridium

licheniformis (AY479984) licheniformis (AY960693) licheniformis (AY859478) licheniformis (AY479984) licheniformis (EU344793) licheniformis (AB363734) licheniformis (GQ148817) licheniformis (EF450112) licheniformis (AJ880762) cereus (EF633273) epidermidis (AM983518) epidermidis (AB305326) epidermidis (EU373384) epidermidis (AY030317) epidermidis (EU373384) epidermidis (EU373384) epidermidis (EU373384) epidermidis (EF522128) epidermidis (AJ514253) epidermidis (EU373384) aureus (EU604543)

perfringens perfringens perfringens perfringens perfringens perfringens perfringens perfringens perfringens perfringens perfringens perfringens perfringens perfringens perfringens

(CP000312) (CP000246) (AM889034) (AM889034) (AB075767) (Y12669) (AM889034) (AM889034) (CP000246) (AM889034) (CP000246) (CP000246) (AM889034) (AM889034) (CP000246)

Class I integron (CS)e

Class I integron (int)f

Transposon Tn5397 (Tndx)g

Isolated on

Antibiotic resistanceh

98 97

+ +

+ +

 

SPS SPS

17 11

96 99 99

+ + +

 + +

 + 

AA AA AA

22 16 15

93 98 96 100 100 96 97 88 95 86

         

         

         

AA AA AA AA AA SPS AA AA AA AA

NT 26 NT NT NT 14 NT NT NT NT

95 97 99 99 99 97 96 98 89 98 99

          

    +      

          

AA AA SPS SPS AA AA AA AA AA AA AA

NT 5 NT NT 15 NT NT NT NT NT 18

99 100 99 99 99 99 99 96 99 99 99 98 99 100 99

              

              

              

SPS SPS AA AA AA AA AA AA SPS AA AA SPS SPS SPS SPS

21 NT NT 20 NT 14 NT 20 23 25 5 NT 20 NT 24

Identity (%)

N. Sengupta et al. / Infection, Genetics and Evolution 11 (2011) 64–77

Gram-positive bacteria Class: Firmicutes Bacillus 6 AG02-18 (FM875823) 7 AG05-4 (FM875819) 8 AG07-12 (FM875836) 9 AG07-13 (FM875807) 10 AG07-20 (FM877591) MU01-6 (FM865970) 11 MU01-14 (FM865968) 12 MU02-12 (FM875826) 13 MU02-19 (FM875825) 14 MU02-18 (FM875820) Staphylococcus 15 AG01-2 (FM865926) 16 AG01-7 (FM865902) 17 AG02-4 (FM865964) 18 AG02-10 (FM865963) 19 AG02-12 (FM865962) 20 AG02-15 (FM865961) 21 AG03-1 (FM865960) 22 AG03-6 (FM875800) 23 AG03-9 (FM875822) 24 MU02-14 (FM865965) 25 AL08-15 (FM877581) Clostridium 26 AL05-1 (FM865911) 27 AL05-7 (FM865912) 28 AL05-11 (FM865913) 29 AL05-12 (FM865914) 30 AL05-13 (FM865915) 31 AL05-16 (FM865916) 32 AL05-18 (FM865917) 33 AL05-19 (FM865918) 34 AG02-3 (FM865903) 35 AG03-4 (FM865904) 36 AG04-3 (FM865905) 37 AG04-11 (FM865929) 38 AG04-18 (FM865932) 39 AG07-1 (FM865906) 40 AG07-3 (FM865907)

Sequence length (nt)

AG07-4 (FM865908) AG07-6 (FM865909) AG07-9 (FM865910) AL06-1 (FM865919) AL06-2 (FM865943) AL08-13 (FM865920) AL08-16 (FM865921) H2-3 (FM865923) AL05-2 (FM865941) AL05-3 (FM865942) AL05-6 (FM875832) AL05-10 (FM865972) AG02-7 (FM875801) AG02-9 (FM875824) AG02-14 (FM865928) AG04-12 (FM865930) AG04-17 (FM865931) AG07-5 (FM875804) MU01-1 (FM865952) MU01-2 (FM875831) MU01-3 (FM875830) MU01-4 (FM865971) MU02-17 (FM865957) AL01-15 (FM875810) AL02-2 (FM875799) AL02-3 (FM875821) AL02-12 (FM865949) AL02-17 (FM875833) AL03-12 (FM875803) AL03-15 (FM865974) AL03-20 (FM865950) AL04-10 (FM877589) AL04-17 (FM875814) AL04-18 (FM875815) AL04-19 (FM875816) AL08-2 (FM875837) AL08-7 (FM865946) AL08-9 (FM865947) AL08-17 (FM865922) H2-6 (FM877583) AG04-5 (FM865959) AG04-7 (FM865927) AG04-19 (FM865958) AG07-8 (FM875805) AG07-10 (FM875806) MU01-5 (FM877590) MU01-8 (FM865969) AL01-1 (FM875808) AL08-3 (FM865945) H2-1 (FM877582) H2-7 (FM877584) H2-8 (FM865951) AG02-5 (FM875802) AL03-3 (FM875818) AL03-4 (FM877592) AL03-6 (FM865938) AL04-3 (FM877585)

791 793 792 633 811 804 804 806 818 831 544 784 980 584 799 817 808 776 689 331 224 811 752 780 809 254 797 497 792 791 810 783 775 789 793 783 430 777 786 791 819 781 807 783 800 461 1012 802 515 854 748 595 794 796 534 634 803

1 1 1 4 1 4 1 1 1 2 1 1 1 1 4 1 1 1 1 1 1 1 2 1 3 1 1 2 5 4 1 1 1 1 1 2 1 1 1 1 3 1 1 2 1 1 3 1 2 1 1 1 1 3 1 1 1

101 101 101 105 105 103 104 105 103 103 102 102 102 102 103 101 101 101 101 102 102 102 104 103 103 103 105 105 105 105 105 103 102 102 102 105 105 105 104 103 103 102 103 101 101 102 102 102 105 105 103 103 103 102 102 102 102

Clostridium Clostridium Clostridium Clostridium Clostridium Clostridium Clostridium Clostridium Clostridium Clostridium Clostridium Clostridium Clostridium Clostridium Clostridium Clostridium Clostridium Clostridium Clostridium Clostridium Clostridium Clostridium Clostridium Clostridium Clostridium Clostridium Clostridium Clostridium Clostridium Clostridium Clostridium Clostridium Clostridium Clostridium Clostridium Clostridium Clostridium Clostridium Clostridium Clostridium Clostridium Clostridium Clostridium Clostridium Clostridium Clostridium Clostridium Clostridium Clostridium Clostridium Clostridium Clostridium Clostridium Clostridium Clostridium Clostridium Clostridium

perfringens (CP000246) perfringens (AM889034) perfringens (DQ298091) perfringens (AM889034) perfringens (CP000246) perfringens (AM889034) perfringens (AM889034) perfringens (CP000312) bifermentans (DQ680017) bifermentans (AY604562) bifermentans (AF320283) bifermentans (AF320283) bifermentans (AF320283) bifermentans (AF320283) bifermentans (AF320283) bifermentans (AF320283) bifermentans (AY604562) bifermentans (AF320283) bifermentans (DQ680025) bifermentans (DQ680025) bifermentans (AY458853) bifermentans (AF320283) bifermentans (AY604562) bifermentans (AF320283) bifermentans (AF320283) bifermentans (DQ680025) bifermentans (AY604562) bifermentans (DQ978211) bifermentans (AF320283) bifermentans (AF320283) bifermentans (AY604562) bifermentans (AF320283) bifermentans (AF320283) bifermentans (AF320283) bifermentans (AF320283) bifermentans (AY604562) bifermentans (DQ680025) bifermentans (AY604562) bifermentans (AY604562) bifermentans (DQ680025) sordellii (DQ978216) sordellii (DQ978216) sordellii (DQ978216) sordellii (DQ978216) sordellii (DQ978216) sordellii (DQ978216) sordellii (DQ978216) sordellii (DQ978216) sordellii (M59105) sordellii (DQ978216) sordellii (DQ978216) sordellii (DQ978216) subterminale (AB294137) subterminale (AB294137) subterminale (AF241842) subterminale (AB294137) subterminale (AB294137)

