- Email: [email protected]
DNA-based authentication of plant extracts
Food Research International 40 (2007) 388–392 www.elsevier.com/locate/foodres
DNA-based authentication of plant extracts Johannes Novak *, Sabine Grausgruber-Gro¨ger, Brigitte Lukas Institute for Applied Botany, Department of Public Health in Veterinary Medicine, University of Veterinary Medicine, Veterina¨rplatz 1, A-1210 Wien, Austria Received 4 June 2006; accepted 25 October 2006
Abstract DNA-based methods to authenticate raw food materials have gained wide acceptance in quality control. An advantage of these methods is their possible use in the (whole?) production chain from raw material to the final customer. The concentration of plant secondary compounds by extraction processes leads to valuable intermediary products that are useful in food, flavor and pharmaceutical industry. An authentication of the extract by DNA sequence information could complement the chemical pool of methods. Three different extract types (spissum ethanol extract from coneflower (Echinacea sp.) and tincture and fluid extract from chamomile (Matricaria chamomilla)) were choosen to proof the possibility of DNA-based authentication of plant extracts. Since plant secondary compounds strongly interfere with subsequent PCR reactions, the minor amounts of intact plant cells observed in the extracts were purified by a repeated dilution/concentration/separation process before extracting the DNA from the plant cells. Internal transcribed spacer (ITS) was successfully amplified from all extracts. The sequence comparison to published sequences in Genbank revealed the unambiguous identification of the plant DNA in the ‘Echinacea’ extract as originating from the genus Echinacea sp. with the closest similarity to Echinacea purpurea. The sequences from the two chamomile extracts were compared to a reference sample. The DNAfragment from the tincture was in complete accordance with the reference while in the fluid extract two fragments of different sizes were amplified with one exactly matching the reference, while the other one originated from a different species. DNA-based authentication of plant extracts is feasible and could reliably complement/substitute chemical analysis. 2006 Elsevier Ltd. All rights reserved. Keywords: Extraction; PCR; Echinacea; Spissum extract; Chamomile; Matricaria chamomilla; Tincture; Fluid extract; Authentication
1. Introduction DNA analysis has become routine technique to identify raw materials of food. An advantage of these methods is their possible use throughout the food supply chain, which is essential for e.g. the traceability of genetically modified organisms (GMO’s) in the whole food production chain (Auer, 2003; Krcmar & Rencova, 2003). Therefore DNA analysis of processed food has received much attention although DNA degradation during processing steps may hamper the analysis (Woolfe & Primrose, 2004).
*
Corresponding author. Tel.: +43 1 250 77 3104; fax: +43 1 250 77 3190. E-mail address: [email protected] (J. Novak). 0963-9969/$ - see front matter 2006 Elsevier Ltd. All rights reserved. doi:10.1016/j.foodres.2006.10.015
Coneflower (Echinacea sp., Asteraceae) and German chamomile (Matricaria chamomilla, Asteraceae) are botanicals used in herbal medicines, in (functional) food and food supplements due to their immunostimulating effect (Echinacea) or for the symptomatic treatment of digestive ailments (chamomile) (WHO, 1999). Chamomile is additionally used for flavoring food (Burdock, 1995). Both botanicals are either applied dried, powdered or as extracts. Since plant extracts are traded goods it is of importance for the customer to be able to control identity and quality of an extract. For the authentication of an extract several chemical methods are established like color and precipitation reactions (which are in most cases only group specific), isotopic ratios and mainly chromatographic methods (Salzer, 2006; Liang, Xie, & Chan, 2004). Additionally the specific gravity is analysed but gives
J. Novak et al. / Food Research International 40 (2007) 388–392
more information about the correct use of the solvent than about the species used for the extraction (Halbach & Stumpf, 1985). In this paper we communicate an approach to isolate DNA from commercial plant extracts suitable for DNA authentication of these extracts. 2. Materials and methods Extracts and reference plant material: The following commercial extracts were analysed: spissum ethanol extract of Echinacea (exact botanical species not declared by the vendor), tincture and fluid extract of chamomile (Matricaria chamomilla). Since the botanical identification of Echinacea species is difficult, no reference samples were collected for this plant. For chamomile, reference plant material was taken from the botanical garden of the University of Veterinary Medicine, Vienna, Austria (Matricaria chamomilla cv. ‘Manzana’). Purification and separation: Twenty-five milliliter of each extracts was diluted with 10 ml of 30% ethanol (v/v), shaken for 15 min and centrifuged (4000 rpm, 5 min). 