99 99 99 99 99 99 99 99 97 97 96 96 97 94 99 96 98 99 97 99 92 99 98 99 99 99 99 75 99 97 98 99 99 99 99 99 98 99 100 100 96 98 99 99 99 99 94 99 98 98 99 96 97 95 95 93 95

                                                        

                                                    +    

                                                        

SPS SPS SPS SPS SPS AA AA SPS SPS SPS SPS SPS SPS SPS AA SPS SPS SPS SPS SPS SPS SPS AA AA AA AA SPS SPS AA AA AA AA AA AA AA SPS SPS SPS AA SPS AA AA SPS SPS SPS SPS SPS SPS SPS SPS SPS SPS SPS SPS SPS SPS SPS

25 27 25 23 20 6 29 20 10 6 12 2 4 NT NT 18 4 13 8 9 19 6 NT 8 NT NT 7 8 22 7 19 4 17 9 5 21 10 NT 9 NT 15 NT NT NT NT 5 12 NT 9 NT NT NT 25 NT 7 10 NT

N. Sengupta et al. / Infection, Genetics and Evolution 11 (2011) 64–77

41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60 61 62 63 64 65 66 67 68 69 70 71 72 73 74 75 76 77 78 79 80 81 82 83 84 85 86 87 88 89 90 91 92 93 94 95 96 97

67

68

Table 2 (Continued ) Isolate (accession no.)b

98 99 100 101 102 103 104 105 106 107 108 109 110 111 112 113 114 115 116 117 118 119 120 121

AL04-4 (FM877586) AL04-6 (FM865940) AL04-7 (FM877588) AL05-4 (FM865973) MU02-1 (FM865953) MU02-8 (FM875829) AL04-11 (FM877580) AL08-1 (FM875817) MU02-11 (FM875827) AL02-1 (FM865935) AL02-5 (FM865936) AL04-5 (FM877587) AL04-15 (FM875812) AL04-16 (FM875813) AL01-11 (FM865948) AL02-16 (FM875834) MU02-10 (FM875828) AL01-12 (FM875809) AL02-9 (FM865937) AL02-8 (FM875838) AL04-1 (FM865939) MU02-13 (FM865966) H2-11 (FM865924) H2-13 (FM865925)

a b c d e f g h

Sequence length (nt) 805 802 783 770 472 568 796 796 426 777 803 783 781 781 819 502 568 804 809 804 800 938 786 779

No. of identical isolatesc

Dilution of isolation

Nearest phylogenetic neighbord (accession number)

1 1 1 3 1 3 1 2 1 2 1 2 1 1 1 1 1 1 1 1 1 1 1 1

103 103 103 103 103 104 103 105 104 104 103 103 103 102 103 105 104 103 103 103 105 104 102 102

Clostridium Clostridium Clostridium Clostridium Clostridium Clostridium Clostridium Clostridium Clostridium Clostridium Clostridium Clostridium Clostridium Clostridium Clostridium Clostridium Clostridium Clostridium Clostridium Clostridium Clostridium Clostridium Clostridium Clostridium

subterminale (AB294137) subterminale (AB294137) subterminale (AB294137) lituseburense (M59107) lituseburense (AY458860) lituseburense (M59107) lituseburense (M59107) lituseburense (EU887828) butyricum (EU183474) butyricum (AF316590) butyricum (AF316590) butyricum (DQ831126) butyricum (AF316590) butyricum (AF316590) glycolicum (AJ291746) glycolinum (AJ318903) lundense (AY858804) tertium (Y18174) septicum (EF194080) tetanomorphum (DQ241819) botulinum (CP001078) barati (AY341242) barati (X68175) cochlearium (M59093)

Identity (%) 98 97 95 98 98 93 98 99 98 99 99 99 98 99 97 81 74 99 98 97 99 96 99 97

Class I integron (CS)e

Class I integron (int)f

Transposon Tn5397 (Tndx)g

Isolated on

Antibiotic resistanceh

                       

                       

                       +

SPS SPS SPS SPS SPS SPS AA SPS AA AA AA SPS AA AA AA SPS SPS AA AA SPS SPS AA AA AA

2 10 4 NT 24 8 19 NT NT NT NT NT 14 NT 29 NT 11 13 NT NT 9 5 NT 4

S. no. = serial number. The bold letters in strain designation indicate the sample source of isolation as reflected in Table 1. Number in parenthesis indicates EMBL accession number of corresponding 16S rRNA gene sequence. Number of isolates showing identical profile including the isolate described here. Only morphologically unique colonies were isolated and their total protein profiles compared on SDS-PAGE. For isolates, the nearest validly published taxon is shown. Number in parenthesis indicates accession number of corresponding 16S rRNA gene sequence. Presence of class I integron was screened by PCR using conserved primer sets (CS) targeting 50 and 30 -conserved regions as described in the methods. The int gene, a marker for the Tn916-like elements, was screened by PCR using primer couple INTf and INTr as described in the methods. Isolates were screened for tndX gene, characterizing the Tn5397-like elements, by PCR using primers tndx1 and tndx3 as described in the methods. Number of antibiotic the strain was found resistant for; NT = not tested.