10 ml of the supernatant was removed and replaced with 10 ml of 30% ethanol (v/v). The procedure was repeated five times with removal and replacement of 30 ml each time using increasing ethanol concentrations from 30% to 70% (v/v). The residue was filled up to 50 ml with ddH2O, dissolved by vortexing, and centrifuged (4000 rpm, 5 min). The supernatant was discarded and the washing step with ddH2O was repeated. The residue now consisted of three fractions, a small brown level between two light colored levels. The residues were examined under the microscope. Intact plant cells were found in the brown residue, which was separated with a spatula for further processing. DNA extraction and quantification: The brown residue was collected in a 50 ml Falcon tube, autoclaved sea sand ‘extra pure’ (Merck, Darmstadt, Germany) was added and the plant fragments were grinded with a pestle. A DNA extraction in 50 ml Falcon tubes was carried out following the protocol of Pirttila¨, Hirsikorpi, Ka¨ma¨ra¨inen, Jaakola, and Hohtola (2001). DNA was quantified with a BIORAD Versa FluorTM fluorimeter and the fluorochrome Hoechst 33258 (BIORAD, Vienna, Austria) according to the manufacturers protocol. DNA from the dried reference material from chamomile was extracted and measured according to the same protocols as the DNA from the residue. PCR primer development: Primers were developed for Echinacea with the program ‘PRIMER3’ (http://frodo. wi.mit.edu/cgi-bin/primer3/primer3_www.cgi) on the basis of an ITS1 sequence of Echinacea purpurea published in Genbank (http://www.ncbi.nlm.nih.gov, accession no. U73148 (Urbatsch, Baldwin, & Donoghue, 2000), forward primer: GACCCGTGAACATGTAAAAACT; reverse primer: AAAAGAAGCAACGCACACTATG). For the chamomile extracts and reference, primers for the internal transcribed spacer 2 (ITS2, forward primer: GCATCGATGAAGAACGTAGC, reverse primer: TCCTTCCGCTT-
389
ATTGATATGC) were selected from primers proposed by Downie and Katz-Downie (1996). All primers were synthesized by INVITROGEN (Karlsruhe, Germany). PCR reaction and visualisation of amplification products: The 15 ll PCR reaction was carried out in 1· enzyme buffer (160 mM (NH4)2SO4, 670 mM Tris–HCl pH 8.8, 15 mM MgCl2, 0.1% Tween 20) reaction mixtures containing 0.6 lM of each of the primers, 0.1 mM of each dNTP (peqLab, Erlangen, Germany), 0.5 U Taq Biotherm DNA polymerase (Genecraft, Lu¨dinghausen, Germany) and 5 ll of the DNA extract. The PCR reaction was performed in a GeneAmp PCR System 9700 (Applied Biosystems, Vienna, Austria). The program for the Echinacea extract started at 94 C for 1 min, followed by 30 cycles of 1 min at 94 C, 45 s at 59 C, 30 s at 72 C, and a final extension step of 72 C for 5 min. The program for the chamomile extracts started at 95 C for 3 min, 55 C for 30 s and 72 C for 45 s, followed by 34 cycles of 30 s at 95 C, 30 s of 55 C, 45 s of 72 C and a final extension step of 72 C for 7 min. A second PCR reaction was carried out in 50 ll reaction mixtures using 5 ll of the PCR mix of the first PCR-run (instead of the whole genomic DNA) following the procedure described above. The amplification product was separated in a 1.4% agarose gel, stained with ethidium bromide and visualized under UV light. The size of the fragment was determined using a standard 100 bp ladder (peqGOLD, peqLab, Erlangen, Germany). Fragment isolation and DNA sequencing: About 45 ll of the amplification products were purified by electrophoresis in a 1% agarose gel and the subsequent use of the QIAGEN QIAEX II Gel extraction kit (VWR International, Vienna, Austria). Sequencing was performed in duplicate at IBL (Vienna, Austria) with the forward primers as sequencing primer. The two sequences were checked for ambiguous bases using the program Chromas (Technelysium, Tewantin, Australia). The sequence of the reference sample of chamomile was submitted to EMBL (accession no. AM086626). Sequence comparison and multiple alignments: The sequence obtained from the Echinacea extract was compared to sequences deposited in Genbank. The sequences of the chamomile extracts were compared to the reference sequence. Comparison was done by aligning the sequences using the ClustalW algorithm of the program Megalign (Lasergene, GATC Biotech, Konstanz). 3. Results and discussion DNA was successfully extracted from minor amounts of remaining intact plant cells from three differently prepared plants extracts, a spissum extract of Echinacea sp., a tincture and a fluid extract of chamomile. As plant secondary compounds interfere with the DNA amplification in the PCR, the remaining plant fragments were first purified with ethanol/water mixtures in increasing ethanol concentrations. This step was introduced before DNA extraction to eliminate plant secondary compounds in a simple and
390
J. Novak et al. / Food Research International 40 (2007) 388–392
Echinacea. Significant differences could be found to sequences from Asteraceae species of the same tribe (Heliantheae) like Rudbeckia sp., Sanvitalia fruticosa, Oblivia mikanioides and Idiopappus quitensis (Fig. 1). The sequence of the plant extract differed from E. purpurea in only one nucleotide at position 12 (Fig. 1). Compared to E. paradoxa and E. pallida the plant extract was different in only two nucleotides at positions 99 and 173 (E. paradoxa) and at positions 173 and 178 (E. pallida). These small differences between the Echinacea spp. do not justify an unambiguous determination of the species in the extract up to now. However, increasing sequence information from additional DNA-regions will enable a better differentiation capacity.