N. Sengupta et al. / Infection, Genetics and Evolution 11 (2011) 64–77

S. no.a

N. Sengupta et al. / Infection, Genetics and Evolution 11 (2011) 64–77

+20 8C to +30 8C at the time of sampling except for the Himalayan soil H2 that was at +10 8C. 2.2. Physicochemical characteristics of soil Soil samples were used for measurement of pH (soil/water 1:5, w/v), water content (drying at 80 8C for 5 h), and volatile solid content (drying at 450 8C for 5 h) as per the standard protocols (APHA, 1985). 2.3. Isolation of bacteria Ten fold serial dilutions of the samples (1 g of soil to 9 ml of buffer on first dilution) in sterilized, anaerobically prepared normal saline and 0.1 ml of the samples were pour-plated on the SPS agar (Difco, France) and anaerobic agar (AA) (Difco, France). The inoculation was carried out in an anaerobic workstation (Don Whitley Scientific Ltd., Shipley, England) operating at 30 8C. The anaerobic gas mixture was composed of 85% N2, 10% H2 and 5% CO2. The plates were then transferred into anaerobic gas jar (Oxoid Ltd., England) containing palladium catalyst and a gas generation kit (Oxoid Ltd., England) as per manufacturer’s instructions. Sets of triplicate plates for each dilution were incubated at 37 8C and bacterial colonies were enumerated after 48 h of incubation. Black colonies from SPS agar plates were anaerobically transferred to 3 ml of thioglycollate broth (TGB) (Oxoid Ltd., England). Morphologically distinct colonies from anaerobic agar plates were also inoculated into TGB broth and incubated at 37 8C for further growth. The cultures were purified by re-plating and maintained at 4 8C in cooked meat medium (CMM) (Difco, France). All the media were procured either from Oxoid Ltd., England or Difco laboratories, France and prepared anaerobically by standard methods using gassing manifold and serum vials. Isolates were subjected to SDSPAGE for total cell protein profile by the method of Blackshear (1984). Representative strains were selected from those showing identical protein profiles and used for further studies. 2.4. Phenotypic characteristics and toxinotyping The phenotypic and biochemical characterization of the bacterial strains was carried out using standard methods as described earlier (Alam et al., 2006). Toxinotyping was carried out by polymerase chain reaction using specific primer sets for alpha (plc), beta (cpb and cpb2), epsilon (etx), iota (iA), and entero (cpe) toxins according to the method of Schoepe et al. (2001). Except for iA and cpb2 toxin genes, amplification was carried out with two independent primer sets for each toxin gene target. The primer sequences used for toxinotyping are listed in Table S1 along with their annealing temperatures and amplicon sizes. 2.5. 16S rRNA and beta 2 gene sequencing and phylogenetic analysis DNA was isolated according to the procedure of Marmur (1961) and the small subunit rRNA gene was amplified using the two primers 16S1 (50 -GAGTTTGATCCTGGCTCA-30 ) and 16S2 (50 CGGCTACCTTGTTACGACTT-30 ) corresponding to the nucleotide positions 9–27 and 1477–1498, respectively, on E. coli chromosome. The purified DNA product, approximately 1.5 Kb in length, was sequenced using five forward and one reverse primers as described earlier (Alam et al., 2006). On several occasions, sequencing was carried out using forward primer pB 50 -TAACACATGCAAGTCGAACG-30 (corresponding to the nucleotide position 50–70 of cpb gene) and partial sequences were obtained (Table 2). The nucleotide sequences have been submitted to the database of European Molecular Biology Laboratory (EMBL) at European

69

Bioinformatics Institute (www.ebi.ac.uk/embl) with accession numbers AM989994–AM990067. The deduced sequences were subjected to blast search for closest match in the database. Related sequences were retrieved from the database (http:// www.ncbi.nlm.nih.gov) and aligned by ClustalW software. The phylogenetic trees were reconstructed after truncating the sequences to the length of the shortest sequence in a given alignment data, by un-weighted pair group method with arithmetic mean (UPGMA) algorithm using tree construction software MEGA version 3.1 (Kumar et al., 2004). A length of six hundred nucleotides was used for phylogenetic reconstruction except for C. perfringens isolates (Fig. 1B) for which 1200 bases of 16S rRNA gene was used. The stability among clades of a phylogenetic tree was assessed by taking 1000 bootstrap replicates of the data set. Beta 2 (cpb2) toxin genes from C. perfringens strains were PCR amplified using cpb2-F (50 -AGATTTTAAATATGATCCTAACC-30 ) and cpb2-R (50 -CAATACCCTTCACCAAATACTC-30 ) primers as reported earlier (Gibert et al., 1997). The amplicons (650 bp) were purified by gel extraction using a commercial kit (Qiagen, Germany) as per manufacturer’s instructions. Double pass sequencing of the purified product was carried out employing automated sequencer (ABI PRISM, Model 3730, USA) using cpb2-F and cpb2-R primers. The obtained sequences of the toxin gene fragments were aligned with closely related sequences in the database by ClustalW at EMBL site. The pair-wise evolutionary distances were computed and phylogenetic tree was constructed using tree construction software MEGA version 3.1 as described above. The nucleotide sequences cpb2 genes have been submitted to the EMBL database with accession numbers FR687302–FR687310. The frequencies of 16S rRNA gene phylotypes determined by sequence comparison (i.e. those sharing >97% identity) were used for analysis of diversity. Shannon’s index for diversity (H0 ) was calculated according to the method of Zar (1984). 2.6. Antibiotic susceptibility test Antibiotic susceptibility test was carried out by a modified protocol of ‘broth-disk susceptibility determination’ (Wilkins and Thiel, 1973). Antibiotic discs of 3 mm radius (Hi-Media, India) were aseptically cut into four equal parts with the help of a sterile scalpel and each quarter of it was added to four adjacent flat-bottom wells of 96-well microtitre plate (Nunc, USA). Susceptibility was tested against 30 antibiotics for 72 isolates, as reflected in Table 2 and supplementary Fig. S2. Cells were grown in tryptose–peptone– yeast extract–glucose (TPYG) broth containing pancreatic digest of casein, 50 g; peptone, 5 g; yeast extract, 20 g; glucose, 4 g; sodium thioglycollate, 1 g; cycloserine, 250 mg; sulphamethoxazole, 76 mg; trimethoprim, 4 mg; and distilled water 1000 ml. After growth at 37 8C until late exponential phase, cultures were inoculated into 20 ml of TPYG broth (3% inoculum) as described above. Two hundred microlitres of this inoculated broth was dispensed in replicate wells (n = 4) of microtitre plate to which quarter antibiotic discs were previously added. Replicates of control wells for each culture did not receive antibiotic discs. The culture was immediately overlaid with sterile paraffin oil. This way, a given strain of anaerobic bacteria was inoculated in replicates to screen for susceptibility against 21 antibiotics on a single microtitre plate. Inoculated microtitre plates were incubated in an anaerobic workstation at 37 8C for 12 h following which cultures were transferred to respective wells of a fresh microtitre plate (without antibiotic discs) using a 12-channel micro-pipetting device. Growth was determined by observing optical density at 600 nm and mean of the replicates was used for calculating percent inhibition of growth with respect to control. Susceptibility to the test antibiotic was defined as either absence of turbidity or more

[()TD$FIG]

70

N. Sengupta et al. / Infection, Genetics and Evolution 11 (2011) 64–77

Fig. 1. UPGMA trees showing phylogenetic relationship between anaerobic isolates from environmental samples belonging to (A) the genus Clostridium, (B) C. perfringens (C) C. bifermentans, and (D) C. sordellii. 16S rRNA gene sequences of other related microorganisms from diverse ecological niches are also included in the phylogenetic reconstruction. Bootstrap values of are given at the nods.