efficient way. A further advantage of this purification process was that the solids centrifuged from the solution could easily be evaluated and the layer containing plant fragments could be isolated after visual inspection under the microscope. The extracted DNA was not quantifiable due to its low concentration. To authenticate the plant extracts, a short DNA fragment from nuclear DNA-regions often used in molecular plant taxonomy (ITS1 for Echinacea and ITS2 for chamomile) was amplified using the same primers in two consecutive PCR reactions. The amplification products were purified, sequenced and the identification was based on sequence comparisons to reference sequences. 3.1. Echinacea
3.2. Chamomile The sequence comparison to published sequences revealed the unambiguous identification of the plant DNA in the extract as originating from the genus
10
Both extracts (the tincture as well as the fluid extract) showed an amplification product equal in size to the refer-
20
30
40
50
60
plant extract Echinacea purpurea Echinacea paradoxa Echinacea pallida Echinacea atrorubens Echinacea simulata Echinacea tennesseensis Rudbeckia fulgida var. fulgida Rudbeckia subtomentosa Sanvitalia fruticosa Rudbeckia missouriensis Rudbeckia heliopsidis Oblivia mikanioides Idiopappus quitensis
C A T T T G T T T C G A G C C T T G T G A G G C C T T - G T T G A C G A G C A T T C A T G C T T - G C C T C T - A C G G G G CA . . . . . . . . . . . - . . . . . . . . . . . . . . . - . . . . . . . . . . . . . . . . . . . . - . . . . . . - . . . . . . .. . . . . . . . . . . . . . . . . . . . . . . . . . . . - . . . . . . . . . . . . . . . . . . . . - . . . . . . - . . . . . . .. . . . . . . . . . . . . . . . . . . . . . . . . . . . - . . . . . . . . . . . . . . . . . . . . - . . . . . . - . . . . . . .. . . . . . . . . . . . . . . . . . . . . . . . . . . . - . . . . . . . . . . . . . . . . . . . . - . . . . . . - . . . . . . .. . . . . . . . . . . . . . . . . . . . . . . . . . . . - . . . . . . . . . . . . . . . . . . . . - . . . . . . - . . . . . . .. . . . . . . . . . - . . . . . . . . . . . . . . . . . - . . . . . . . . . . . . . . . . . . . . - . . . . . . - . . . . . . .. . . . . . . . . . T . . . . . . . . . . . . C . . . . - . . . . . . . T . T G . . . . . . . . . - C . . C . - - . T . . . . .. . . . . . . . . . . . . . . . . . . . . . . . . . . . T . . . . . . . T . T G . . . . . . . . . - . . . . . - - . A . . . . .. . G . . . . . . . T . . . . . . C C . . . . . . . . . - . . . . . . . - . . C . . . . . . . . . - . . . C . . C . T . . . . .. . . . . . . . . . T . . . . . . . . . . . . C . . . . - . . . . . . . T . T G . . . . . . . . . - C . . C . - - . T . . . . .. . . . . . . . . . T . . . . . . . . . . . . . . . . . - . . . . . . . T . T G . . . . . . . . . - . . . C . - - . . . . . . T. - C . . C . C . . . A G C . . A . . . . . A . . . . . - . . C . . . . T . T G . . . G . . T . . T . . . C . . - . T . . . . .. . T . . . . . . . T . . . . . . . . . . . A . . . . . - . . . . . . . T . T G . . . . . . T A A - . . . . . . - C T . . . . ..
plant extract Echinacea purpurea Echinacea paradoxa Echinacea pallida Echinacea atrorubens Echinacea simulata Echinacea tennesseensis Rudbeckia fulgida var. fulgida Rudbeckia subtomentosa Sanvitalia fruticosa Rudbeckia missouriensis Rudbeckia heliopsidis Oblivia mikanioides Idiopappus quitensis
T C A T G G T T G T C T G G T T G A C A C A C T A A C A A C C C C C G G C A C A A C A T G T G C C A A G G A A A A - C A A A AC . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . - . . . . .. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . - . . . . . . . . . . . . . . . . . . . . . - . . . . .. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . - . . . . .. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . - . . . . .. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . - . . . . . . . . . . . . . . . . . . . . . - . . . . .. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . - . . . . .. . . . . . . A . . - . A . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . - . T . . .. . . . . . . A . . - . A A . . . . . . . . . . . . . . . . . . . . . . . . . . G G . . . . . . . . . . . . . . . . - . T . . .. C . . C . . A . . . . A A . . . . . . G . . . . . . . . . . . . . . . . . . G . . . . C . . . . . . . . . . . . . - . . T . .. . . . . . . A . . - . A . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . A . T . . .. . . . . . . A . . - . A A . . . . . . . . . . . . . . . . . . . . . . . . . . G G . . . . . . . . . . . . . . . . - - T . . .. . . . . . . A . A . . A A . . . . . . . . . T . . . . . . . . . . . . . . . . G . . . . . . . . . . . . . . . . . - . . . . .. . . . . . . A . A . . A A . . . . . . . . . A . . . . . . . . . . . C . . . . G G . . A . . . . . . . . . . . . . - . T . . ..
plant extract Echinacea purpurea Echinacea paradoxa Echinacea pallida Echinacea atrorubens Echinacea simulata Echinacea tennesseensis Rudbeckia fulgida var. fulgida Rudbeckia subtomentosa Sanvitalia fruticosa Rudbeckia missouriensis Rudbeckia heliopsidis Oblivia mikanioides Idiopappus quitensis
TTAAAGGGCTTGTGCTGTTATGCCCCGTCA-TTGGTGTGCATAGT-GTGCGTTGCTTCTTT ..............................-..............-............... ..............................-............C.-............... ..............................-............C.-..-............ ..............................A............C.-............... ..............................A............C.-............... ..............................-............C.-............... A.G...T..CC...T.........NN..T.-GC.......-..T.-.CA...GTG..... ..G...T..CC.....A...C...NN..TT-GC.......G-.T.-..A...G.A...... .........CC.....A........-....-CC.......G.GT.-......G........ A.G...T..CC...T.............T.-GC.......G..T.-.CA...GTG...... .-G...T..CA..-......C.......T--GC.......G..TA-..A...G....TC. ....G.-.........T.G.C......CTT-GC.......GA.T.T.C....G........ ......A.........A.G.C.......TT-GC.......GA.T.-..A..CGAA......
70
130
80
140
90
150
100
160
110
170
120
180
Fig. 1. Multiple alignment of the sequence amplified from the Echinacea extract and the closest related search results from Genbank (Clustal W alignment algorithm; dots represent bases identical to the sequence from the plant extract).
J. Novak et al. / Food Research International 40 (2007) 388–392
ence sample of approx. 400 bp (Fig. 2). From the fluid extract, however, an additional fragment of 420 bp length was amplified (‘upper band’). The DNA fragments equal in size to the reference sample were completely homologous to the reference, while the sequence of the upper band of the fluid extract showed only a similarity of 78% (Fig. 3), which would indicate an impurity in the plant raw material used for producing the fluid extract. The identity of the impurity could not be determined. A Genbank search resulted in resemblances to Perovskia abrotanoides (89% similarity), Salvia davidsonii (87%), Rosmarinus officinalis (83%) and Salvia pachyphylla (82%) (all from the Lamiaceae family). The similarity is too low to identify the DNA fragment as belonging to any of these species mentioned above. In this example, the impurity could easily be detected due to DNA inserts which resulted in a larger DNA-fragment easily separable from the chamomile DNA-fragment. DNA authentication was possible, because plant cells could be isolated from the extract. The success of this approach is therefore strongly dependent on the technology (filtration, etc.) used in producing the plant extract. Usually a small portion of very fine vegetal material
Fig. 2. Agarose gel of the chamomile extracts and the reference (lane 1: 100 bp molecular marker, lane 2: chamomile tincture, lane 3: chamomile fluid extract, lane 4: non-target control, lane 5: reference sample).
10
391
20
30
40
50
60
reference sample tincture extract fluid lower band extract fluid upper band
GATTGCAGAATCCCGTGAACCATCGAGTTTTTGAACGCAAGTTGCGCCCGAAGCCTTTTGGCCG ................................................................ ................................................................ A...........................C..........................A..A.....
reference sample tincture extract fluid lower band extract fluid upper band
AGGGCACGTCTGCCTGGGCGTCACGCATCGCGTCGCCCCCA--------------ACAAACTAT .........................................--------------......... .........................................--------------......... ........................................CCGCCCTCCGTGCGC...GCGCCC
reference sample tincture extract fluid lower band extract fluid upper band
GTTGGGGG--------CGGATATTGGTCTCCCGTGCTTATGG---CGTGGTTGGCCAAAATAGG ........--------..........................---................... ........--------..........................---................... ........AGGGGGGG..........C..........CC.C.GCG..C..C.....C....GC.
reference sample tincture extract fluid lower band extract fluid upper band
AGTCCCTT-CGATGGACGCACGAACTAGTGGTGGTCGTAAAAACC---CTCGTTCTTTGTTTTG ........-....................................---................ ........-....................................---................ .TC..TCGG...CTC.T.TCACG..A.........T.A.C..CT.AAT....CG.GCC..CG..
reference sample tincture extract fluid lower band extract fluid upper band
TGTC---GTCGGTCGCAAGGATAAGCTCTCTAAAAACCCCAATGTGTTG-----TCTTAGGATG ....---..........................................-----.......... ....---..........................................-----.......... CCA.TGC....TC...TC..GC.--TC.ATC..CG....A.CG...CC.GTGCC..AC..CTC.
reference sample tincture extract fluid lower band extract fluid upper band
ACGCTTCGACCGCGACCCCAGGTCAGG ........................... ........................... CAC........................
70
80
130
90
140
200
260
150
210
270
330
100
160
220
280
110
170
230
290
120
180
240
300
190
250
310
320
340
Fig. 3. Multiple alignment of the sequence amplified from the chamomile reference material and the two chamomile plant extracts (Clustal W alignment algorithm; dots represent bases identical to the sequence from the plant extract).
392
J. Novak et al. / Food Research International 40 (2007) 388–392
manages to pass though the filtering system of the extractor (Bombardelli, 1991). Typical sizes of plant cells are between 5 and 100 lm, sizes that would already require microfiltration, a technique not applicable to extracts especially when they contain mucilaginous or polymeric substances which hinder filtration. Unambiguous plant identification is of primary concern to guarantee quality, safety and efficacy of a drug or an extract. DNA analysis is able to complement or substitute existing authentication methods of extracts. References Auer, C. A. (2003). Tracking genes from seed to supermarket: Techniques and trends. Trends in Plant Science, 8, 591–597. Bombardelli, E. (1991). Technologies for the processing of medicinal plants. In R. O. B. Wijesekera (Ed.), The Medicinal Plant Industry (pp. 85–98). Boca Raton: CRC Press. Burdock, G. A. (1995) (third edition). Fenaroli’s handbook of flavor ingredients (Vol. 1). Boca Raton: CRC Press. Downie, S. R., & Katz-Downie, D. S. (1996). A molecular phylogeny of Apiaceae subfamily Apioideae: Evidence from nuclear ribosomal
DNA internal transcribed spacer sequences. American Journal of Botany, 83, 234–251. Halbach, G., & Stumpf, H. (1985). Pru¨fung von Extrakten und Extraktmischungen. In G. Harnischfeger (Ed.), Qualita¨tskontrolle von Phytopharmaka (pp. 98–99). Stuttgart: Georg Thieme. Krcmar, P., & Rencova, E. (2003). Identification of species-specific DNA in feedstuffs. Journal of Agricultural and Food Chemistry, 51, 7655–7658. Liang, Y.-Z., Xie, P., & Chan, K. (2004). Quality control of herbal medicines. Journal of Chromatography B, 812, 53–70. Pirttila¨, A. M., Hirsikorpi, M., Ka¨ma¨ra¨inen, T., Jaakola, L., & Hohtola, A. (2001). DNA isolation methods for medicinal and aromatic plants. Plant Molecular Biology Reporter, 19, 273a–273f. WHO (1999). WHO monographs on selected medicinal plants (Vol. 1). World Health Organisation: Geneva. Woolfe, M., & Primrose, S. (2004). Food forensics: Using DNA technology to combat misdescription and fraud. Trends in Biotechnology, 22, 222–226. Salzer, U. J. (2006). Aromen. In W. Frede (Ed.), Taschenbuch fu¨r Lebensmittelchemiker (pp. 727–743). Berlin: Springer. Urbatsch, L. E., Baldwin, B. G., & Donoghue, M. J. (2000). Phylogeny of the coneflowers and relatives (Heliantheae:Asteraceae) based on nuclear rDNA internal transcribed spacer (ITS) sequences and chloroplast DNA restriction site data. Systematic Botany, 25, 539– 565.