[()TD$FIG]

N. Sengupta et al. / Infection, Genetics and Evolution 11 (2011) 64–77

71

Fig. 1. (Continued).

than 75% reduction of turbidity (OD600 nm with respect to control) with respect to control culture. Cultures showing 25 to 75% reduction of turbidity were considered moderately susceptible whereas those showing less than 25% reduction of turbidity were considered resistant. Vancomycin, Neomycin, Amikacin, Cefepime, Tetracycline, Kanamycin, Chloramphenicol, Cephalexin, Nitroxoline, Roxithromycin, Spiramycin, Cefadroxil, Cefaclor, Cefamandole, Cephalothin, and Cefotaxime were used at a calculated test concentration of 7.5 mg per ml. Whereas, 2.5 mg/ml of Ampicillin, Streptomycin, Cephaloridine, and Bacitracin; 1.25 mg/ml of

Trimethoprim and Methicillin; 75 units/ml of Polymyxin B; 25 mg/ml of Nitrofurazone; 3.75 mg/ml Virginamycin and Azithromycin; 50 mg/ml of Sulfaphenazole; 18.75 mg/ml Azlocillin; 2.5 units/ml of Penicillin G; 0.25 mg/ml of Oxacillin were used for susceptibility determination against selected anaerobic bacterial strains. 2.7. Screening for integron and transposable element All the isolates were screened for the presence of class 1 integron, targeting 50 and 30 -conserved regions using primer pair

[()TD$FIG]

72

N. Sengupta et al. / Infection, Genetics and Evolution 11 (2011) 64–77

Fig. 1. (Continued).

50 CS (50 GGCATCCAAGCAGCAAGC 30 ) and 30 CS (50 AAGCAGACTTGACCTGAT 30 ) as per the conditions described by Conza et al. (2002). The int gene, was detected using the primer couple INTf (50 GACTGGA-GAGAGCCAACGAA 30 ) and INTr (50 CATCATGCCGTTGTAATCAC 30 ) (Gherardi et al., 2003). The tndX gene,

was detected using primers tndx1 (50 TACATTGTTAAAACAGCAAGC 30 ), and tndx3 (50 TATCAATGAG ACACTGC-TA 30 ) (Spigaglia et al., 2005). Specificity of PCR amplification was verified by single pass DNA sequencing using forward primers as described above.

[()TD$FIG]

N. Sengupta et al. / Infection, Genetics and Evolution 11 (2011) 64–77

Fig. 1. (Continued).

3. Results 3.1. Bacterial counts Soil samples were collected in the month of March from various locations of planar India varying in altitude from 268140 N to 278300 N and 788050 E to 798400 E and included three districts in two adjoining states of northern India. The sampling was largely done near waste dumping sites of butcheries or near a sewage canal. The samples were of diverse nature varying in texture, water content, porosity, and volatile solid (Table 1). In addition, one soil sample was also collected from the pristine environment of Himalayas (H2) for subsequent comparison of microbial community. Viable counts of anaerobic bacteria (cfu/g) on anaerobic agar and SPS agar ranged from 1.0  102 cfu/g to 8.8  107 cfu/g and nil to 3.9  106 cfu/g, respectively (Table 1). The abundance of microbes on most occasions correlated with the moisture content of the soil; dry soils supported lower bacterial loads. 3.2. Diversity and phylogenetic analysis of anaerobic bacteria in different soil samples In the environmental samples, 95.9% of cultured anaerobes belonged to Firmicutes and 4.1% were classified to gammaProteobacteria (Table 2). Of the five genera observed, most

73

belonged to the genus Clostridium (79.34%) followed by Staphylococcus (9.09%), Bacillus (7.44%), Escherichia (2.48%), and Enterobacter (1.65%). Based on their closest match in the database using partial 16S rRNA gene sequence, the strains belonged to 20 different species with genus Clostridium (14 species) showing maximum diversity. Among clostrdial species, C. bifermentans (35.9%) was the most dominant in the samples screened here, followed by C. perfringens (25.8%). All the C. perfringens isolates were found to be of type A and did not show amplification of any of the other four toxin genes except alpha toxin (plc). Twenty eight cultured phylotypes shared <97% 16S rRNA gene sequence identity with previously described bacteria and can be considered divergent strains of the species; a new species status is difficult to propose here as the length of gene sequence used for the analysis is small. Identification of isolates was further supplemented by phenotypic characteristics and diagnostic biochemical tests (data not shown). Although SPS agar is recommended for isolation and enumeration of C. perfringens, our results indicate that the medium is not specific for selective isolation of this organism, at least for soil samples rich in organic content. Of the 39 strains isolated from SPS agar plate, 48.7% were identified as C. bifermentans and 25.6% were C. sordellii, C. perfringens being represented by merely 33.3% of the SPS-isolated anaerobic bacteria showing characteristic black colonies. Maximum diversity was observed in samples MU02 (Shannon’s index 2.17  0.0037) followed by MU01 (Shannon’s index 1.85  0.0042), AL04 (Shannon’s index 1.73  0.0013), and AG02 (Shannon’s index 1.56  0.0034) (Table 3). Except for AL04, a moist clay sample from a butchery waste dumping site, all the above samples with high Shannon’s diversity index belonged to sewage soil. Notably, no clostridial species was isolated from AG01, AG05, and AG06 on either of the media used and the bacterial population was solely composed of species of Staphylococcus, Bacillus, and Enterobacter, respectively. Staphylococcus species were also isolated from AG03 (75%), AG02 (40%), AL08 (11%), and MU02 (10%) while Bacillus species were observed in MU02 (30%), AG07 (27%), MU01 (18%), and AG02 (10%). Sorensen similarity index (QS) indicated that the composition of anaerobic bacterial species in different soil and sewage samples were largely distinct and a correlation with niche type, organic matter, or moisture content was not seen (Table S2). The UPGMA tree using partial 16S rRNA gene sequences of clostridial environmental isolates along with their closely related species has been shown Fig. 1A, while clades belonging to C.

Table 3 Phylogenetic distribution of 16S rRNA gene sequences from isolates recovered from various environmental samples from planar India. Relative distribution of taxa is reflected as percentage from the total number of isolates for the given sample. One or more of isolates showing identical SDS-PAGE whole cell protein profile were selected. Sample no.

Sample name

Site of sampling

Clostridium

Staphylococcus

Bacillus

Enterobacter

Escherichia

Number of 16S phylotypesa

Shannon index  variance

1. 2. 3. 4. 5. 6. 7. 8. 9. 10. 11. 12. 13. 14. 15. 16. 17.

AG01 AG02 AG03 AG04 AG05 AG06 AG07 MU01 MU02 AL01 AL02 AL03 AL04 AL05 AL06 AL08 H2

Agra Agra Agra Agra Agra Agra Agra Morena Morena Aligarh Aligarh Aligarh Aligarh Aligarh Aligarh Aligarh Siachen

0.0 50.0 25.0 100 0.0 0.0 72.7 54.5 60.0 100 100 100 100 100 100 88.9 100

100 40.0 75.0 0.0 0.0 0.0 0.0 0.0 10.0 0.0 0.0 0.0 0.0 0.0 0.0 11.1 0.0

0.0 10.0 0.0 0.0 100 0.0 27.3 18.2 30.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0

0.0 0.0 0.0 0.0 0.0 100 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0

0.0 0.0 0.0 0.0 0.0 0.0 0.0 27.3 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0 0.0

1 6 4 5 1 1 5 8 10 4 6 5 7 6 1 4 4

0.0 1.56  0.0034 1.32  0.0030 1.15  0.0021 0.0 0.0 1.27  0.0012 1.85  0.0042 2.17  0.0037 1.38  0.0009 1.62  0.0023 1.12  0.0018 1.73  0.0013 1.37  0.0014 0.0 1.16  0.0018 1.14  0.0016

a

The 16S rRNA gene phylotype refers to group of isolates from a sample sharing >97% sequence identity.

74

N. Sengupta et al. / Infection, Genetics and Evolution 11 (2011) 64–77

perfringens (Fig. 1B), C. bifermentans (Fig. 1C), and C. sordellii (Fig. 1D) have been shown independently. The isolates exhibited specific phylogenetic affinities among themselves which have been niche specific on most occasions (Fig. 1A). However, the clades of these environmental strains exhibited discrete phylogenetic position when compared with related reference strains. For instance, in the cluster occupied by Clostridium schirmacherense, Clostridium argentinense, and Clostridium subterminale the environmental isolates formed two distinct clades largely originating from samples AL03 and AL04. Similarly, C. perfringens isolates reported here exhibited phylogenetic diversity and either formed independent clades or clustered with related strains from similar environmental niches (Fig. 1B). Phylogenetic affiliations of C. bifermentans and C. sordellii have been heterogeneous with isolates occupying clades of almost all lineages of known reference strains in the corresponding trees (Fig. 1C and D). 3.3. Phylogenetic analysis of beta2-toxin (cpb2) gene

[()TD$FIG]

Beta2 toxin gene (cpb2) fragment corresponding to position 225– 791 of the complete CDS in C. perfringens strain 13, was amplified by PCR and sequenced using corresponding forward and reverse primers as discussed in Section 2.5. The sequences obtained from the C. perfringens isolates AG07-6, AG07-3, AG07-9, AL05-16, AG03-4, and AG02-3 exhibited 98.7%, 99.2%, 99.5%, 99.6%, 99.8%, and 99.8% identity with that of reference strain C. perfringens strain 13. Isolates AG07-4 and AL05-12 did not show any difference in the nucleotide sequence of cpb2 gene with respect to strain 13. Notably, the Himalayan isolate H2-3 harbored atypical cpb2 gene sequence showing 74.6% sequence identity with the typical gene sequence from strain 13, although it was closely related to atypical sequences reported in other C. perfringens strains. In a phylogenetic reconstruction using cpb2 gene fragments from related strains, most of the environmental isolates formed tight clusters shared by sequences from strains of non-porcine origin (Fig. 2). Among these, isolates AG07-9, AL05-16, AG03-4, and AL05-12 were closely related and exhibited specific phylogenetic affiliation with a strain isolated from an elephant and another from a wastewater treatment plant. As expected, the Himalayan isolate H2-3 formed a distinct clade and

clustered tightly with atypical cpb2 sequence from C. perfringens str. JGS1902. 3.4. Prevalence of antibiotic resistance Prevalence of antibiotic resistance among environmental anaerobic bacterial strains has been summarized in Table 2 and supplementary Figs. S1 and S2. The results clearly indicate multidrug resistance phenotype to dominate among bacterial isolates. Antibiotic susceptibility test using a modified protocol of ‘brothdisk susceptibility determination’ revealed resistance from 16 to 25 antibiotics for 35% of the strains tested. Approximately 45% of the isolates tested were found to exhibit resistance from 6 to 15 antibiotics. Prevalence of antibiotic resistance did not show correlation with any specific geographical region or environmental niche (Fig. S1). Curiously, resistance to multiple antibiotics was more common among C. perfringens isolates when compared with other clostridial species, although such a conclusion is difficult to draw for some other species represented only by 2 or 3 isolates in the dataset (Fig. S2). Resistance to vancomycin was least prevalent (only 24% of the isolates were resistant) while resistance to neomycin, amikacin, streptomycin, trimethoprim, kanamycin, nitrofurazone, sulfaphenazole, and methicillin was most common (resistance in >55% of isolates). Ampicillin, chloramphenicol, cephaloridine, cephalexin, roxithromycin, cefadroxil, azlocillin, bacitracin, and cefotaxime were by and large active against environmental anaerobic bacteria and resistance was seen in 40– 50% of isolates. Notably, 7 out of 9 of the aforesaid antibiotics are known to inhibit bacterial growth by blocking cell wall synthesis. None of the Gram-positive isolates were found to possess class 1 integron when 50 and 3’-conserved regions were targeted using conserved primer sets (CS), though amplification of 230 bp fragment was seen in all the four Gram-negative strains tested (Table 1). The int gene, a marker for the Tn916-like elements, was detected in one isolate each of C. subterminale and Staphylococcus epidermidis, apart from four Gram-negative isolates. The tndX gene, characterizing the Tn5397-like elements, was detected only in an E. coli and a C. cochlearium isolate.

Fig. 2. UPGMA phenogram showing phylogenetic relationship between cpb2 gene fragments of Clostridium perfringens isolates and reported sequences of typical and atypical cpb2 genes of diverse origin. Bootstrap values are given at the nodes.

N. Sengupta et al. / Infection, Genetics and Evolution 11 (2011) 64–77

4. Discussion 4.1. Diversity of anaerobes and phylogenetic analysis In the present study, we detected fourteen separate species of Clostridium (e.g. C. bifermentans, C. perfringens and C. sordellii were the most prevalent) in addition to facultative anaerobic species of Staphylococcus (2), Bacillus (2), Enterobacter (1), and Escherichia (1). The dominance of C. bifermentans on SPS agar which is recommended by other investigators for enumeration of C. perfringens warrants reconsideration for use with environmental samples. Very few reports have been published on the prevalence of clostridial species in soil. The diversity of clostridia in Costa Rican soils and its possible association with geographic zone, pH or type of soil was studied in 117 soil samples by del Mar Gamboa et al. (2005). The authors reported a total of 1945 strains of clostridia and the most frequent species were shown to be C. subterminale (56%), Clostridium oceanicum (51%), C. bifermentans and Clostridium glycolicum (50%, each), Clostridium sporogenes (49%), and C. sordellii (42%). Although the clostridial species identified by the authors were common with our findings, the relative abundance of individual species was markedly different. The Shanon’s index of diversity (Table 3) and Sorensen similarity indices (Table S2) for different samples indicate that clostridia are adapted to grow in diverse soil conditions. High abundance of C. bifermentans in soil samples described here needs attention with respect to their role in dissemination of diseases. Quantitative comparison of the microbiota of the gastrointestinal tract of healthy horses with that of horses with equine grass sickness (EGS) was carried out by Garrett et al. (2002). The authors reported differences in clostridia isolated between health and disease: fourteen species were isolated from EGS cases, compared to only one (C. bifermentans) in controls. In another study of 73 patients suffering with clostridial bacteremia, C. perfringens (77%) and C. bifermentans (9%) were found to be the most common etiological organisms (Chen et al., 2001). Further, the strains of C. bifermentans also have been shown to exhibit adaptability in the extreme environments and all the three Clostridium strains isolated from deep-sea sediments collected at a depth of 6.3–7.3 km in the Japan Trench were identified as C. bifermentans (Lauro et al., 2004). C. perfringens was the second most predominant species among all the anaerobic isolates identified from the samples described here. The epidemiological relationship between C. perfringens isolates has previously been investigated primarily by pulsed-field gel electrophoresis (PFGE) and in most of these studies a majority of isolates from food poisoning outbreaks were examined (Lin and Labbe, 2003; Nakamura et al., 2003). C. perfringens isolates originating from poultry also have been investigated previously by PFGE (Nauerby et al., 2003; Gholamiandekhordi et al., 2006). The general conclusion drawn from the previous work, concerning both food poisoning outbreaks and animals, is that isolates from the same outbreak have very similar patterns whereas the genetic diversity is high in nonoutbreak isolates and in isolates selected randomly. Simmon et al. (2008) studied the genotypic diversity of anaerobic isolates from bloodstream infections using 16S rRNA gene sequencing and 35% of the isolates were identified as C. perfringens in the anaerobic bacteremia cases at a large tertiary care hospital. The phylogenetic analysis of anaerobes isolated in the present investigation has revealed wide genetic diversity among soil isolates. Our results further indicate that C. perfringens is a highly ubiquitous clostridial species and that isolates from diverse niches may share the same phylogenetic clades (Fig. 1B). It is interesting to note that many C. bifermentans isolates from our study exhibited close phylogenetic affiliation with those previously isolated from