DNA-based authentication of plant extracts Johannes Novak *, Sabine Grausgruber-Gro¨ger, Brigitte Lukas Institute for Applied Botany, Department of Public Health in Veterinary Medicine, University of Veterinary Medicine, Veterina¨rplatz 1, A-1210 Wien, Austria Received 4 June 2006; accepted 25 October 2006
Abstract DNA-based methods to authenticate raw food materials have gained wide acceptance in quality control. An advantage of these methods is their possible use in the (whole?) production chain from raw material to the final customer. The concentration of plant secondary compounds by extraction processes leads to valuable intermediary products that are useful in food, flavor and pharmaceutical industry. An authentication of the extract by DNA sequence information could complement the chemical pool of methods. Three different extract types (spissum ethanol extract from coneflower (Echinacea sp.) and tincture and fluid extract from chamomile (Matricaria chamomilla)) were choosen to proof the possibility of DNA-based authentication of plant extracts. Since plant secondary compounds strongly interfere with subsequent PCR reactions, the minor amounts of intact plant cells observed in the extracts were purified by a repeated dilution/concentration/separation process before extracting the DNA from the plant cells. Internal transcribed spacer (ITS) was successfully amplified from all extracts. The sequence comparison to published sequences in Genbank revealed the unambiguous identification of the plant DNA in the ‘Echinacea’ extract as originating from the genus Echinacea sp. with the closest similarity to Echinacea purpurea. The sequences from the two chamomile extracts were compared to a reference sample. The DNAfragment from the tincture was in complete accordance with the reference while in the fluid extract two fragments of different sizes were amplified with one exactly matching the reference, while the other one originated from a different species. DNA-based authentication of plant extracts is feasible and could reliably complement/substitute chemical analysis. 2006 Elsevier Ltd. All rights reserved. Keywords: Extraction; PCR; Echinacea; Spissum extract; Chamomile; Matricaria chamomilla; Tincture; Fluid extract; Authentication
1. Introduction DNA analysis has become routine technique to identify raw materials of food. An advantage of these methods is their possible use throughout the food supply chain, which is essential for e.g. the traceability of genetically modified organisms (GMO’s) in the whole food production chain (Auer, 2003; Krcmar & Rencova, 2003). Therefore DNA analysis of processed food has received much attention although DNA degradation during processing steps may hamper the analysis (Woolfe & Primrose, 2004).
*
Corresponding author. Tel.: +43 1 250 77 3104; fax: +43 1 250 77 3190. E-mail address: [email protected] (J. Novak). 0963-9969/$ - see front matter 2006 Elsevier Ltd. All rights reserved. doi:10.1016/j.foodres.2006.10.015
Coneflower (Echinacea sp., Asteraceae) and German chamomile (Matricaria chamomilla, Asteraceae) are botanicals used in herbal medicines, in (functional) food and food supplements due to their immunostimulating effect (Echinacea) or for the symptomatic treatment of digestive ailments (chamomile) (WHO, 1999). Chamomile is additionally used for flavoring food (Burdock, 1995). Both botanicals are either applied dried, powdered or as extracts. Since plant extracts are traded goods it is of importance for the customer to be able to control identity and quality of an extract. For the authentication of an extract several chemical methods are established like color and precipitation reactions (which are in most cases only group specific), isotopic ratios and mainly chromatographic methods (Salzer, 2006; Liang, Xie, & Chan, 2004). Additionally the specific gravity is analysed but gives
J. Novak et al. / Food Research International 40 (2007) 388–392
more information about the correct use of the solvent than about the species used for the extraction (Halbach & Stumpf, 1985). In this paper we communicate an approach to isolate DNA from commercial plant extracts suitable for DNA authentication of these extracts. 2. Materials and methods Extracts and reference plant material: The following commercial extracts were analysed: spissum ethanol extract of Echinacea (exact botanical species not declared by the vendor), tincture and fluid extract of chamomile (Matricaria chamomilla). Since the botanical identification of Echinacea species is difficult, no reference samples were collected for this plant. For chamomile, reference plant material was taken from the botanical garden of the University of Veterinary Medicine, Vienna, Austria (Matricaria chamomilla cv. ‘Manzana’). Purification and separation: Twenty-five milliliter of each extracts was diluted with 10 ml of 30% ethanol (v/v), shaken for 15 min and centrifuged (4000 rpm, 5 min). 