75

potato crop soil and slaughter house waste (Fig. 1C). The isolates of C. sordellii were genetically diverse as revealed in the 16S rRNA gene tree and also there appeared to be some geographical correlation in clustering pattern with isolates from Hiamalayas and Morena forming more or less independent clades. 4.2. Phylogenetic analysis of beta2 toxin There are only a few reports of prevalence and phylogenetic analysis of beta2-toxin among soil and sewage isolates of C. perfringens. A strong correlation has been demonstrated previously, between the prevalence of cpb2 in isolates from piglets with enteritis and the absence of cpb2 in isolates from healthy piglets (Bueschel et al., 2002). However, two recently published studies, by Jost et al. (2005) and Vilei et al. (2005), demonstrated that beta2 toxin encoded by cpb2, was expressed by most porcine C. perfringens isolates, but seldom by isolates of non-porcine origin. Curiously, Vilei et al. (2005) reported that gentamicin and streptomycin induced expression of an atypical cpb2 gene in a non-porcine isolate. The distribution of cpb2 in isolates described here was low and the toxin gene was detected only in 8 out of 23 C. perfringens isolates screened. This is in agreement with the previous report by Johansson et al. (2006) where 4 out of 14 isolates from wastewater treatment plant were found to harbor the cpb2 gene, however the proportion was significantly higher for isolates from pig and horses. The high prevalence of the cpb2 gene in isolates from pigs and horses has also been shown in other studies especially in animals suffering from gastrointestinal diseases (Waters et al., 2003). Isolates originating from humans with gastrointestinal diseases carrying both cpb2 and cpe have recently been described (Fisher et al., 2005). Further, in the phylogenetic reconstruction, the sequences reported here delineated from those reported for isolates from pig and horses. In a detailed phylogenetic analysis of cpb2 genes from diverse origin, Johansson et al. (2006) divided them into two evolutionary differing populations, I and II. The authors further divided group I sequences into three sub-clusters: porcine isolates (Ia), animal isolates of non-porcine origin (Ib), and isolates from food poisoning outbreaks (Ic). Except for the Himalayan isolate H2-3 that exhibited a high sequence difference (25.4%) with the others and belonged to group II, all other sequences reported in this study belonged to group I and sub-cluster Ib (Fig. 2). 4.3. Prevalence of antibiotic resistance Disk diffusion methods for testing the antibiotic susceptibility of anaerobic bacteria have been described; however, these tests are not suitable for oxygen-sensitive, anaerobic isolates. A modification of the broth-disk method of Wilkins and Thiel (1973) allowed us to determine antibiotic susceptibility in a completely anaerobic environment. Most of the studies pertaining to antibiotic resistance profile of pathogenic microbes are directed towards clinical isolates and there are very few such reports for environmental strains of bacteria. The present study demonstrated that environmental anaerobic isolates were resistant to antimicrobial agents commonly used as feed additives (e.g. tetracycline, streptomycin, and sulfonamides) or therapeutics (e.g. penicillins, cephalosporins, trimethoprim, and tetracyclines) (Phillips et al., 2004; Kim et al., 2005). Resistance to antimicrobial agents among C. perfringens isolates was higher than the dominant species of C. bifermentans. Interestingly, resistance for antibiotics that block protein synthesis was more prevalent than those inhibiting bacteria by interfering with their cell wall synthesis.

76

N. Sengupta et al. / Infection, Genetics and Evolution 11 (2011) 64–77

The environmental anaerobic bacterial strains were shown in the present study to exhibit multi-resistance phenotype, hence may act as a potential reservoir for antimicrobial resistance genes and arguably play an important role in the ecology of antimicrobial resistance of bacterial populations. Genes and proteins responsible for resistance in environmental bacteria are shown to be homologous to those found circulating in pathogens, strongly suggesting contemporary horizontal gene transfer (Wright, 2010). It will be highly speculative to correlate the prevalence of antimicrobial resistance in these environmental isolates with the use of antibiotics. However, most of the niches sampled in the present investigation were from densely populated areas and contaminated with animal remains (e.g. butchery samples) increasing the likelihood of their animal origin. Class 1 integron was observed in all the four Gram-negative strains (Enterobacter and Escherichia spp.) tested but none of the Gram-positive isolates were found positive for the same (Table 1). There are at least 90 distinct integron classes reported, mostly located on chromosomes, and about 10% of sequenced bacterial genomes carry these elements (Boucher et al., 2007). There is experimental evidence (Rowe-Magnus et al., 2002) that the antibiotic resistance genes found in class 1, 2, and 3 integrons were acquired by capturing gene cassettes from the vast pool of diverse cassettes that are prevalent in microbial communities (Boucher et al., 2007; Stokes et al., 2001). Further clues to the origin of clinical class 1 integrons emerged recently, when two class 1 integrons were discovered in environmental bacteria isolated from sediment samples. Experimental evidences suggest that ancestor of clinical class 1 integron was more like a typical chromosomal integron and that it was from an environment that intersects the human food chain (Stokes et al., 2006; Gillings et al., 2008). It has been shown that diverse class 1 integrase genes can be routinely recovered from groundwater or lake sediment and that the chromosomes of various Betaproteobacteria contain class 1 integrons (Gillings et al., 2008). Conjugation is a common mechanism by which both Grampositive and Gram-negative microorganisms exchange their genetic material. Conjugative transposons are genetic elements that encode their own transfer from the genome of a donor cell to the genome of a recipient cell. These elements are remarkably promiscuous and are capable of being transferred across large phylogenetic distances (Lanka and Wilkins, 1995). For instance, the conjugative streptococcal transposon Tn916 was found to transfer naturally between a variety of Gram-positive and Gram-negative eubacteria. We observed int gene, a marker for the Tn916-like elements, in 4 out 5 isolates of Enterobacter and Escherichia, in addition to one isolate each of C. subterminale and S. epidermidis. However, tndX gene, characterizing the Tn5397-like elements, was detected only in an E. coli and a C. cochlearium isolate. Tn5397 is a conjugative transposon that was originally isolated from Clostridium difficile (Mullany et al., 1996). It has been shown that the central region of Tn5397 was closely related to the conjugative transposon Tn916, originally isolated from the chromosome of Enterococcus faecalis DS16 (Franke and Clewell, 1981). Curiously, C. perfringens has been shown to harbor a 6.3 kb transposon, Tn4451 that undergoes precise, conjugative excision from pIP401 in C. perfringens and precise high-frequency excision from multicopy plasmids in both C. perfringens and E. coli (Abraham and Rood, 1987). Crellin and Rood (1998) demonstrated that the Tn4451encoded protein, TnpZ can promote RP4 mediated plasmid transfer from an E. coli donor to a C. perfringens recipient. E. coli isolates from clinical specimens have been shown to be resistant to multiple antimicrobial agents (Yu et al., 2004) and a substantial proportion of multi-resistant E. coli isolates carry integrons (Goldstein et al., 2001).

5. Conclusion The present investigation describes the major anaerobic bacterial population of soil and sewage from densely populated, planar regions of India. Our results further indicate that Gramnegative bacteria are the major reservoir of integrons and transposons screened here, but they do not seem to be responsible for the spread of multi-resistance phenotype among Gram-positive bacteria. It warrants further investigation to elucidate the mechanism of dissemination of antibiotic resistance genes in the environmental clostridial population. Acknowledgments We thank Dr. R. Vijayaraghavan, Director, DRDE, Gwalior, for providing all the facilities and support required for this study. The work has been funded by Defence Research and Development Organization, Government of India.

Appendix A. Supplementary data Supplementary data associated with this article can be found, in the online version, at doi:10.1016/j.meegid.2010.10.009. References Abraham, L.J., Rood, J.I., 1987. Identification of Tn 4451 and Tn4452 chloramphenicol resistance transposons from Clostridium perfringens. J. Bacteriol. 169, 1579– 1584. Alam, S.I., Dixit, A., Dube, S., Reddy, G.S.N., Palit, M., Shivaji, S., Singh, L., 2006. Clostridium schirmacheriensis sp. nov., an obligately anaerobic, proteolytic, psychrophilic bacterium isolated from lake sediments of Schirmacher Oasis, Antarctica. Int. J. Syst. Evol. Microbiol. 56, 721–725. APHA, 1985. Standard Methods for the Examination of Water and Waste Water, 16th edn. American Public Health Association, Washington, DC, ISBN 087553131-8. Asano, T.A., Levine, D., 1998. Wastewater reclamation, recycling, and reuse: an introduction. In: Asano, T. (Ed.), Wastewater Reclamation and Reuse, vol. 10. CRC Press, Boca Raton, pp. 1–56. Atlas, R., Rubin, C., Maloy, S., Daszak, P., Colwell, R., Hyde, B., 2010. One healthattaining optimal health for people, animals, and the environment. Microbe 5, 383–389. Bacciarini, L.N., Boerlin, P., Straub, R., Frey, J., Gro¨ne, A., 2003. Immuno-histochemical localization of the Clostridium perfringens 2-toxin in the gastrointestinal tract of horses. Vet. Pathol. 40, 376–381. Blackshear, P.J., 1984. Systems for polyacrylamide gel electrophoresis. In: Jaeoby, W.B. (Ed.), Methods in Enzymology, vol. 104. Academic Press, New York, pp. 237–255. Boucher, Y., Labbate, M., Koenig, J., Stokes, H., 2007. Integrons: mobilizable platforms that promote genetic diversity in bacteria. Trends Microbiol. 15, 301– 309. Brook, I., 2010. The role of anaerobic bacteria in bacteremia. Anaerobe 16, 183–189. Bueschel, D.M., Jost, B.H., Billington, S.J., Trinh, H.T., Songer, J.G., 2002. Prevalence of cbp2, encoding beta2 toxin, in Clostridium perfringens field isolates: correlation of genotype with phenotype. Vet. Microbiol. 94, 121–129. Chen, Y.M., Lee, H.C., Chang, C.M., Chuang, Y.C., Ko, W.C., 2001. Clostridium bacteremia: emphasis on the poor prognosis in cirrhotic patients. J. Microbiol. Immunol. Infect. 34 (2), 113–118. Conza, J.D., Ayala, J.A., Power, P., Mollerach, M., Gutkind, G., 2002. Novel Class 1 Integron (InS21) Carrying blaCTX-M-2 in Salmonella enterica Serovar Infantis. Antimicrob. Agents Chemother. 46 (7), 2257–2261. Crellin, P.K., Rood, J.I., 1998. Tn4451 from Clostridium perfringens is a mobilizable transposon that encodes the functional Mob protein, TnpZ. Mol. Microbiol. 27, 631–642. del Mar Gamboa, M., Rodrı´guez, E., Vargas, P., 2005. Diversity of mesophilic clostridia in Costa Rican soils. Anaerobe 11 (6), 322–326. Franke, A.E., Clewell, D.B., 1981. Evidence for a chromosome-borne resistance transposon (Tn916) in Streptococcus faecalis that is capable of ‘‘conjugal’’ transfer in the absence of a conjugative plasmid. J. Bacteriol. 145, 494–502. Fisher, D.J., Miyamoto, K., Harrison, B., Akimoto, S., Sarker, M.R., McClane, B.A., 2005. Association of beta2 toxin production with Clostridium perfringens type A human gastrointestinal disease isolates carrying a plasmid enterotoxin gene. Mol. Microbiol. 56, 747–762. Garrett, L.A., Brown, R., Poxton, I.R., 2002. A comparative study of the intestinal microbiota of healthy horses and those suffering from equine grass sickness. Vet. Microbiol. 87 (1), 81–88. Gherardi, G., Del Grosso, M., Scotto D’Abusco, A., D’Ambrosio, F., Dicuonzo, G., Pantosti, A., 2003. Phenotypic and genotypic characterization of two penicillin-