10 ml of the supernatant was removed and replaced with 10 ml of 30% ethanol (v/v). The procedure was repeated five times with removal and replacement of 30 ml each time using increasing ethanol concentrations from 30% to 70% (v/v). The residue was filled up to 50 ml with ddH2O, dissolved by vortexing, and centrifuged (4000 rpm, 5 min). The supernatant was discarded and the washing step with ddH2O was repeated. The residue now consisted of three fractions, a small brown level between two light colored levels. The residues were examined under the microscope. Intact plant cells were found in the brown residue, which was separated with a spatula for further processing. DNA extraction and quantification: The brown residue was collected in a 50 ml Falcon tube, autoclaved sea sand ‘extra pure’ (Merck, Darmstadt, Germany) was added and the plant fragments were grinded with a pestle. A DNA extraction in 50 ml Falcon tubes was carried out following the protocol of Pirttila¨, Hirsikorpi, Ka¨ma¨ra¨inen, Jaakola, and Hohtola (2001). DNA was quantified with a BIORAD Versa FluorTM fluorimeter and the fluorochrome Hoechst 33258 (BIORAD, Vienna, Austria) according to the manufacturers protocol. DNA from the dried reference material from chamomile was extracted and measured according to the same protocols as the DNA from the residue. PCR primer development: Primers were developed for Echinacea with the program ‘PRIMER3’ (http://frodo. wi.mit.edu/cgi-bin/primer3/primer3_www.cgi) on the basis of an ITS1 sequence of Echinacea purpurea published in Genbank (http://www.ncbi.nlm.nih.gov, accession no. U73148 (Urbatsch, Baldwin, & Donoghue, 2000), forward primer: GACCCGTGAACATGTAAAAACT; reverse primer: AAAAGAAGCAACGCACACTATG). For the chamomile extracts and reference, primers for the internal transcribed spacer 2 (ITS2, forward primer: GCATCGATGAAGAACGTAGC, reverse primer: TCCTTCCGCTT-
389
ATTGATATGC) were selected from primers proposed by Downie and Katz-Downie (1996). All primers were synthesized by INVITROGEN (Karlsruhe, Germany). PCR reaction and visualisation of amplification products: The 15 ll PCR reaction was carried out in 1· enzyme buffer (160 mM (NH4)2SO4, 670 mM Tris–HCl pH 8.8, 15 mM MgCl2, 0.1% Tween 20) reaction mixtures containing 0.6 lM of each of the primers, 0.1 mM of each dNTP (peqLab, Erlangen, Germany), 0.5 U Taq Biotherm DNA polymerase (Genecraft, Lu¨dinghausen, Germany) and 5 ll of the DNA extract. The PCR reaction was performed in a GeneAmp PCR System 9700 (Applied Biosystems, Vienna, Austria). The program for the Echinacea extract started at 94 C for 1 min, followed by 30 cycles of 1 min at 94 C, 45 s at 59 C, 30 s at 72 C, and a final extension step of 72 C for 5 min. The program for the chamomile extracts started at 95 C for 3 min, 55 C for 30 s and 72 C for 45 s, followed by 34 cycles of 30 s at 95 C, 30 s of 55 C, 45 s of 72 C and a final extension step of 72 C for 7 min. A second PCR reaction was carried out in 50 ll reaction mixtures using 5 ll of the PCR mix of the first PCR-run (instead of the whole genomic DNA) following the procedure described above. The amplification product was separated in a 1.4% agarose gel, stained with ethidium bromide and visualized under UV light. The size of the fragment was determined using a standard 100 bp ladder (peqGOLD, peqLab, Erlangen, Germany). Fragment isolation and DNA sequencing: About 45 ll of the amplification products were purified by electrophoresis in a 1% agarose gel and the subsequent use of the QIAGEN QIAEX II Gel extraction kit (VWR International, Vienna, Austria). Sequencing was performed in duplicate at IBL (Vienna, Austria) with the forward primers as sequencing primer. The two sequences were checked for ambiguous bases using the program Chromas (Technelysium, Tewantin, Australia). The sequence of the reference sample of chamomile was submitted to EMBL (accession no. AM086626). Sequence comparison and multiple alignments: The sequence obtained from the Echinacea extract was compared to sequences deposited in Genbank. The sequences of the chamomile extracts were compared to the reference sequence. Comparison was done by aligning the sequences using the ClustalW algorithm of the program Megalign (Lasergene, GATC Biotech, Konstanz). 3. Results and discussion DNA was successfully extracted from minor amounts of remaining intact plant cells from three differently prepared plants extracts, a spissum extract of Echinacea sp., a tincture and a fluid extract of chamomile. As plant secondary compounds interfere with the DNA amplification in the PCR, the remaining plant fragments were first purified with ethanol/water mixtures in increasing ethanol concentrations. This step was introduced before DNA extraction to eliminate plant secondary compounds in a simple and
390
J. Novak et al. / Food Research International 40 (2007) 388–392
Echinacea. Significant differences could be found to sequences from Asteraceae species of the same tribe (Heliantheae) like Rudbeckia sp., Sanvitalia fruticosa, Oblivia mikanioides and Idiopappus quitensis (Fig. 1). The sequence of the plant extract differed from E. purpurea in only one nucleotide at position 12 (Fig. 1). Compared to E. paradoxa and E. pallida the plant extract was different in only two nucleotides at positions 99 and 173 (E. paradoxa) and at positions 173 and 178 (E. pallida). These small differences between the Echinacea spp. do not justify an unambiguous determination of the species in the extract up to now. However, increasing sequence information from additional DNA-regions will enable a better differentiation capacity.
efficient way. A further advantage of this purification process was that the solids centrifuged from the solution could easily be evaluated and the layer containing plant fragments could be isolated after visual inspection under the microscope. The extracted DNA was not quantifiable due to its low concentration. To authenticate the plant extracts, a short DNA fragment from nuclear DNA-regions often used in molecular plant taxonomy (ITS1 for Echinacea and ITS2 for chamomile) was amplified using the same primers in two consecutive PCR reactions. The amplification products were purified, sequenced and the identification was based on sequence comparisons to reference sequences. 3.1. Echinacea
3.2. Chamomile The sequence comparison to published sequences revealed the unambiguous identification of the plant DNA in the extract as originating from the genus
10
Both extracts (the tincture as well as the fluid extract) showed an amplification product equal in size to the refer-
20
30
40
50
60
plant extract Echinacea purpurea Echinacea paradoxa Echinacea pallida Echinacea atrorubens Echinacea simulata Echinacea tennesseensis Rudbeckia fulgida var. fulgida Rudbeckia subtomentosa Sanvitalia fruticosa Rudbeckia missouriensis Rudbeckia heliopsidis Oblivia mikanioides Idiopappus quitensis
C A T T T G T T T C G A G C C T T G T G A G G C C T T - G T T G A C G A G C A T T C A T G C T T - G C C T C T - A C G G G G CA . . . . . . . . . . . - . . . . . . . . . . . . . . . - . . . . . . . . . . . . . . . . . . . . - . . . . . . - . . . . . . .. . . . . . . . . . . . . . . . . . . . . . . . . . . . - . . . . . . . . . . . . . . . . . . . . - . . . . . . - . . . . . . .. . . . . . . . . . . . . . . . . . . . . . . . . . . . - . . . . . . . . . . . . . . . . . . . . - . . . . . . - . . . . . . .. . . . . . . . . . . . . . . . . . . . . . . . . . . . - . . . . . . . . . . . . . . . . . . . . - . . . . . . - . . . . . . .. . . . . . . . . . . . . . . . . . . . . . . . . . . . - . . . . . . . . . . . . . . . . . . . . - . . . . . . - . . . . . . .. . . . . . . . . . - . . . . . . . . . . . . . . . . . - . . . . . . . . . . . . . . . . . . . . - . . . . . . - . . . . . . .. . . . . . . . . . T . . . . . . . . . . . . C . . . . - . . . . . . . T . T G . . . . . . . . . - C . . C . - - . T . . . . .. . . . . . . . . . . . . . . . . . . . . . . . . . . . T . . . . . . . T . T G . . . . . . . . . - . . . . . - - . A . . . . .. . G . . . . . . . T . . . . . . C C . . . . . . . . . - . . . . . . . - . . C . . . . . . . . . - . . . C . . C . T . . . . .. . . . . . . . . . T . . . . . . . . . . . . C . . . . - . . . . . . . T . T G . . . . . . . . . - C . . C . - - . T . . . . .. . . . . . . . . . T . . . . . . . . . . . . . . . . . - . . . . . . . T . T G . . . . . . . . . - . . . C . - - . . . . . . T. - C . . C . C . . . A G C . . A . . . . . A . . . . . - . . C . . . . T . T G . . . G . . T . . T . . . C . . - . T . . . . .. . T . . . . . . . T . . . . . . . . . . . A . . . . . - . . . . . . . T . T G . . . . . . T A A - . . . . . . - C T . . . . ..
plant extract Echinacea purpurea Echinacea paradoxa Echinacea pallida Echinacea atrorubens Echinacea simulata Echinacea tennesseensis Rudbeckia fulgida var. fulgida Rudbeckia subtomentosa Sanvitalia fruticosa Rudbeckia missouriensis Rudbeckia heliopsidis Oblivia mikanioides Idiopappus quitensis
T C A T G G T T G T C T G G T T G A C A C A C T A A C A A C C C C C G G C A C A A C A T G T G C C A A G G A A A A - C A A A AC . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . - . . . . .. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . - . . . . . . . . . . . . . . . . . . . . . - . . . . .. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . - . . . . .. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . - . . . . .. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . - . . . . . . . . . . . . . . . . . . . . . - . . . . .. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . - . . . . .. . . . . . . A . . - . A . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . - . T . . .. . . . . . . A . . - . A A . . . . . . . . . . . . . . . . . . . . . . . . . . G G . . . . . . . . . . . . . . . . - . T . . .. C . . C . . A . . . . A A . . . . . . G . . . . . . . . . . . . . . . . . . G . . . . C . . . . . . . . . . . . . - . . T . .. . . . . . . A . . - . A . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . A . T . . .. . . . . . . A . . - . A A . . . . . . . . . . . . . . . . . . . . . . . . . . G G . . . . . . . . . . . . . . . . - - T . . .. . . . . . . A . A . . A A . . . . . . . . . T . . . . . . . . . . . . . . . . G . . . . . . . . . . . . . . . . . - . . . . .. . . . . . . A . A . . A A . . . . . . . . . A . . . . . . . . . . . C . . . . G G . . A . . . . . . . . . . . . . - . T . . ..
plant extract Echinacea purpurea Echinacea paradoxa Echinacea pallida Echinacea atrorubens Echinacea simulata Echinacea tennesseensis Rudbeckia fulgida var. fulgida Rudbeckia subtomentosa Sanvitalia fruticosa Rudbeckia missouriensis Rudbeckia heliopsidis Oblivia mikanioides Idiopappus quitensis
TTAAAGGGCTTGTGCTGTTATGCCCCGTCA-TTGGTGTGCATAGT-GTGCGTTGCTTCTTT ..............................-..............-............... ..............................-............C.-............... ..............................-............C.-..-............ ..............................A............C.-............... ..............................A............C.-............... ..............................-............C.-............... A.G...T..CC...T.........NN..T.-GC.......-..T.-.CA...GTG..... ..G...T..CC.....A...C...NN..TT-GC.......G-.T.-..A...G.A...... .........CC.....A........-....-CC.......G.GT.-......G........ A.G...T..CC...T.............T.-GC.......G..T.-.CA...GTG...... .-G...T..CA..-......C.......T--GC.......G..TA-..A...G....TC. ....G.-.........T.G.C......CTT-GC.......GA.T.T.C....G........ ......A.........A.G.C.......TT-GC.......GA.T.-..A..CGAA......
70
130
80
140
90
150
100
160
110
170
120
180
Fig. 1. Multiple alignment of the sequence amplified from the Echinacea extract and the closest related search results from Genbank (Clustal W alignment algorithm; dots represent bases identical to the sequence from the plant extract).