N. Sengupta et al. / Infection, Genetics and Evolution 11 (2011) 64–77 susceptible serotype 6B Streptococcus pneumoniae clones circulating in Italy. J. Clin. Microbiol. 41, 2855–2861. Gholamiandekhordi, A.R., Ducatelle, R., Heyndrickx, M., Haesebrouck, F., Van Immerseel, F., 2006. Molecular and phenotypical characterization of Clostridium perfringens isolates from poultry flocks with different disease status. Vet. Microbiol. 113, 143–152. Gibert, M., Jolivet-Reynaud, C., Popoff, M.R., 1997. Beta2 toxin, a novel toxin produced by Clostridium perfringens. Gene 203, 65–73. Gillings, M., Boucher, Y., Labbate, M., Holmes, A., Krishnan, S., Holley, M., Stokes, H.W., 2008. The evolution of class 1 integrons and the rise of antibiotic resistance. J. Bacteriol. 190, 5095–5100. Goldstein, C., Lee, M.D., Sanchez, S., Hudson, C., Phillips, B., Register, B., Grady, M., Liebert, C., Summers, A.O., White, D.G., Maurer, J.J., 2001. Incidence of class 1 and 2 integrase in clinical and commensal bacteria from livestock, companion, animals, and exotics. Antimicrob. Agents Chemother. 45, 723–726. Homsi, J., 2000. The present state of sewage treatment. International report. Water Supply 18, 325–327. Jay, M.T., Cooley, M., Carychao, D., Wiscomb, G.W., Sweitzer, R.A., Crawford-Miksza, L., Farrar, J.A., Lau, D.K., O’Connell, J., Millington, A., Asmundson, R.V., Atwill, E.R., Mandrell, R.E., 2007. Escherichia coli O157:H7 in feral swine near spinach fields and cattle, central California coast. Emerg. Infect. Dis. 13, 1908–1911. Johansson, A., Aspan, A., Bagge, E., Ba˚verud, V., Engstro¨m, B.E., Johansson, K.E., 2006. Genetic diversity of Clostridium perfringens type A isolates from animals, food poisoning outbreaks and sludge. BMC Microbiol. 6, 47. Jost, B.H., Billington, S.J., Trinh, H.T., Bueschel, D.M., Songer, J.G., 2005. Atypical cpb2 genes, encoding beta2-toxin in Clostridium perfringens isolates of nonporcine origin. Infect. Immun. 73, 652–656. Kim, L.M., Gray, J.T., Harmon, B.G., Jones, R.D., Fedorka-Cray, P.J., 2005. Susceptibility of Escherichia coli from growing piglets receiving antimicrobial feed additives. Food Borne Path. Dis. 2 (4), 304–316. Kumar, S., Tamura, K., Nei, M., 2004. MEGA3: integrated software for molecular evolutionary genetics analysis and sequence alignment. Brief Bioinform. 5, 150–163. Lanka, E., Wilkins, B.M., 1995. DNA processing reactions in bacterial conjugation. Annu. Rev. Biochem. 64, 141–169. Lauro, F.M., Bertoloni, G., Obraztsova, A., Kato, C., Tebo, B.M., Bartlett, D.H., 2004. Pressure effects on Clostridium strains isolated from a cold deep-sea environment. Extremophiles 8 (2), 169–173. Lin, Y.T., Labbe, R., 2003. Enterotoxigenicity and genetic relatedness of Clostridium perfringens isolates from retail foods in the United States. Appl. Environ. Microbiol. 69, 1642–1646. Marmur, J., 1961. Procedure for the isolation of deoxyribonucleic acid from microorganisms. J. Mol. Biol. 3, 208–218. Mullany, P., Pallen, M., Wilks, M., Tabaqchali, S., 1996. A group II introns in a conjugative transposon from the Gram-positive bacterium, Clostridium difficile. Gene 174, 145–150. Nakamura, H., Ogasawara, J., Monma, C., Hase, A., Suzuki, H., Kai, A., Haruki, K., Nishikawa, Y., 2003. Usefulness of a combination of pulsed-field gel electrophoresis and enrichment culture in laboratory investigation of a foodborne outbreak due to Clostridium perfringens. Diagn. Microbiol. Infect. Dis. 47, 471– 475. Nauerby, B., Pedersen, K., Madsen, M., 2003. Analysis by pulsed-field gel electrophoresis of the genetic diversity among Clostridium perfringens isolates from chickens. Vet. Microbiol. 94, 257–266. Phillips, I., Casewell, M., Cox, T., Groot, B.D., Friis, C., Jones, R., Nightingale, C., Preston, R., Waddell, J., 2004. Does the use of antibiotics in food animals pose a

77

risk to human health? A critical review of published data. J. Antimicrob. Chemother. 53, 28–52. Recchia, G.D., Hall, R.M., 1995. Gene cassettes—a new class of mobile element. Microbiology 141, 3015–3027. Rodriguez, A., Pangloli, P., Richards, H.A., Mount, J.R., Draughon, F.A., 2006. Prevalence of Salmonella in diverse environmental farm samples. J. Food. Prot. 69, 2576–2580. Rood, I.R., Cole, S.T., 1991. Molecular genetics and pathogenesis of Clostridium perfringens. Microbiol. Rev. 55, 621–648. Rowe-Magnus, D., Guerot, A.M., Mazel, D., 2002. Bacterial resistance evolution by recruitment of super-integron gene cassettes. Mol. Microbiol. 43, 1657– 1669. Schoepe, H., Pache, C., Neubauer, A., Potschka, H., Schlapp, T., Wieler, L.H., Baljer, G., 2001. Naturally occuring Clostridium perfringens nontoxic alpha-toxin variant as a potential vaccine candidate against alpha-toxin-associated diseases. Infect. Immun. 69 (11), 7194–7196. Scott, C.A., Faruqui, N.I., Raschid-Sally, L., 2004. Wastewater use in irrigated agriculture: confronting the livelihood and environmental realities. www.idrc.ca/en/ev-31595-201-1-DO_TOPIC.html. Simmon, K.E., Mirrett, S., Reller, L.B., Petti, C.A., 2008. Genotypic diversity of anaerobic isolates from bloodstream infections. J. Clin. Microbiol. 46 (5), 1596–1601. Songer, J.G., 1996. Clostridial enteric diseases of domestic animals. Clin. Microbiol. Rev. 9, 216–234. Songer, J.G., 2010. Clostridia as agents of zoonotic disease. Vet. Microbiol. 140, 399– 404. Spigaglia, P., Carucci, V., Barbanti, F., Mastrantonio, P., 2005. ErmB determinants and Tn916-like elements in clinical isolates of Clostridium difficile. Antimicrob. Agents Chemother. 49 (6), 2550–2553. Stephenson, K., Lewis, R.J., 2005. Molecular insights into the initiation of sporulation in Gram-positive bacteria: new technologies for an old phenomenon. FEMS Microbiol. Rev. 29 (2), 281–301. Stokes, H., Holmes, A., Nield, B., Holley, M., Nevalainen, K., Mabbutt, B., Gillings, M., 2001. Gene cassette PCR: sequence independent recovery of entire genes from environmental DNA. Appl. Environ. Microbiol. 67, 5240–5246. Stokes, H., Nesbø, C., Holley, H., Bahl, M., Gillings, M., Boucher, Y., 2006. Class 1 integrons predating the association with Tn402-like transposition genes are present in a sediment microbial community. J. Bacteriol. 188, 5722–5730. Thiede, S., Goethe, R., Amtsberg, G., 2001. Prevalence of beta2 toxin gene of Clostridium perfringens type A from diarrhoeic dogs. Vet. Rec. 149, 273–274. Vilei, E.M., Schlatter, Y., Perreten, V., Straub, R., Popoff, M.R., Gibert, M., Grone, A., Frey, J., 2005. Antibiotic-induced expression of a cryptic cpb2 gene in equine beta2-toxigenic Clostridium perfringens. Mol. Microbiol. 57, 1570–1581. Waters, M., Savoie, A., Garmory, H.S., Bueschel, D., Popoff, M.R., Songer, J.G., Titball, R.W., McClane, B.A., Sarker, M.R., 2003. Genotyping and phenotyping of beta2toxigenic Clostridium perfringens fecal isolates associated with gastrointestinal diseases in piglets. J. Clin. Microbiol. 41, 3584–3591. Wilkins, T.D., Thiel, T., 1973. Modified broth-disk method for testing the antibiotic susceptibility of anaerobic bacteria. Antimicrob. Agents Chemother. 3, 350–356. Wright, G.D., 2010. Q&A: antibiotic resistance: where does it come from and what can we do about it? BMC Biol. 8, 123. Yu, H.S., Lee, J.C., Kang, H.Y., Jeong, Y.S., Lee, E.Y., Choi, C.H., Tae, S.H., Lee, Y.C., Seol, S.Y., Cho, D.T., 2004. Prevalence of dfr genes associated with integrons and dissemination of dfrA17 among urinary isolates of Escherichia coli in Korea. J. Antimicrob. Chemother. 53, 445–450. Zar, J.H., 1984. Biostatistical Analysis. Prentice Hall, Englewood Cliffs, N.J..