J. Novak et al. / Food Research International 40 (2007) 388–392
ence sample of approx. 400 bp (Fig. 2). From the fluid extract, however, an additional fragment of 420 bp length was amplified (‘upper band’). The DNA fragments equal in size to the reference sample were completely homologous to the reference, while the sequence of the upper band of the fluid extract showed only a similarity of 78% (Fig. 3), which would indicate an impurity in the plant raw material used for producing the fluid extract. The identity of the impurity could not be determined. A Genbank search resulted in resemblances to Perovskia abrotanoides (89% similarity), Salvia davidsonii (87%), Rosmarinus officinalis (83%) and Salvia pachyphylla (82%) (all from the Lamiaceae family). The similarity is too low to identify the DNA fragment as belonging to any of these species mentioned above. In this example, the impurity could easily be detected due to DNA inserts which resulted in a larger DNA-fragment easily separable from the chamomile DNA-fragment. DNA authentication was possible, because plant cells could be isolated from the extract. The success of this approach is therefore strongly dependent on the technology (filtration, etc.) used in producing the plant extract. Usually a small portion of very fine vegetal material
Fig. 2. Agarose gel of the chamomile extracts and the reference (lane 1: 100 bp molecular marker, lane 2: chamomile tincture, lane 3: chamomile fluid extract, lane 4: non-target control, lane 5: reference sample).
10
391
20
30
40
50
60
reference sample tincture extract fluid lower band extract fluid upper band
GATTGCAGAATCCCGTGAACCATCGAGTTTTTGAACGCAAGTTGCGCCCGAAGCCTTTTGGCCG ................................................................ ................................................................ A...........................C..........................A..A.....
reference sample tincture extract fluid lower band extract fluid upper band
AGGGCACGTCTGCCTGGGCGTCACGCATCGCGTCGCCCCCA--------------ACAAACTAT .........................................--------------......... .........................................--------------......... ........................................CCGCCCTCCGTGCGC...GCGCCC
reference sample tincture extract fluid lower band extract fluid upper band
GTTGGGGG--------CGGATATTGGTCTCCCGTGCTTATGG---CGTGGTTGGCCAAAATAGG ........--------..........................---................... ........--------..........................---................... ........AGGGGGGG..........C..........CC.C.GCG..C..C.....C....GC.
reference sample tincture extract fluid lower band extract fluid upper band
AGTCCCTT-CGATGGACGCACGAACTAGTGGTGGTCGTAAAAACC---CTCGTTCTTTGTTTTG ........-....................................---................ ........-....................................---................ .TC..TCGG...CTC.T.TCACG..A.........T.A.C..CT.AAT....CG.GCC..CG..
reference sample tincture extract fluid lower band extract fluid upper band
TGTC---GTCGGTCGCAAGGATAAGCTCTCTAAAAACCCCAATGTGTTG-----TCTTAGGATG ....---..........................................-----.......... ....---..........................................-----.......... CCA.TGC....TC...TC..GC.--TC.ATC..CG....A.CG...CC.GTGCC..AC..CTC.
reference sample tincture extract fluid lower band extract fluid upper band
ACGCTTCGACCGCGACCCCAGGTCAGG ........................... ........................... CAC........................
70
80
130
90
140
200
260
150
210
270
330
100
160
220
280
110
170
230
290
120
180
240
300
190
250
310
320
340
Fig. 3. Multiple alignment of the sequence amplified from the chamomile reference material and the two chamomile plant extracts (Clustal W alignment algorithm; dots represent bases identical to the sequence from the plant extract).
392
J. Novak et al. / Food Research International 40 (2007) 388–392
manages to pass though the filtering system of the extractor (Bombardelli, 1991). Typical sizes of plant cells are between 5 and 100 lm, sizes that would already require microfiltration, a technique not applicable to extracts especially when they contain mucilaginous or polymeric substances which hinder filtration. Unambiguous plant identification is of primary concern to guarantee quality, safety and efficacy of a drug or an extract. DNA analysis is able to complement or substitute existing authentication methods of extracts. References Auer, C. A. (2003). Tracking genes from seed to supermarket: Techniques and trends. Trends in Plant Science, 8, 591–597. Bombardelli, E. (1991). Technologies for the processing of medicinal plants. In R. O. B. Wijesekera (Ed.), The Medicinal Plant Industry (pp. 85–98). Boca Raton: CRC Press. Burdock, G. A. (1995) (third edition). Fenaroli’s handbook of flavor ingredients (Vol. 1). Boca Raton: CRC Press. Downie, S. R., & Katz-Downie, D. S. (1996). A molecular phylogeny of Apiaceae subfamily Apioideae: Evidence from nuclear ribosomal
DNA internal transcribed spacer sequences. American Journal of Botany, 83, 234–251. Halbach, G., & Stumpf, H. (1985). Pru¨fung von Extrakten und Extraktmischungen. In G. Harnischfeger (Ed.), Qualita¨tskontrolle von Phytopharmaka (pp. 98–99). Stuttgart: Georg Thieme. Krcmar, P., & Rencova, E. (2003). Identification of species-specific DNA in feedstuffs. Journal of Agricultural and Food Chemistry, 51, 7655–7658. Liang, Y.-Z., Xie, P., & Chan, K. (2004). Quality control of herbal medicines. Journal of Chromatography B, 812, 53–70. Pirttila¨, A. M., Hirsikorpi, M., Ka¨ma¨ra¨inen, T., Jaakola, L., & Hohtola, A. (2001). DNA isolation methods for medicinal and aromatic plants. Plant Molecular Biology Reporter, 19, 273a–273f. WHO (1999). WHO monographs on selected medicinal plants (Vol. 1). World Health Organisation: Geneva. Woolfe, M., & Primrose, S. (2004). Food forensics: Using DNA technology to combat misdescription and fraud. Trends in Biotechnology, 22, 222–226. Salzer, U. J. (2006). Aromen. In W. Frede (Ed.), Taschenbuch fu¨r Lebensmittelchemiker (pp. 727–743). Berlin: Springer. Urbatsch, L. E., Baldwin, B. G., & Donoghue, M. J. (2000). Phylogeny of the coneflowers and relatives (Heliantheae:Asteraceae) based on nuclear rDNA internal transcribed spacer (ITS) sequences and chloroplast DNA restriction site data. Systematic Botany, 25, 539– 565.