DNA immunization against respiratory syncytial virus (RSV) in infant rhesus monkeys

Vaccine 23 (2005) 2928–2942

DNA immunization against respiratory syncytial virus (RSV) in infant rhesus monkeys Kerrie Vaughana,∗ , Gary H. Rhodesb , Laurel J. Gershwina a

Department of Pathology, Microbiology and Immunology, University of California, Davis, School of Veterinary Medicine, Davis, CA 95616, USA b Department of Pathology, University of California, Davis, School of Medicine, Davis, CA 95616, USA Received 15 July 2004; received in revised form 19 October 2004; accepted 25 October 2004 Available online 23 December 2004

Abstract A DNA vaccine was tested in infant Rhesus macaques to evaluate its safety, immunogenicity and protective efficacy. Monkeys were vaccinated and challenged with a clinical isolate of human RSV. Vaccinated animals developed humoral and cellular responses following inoculation with plasmid DNA encoding the fusion (F) and nucleoprotein (N), from closely related bovine RSV. Vaccinated monkeys had decreased RSV in their lungs post-infection, and there was a qualitative difference in histopathology observed between vaccinated and unvaccinated animals. The combined result of safety and immunogenicity in a neonatal primate model is encouraging, suggesting the feasibility of DNA vaccines against RSV in infants. © 2004 Elsevier Ltd. All rights reserved. Keywords: DNA immunization; RSV; Rhesus monkeys

1. Introduction Respiratory syncytial virus (RSV) is major cause of infectious pulmonary disease in infants and children worldwide. Disease due to RSV infection occurs seasonally in both populations, however disease severity is maximal in infancy [1]. While the development of safe and efficacious vaccines for use in the neonatal population is a daunting task, it is requisite for successful RSV disease prophylaxis. Currently, there is no vaccine for use against RSV, nor is there any consensus regarding the most appropriate strategy to use in neonates. This is due in large part to several age-related issues associated with this target group. Immunological and developmental immaturity are the predominant issues for consideration in RSV vaccine research. However, an incomplete understanding of the combined influence of each of these early processes has hampered RSV vaccine progress for decades. Further∗ Corresponding author. Present Address: U.S. Navy Marine Mammal Program, Spawarsyscen, San Diego, CA, USA. Tel.: +1 619 767 4004; fax: +1 619 553 5068. E-mail address: [email protected] (K. Vaughan).

0264-410X/$ – see front matter © 2004 Elsevier Ltd. All rights reserved. doi:10.1016/j.vaccine.2004.10.046

more, the groups most susceptible to severe lower respiratory tract infection are pre-term infants and those with pre-existing conditions, such as asthma, congenital heart disease or bronchopulmonary dysplasia [2–4]. For these infants, lung function and development are significantly impaired, and immune responses to infectious microbes are compromised. In these susceptible populations, vaccine safety is of utmost importance. Therefore, the ability to safely and reliably induce protective and/or lasting immune responses in immunologically and developmentally healthy, albeit na¨ıve, as well as those most vulnerable groups remains to be established. Of parallel importance is the question of whether vaccinespecific immunity can be elicited and protective in the presence of maternally derived antibody. The presence of maternal antibody at the time of immunization has long been known to suppress or inhibit immune responses to a variety of conventional vaccines, including live-attenuated, inactivated and subunit formulations [5–8]. Not surprisingly, passively acquired (not maternally derived) antibodies have also been shown to decrease the immunogenicity of subunit, recombinant, as well as live-attenuated vaccines against RSV [9–11]. This phenomenon of passive antibody-mediated inhibition

K. Vaughan et al. / Vaccine 23 (2005) 2928–2942

of vaccine-specific immunity has therefore become a central challenge for neonatal vaccine design against RSV. Because moderate to high levels of RSV-specific maternal antibodies have been correlated with decreased disease severity [12,13], it is perhaps essential to develop an active immunization strategy that will complement pre-existing, passively acquired protection. Thus far, no conventional candidate vaccine strategy has demonstrated the necessary combination of safety and immunogenicity for use in neonates against RSV infection. With rare exception, killed/inactivated and subunit vaccines have been safe. However, these formulations have historically lacked good immunogenicity. While live-attenuated and recombinant viral vaccines have been strongly immunogenic, they lack stability, and are therefore unsafe for use in this target population. Moreover, these vaccine formulations remain vulnerable to passive antibody-mediated inhibition due to pre-existing maternal antibody. Gene-based immunization provides a unique tool with which to potentially provide targeted immunogenicity with the greatest potential for safety. DNA vaccines elicit both humoral and cellular immunity [14], and therefore have greater potential to provide more complete protection against RSV infection. Moreover, studies have shown DNA vaccines to be safe and immunogenic in neonatal animal models [15–18]. We hypothesized that plasmid DNA encoding specific viral immunogens would induce balanced humoral and cellular immune responses, and that these responses so elicited, would be protective against RSV in infant rhesus monkeys. Furthermore, we hypothesized that vaccination with the closely related bovine RSV genes would immunize better in the presence of maternally derived antiRSV antibodies. Bovine respiratory syncytial virus (BRSV) is a pneumovirus that produces a similar disease syndrome in young calves. Notable is that there is high degree of homology between BRSV and RSV immunogenic proteins (% homology provided below). To test this hypothesis, infant Rhesus macaques were inoculated with plasmid DNA encoding two key immunogens of bovine RSV. These animals were then challenged with a clinical isolate of human RSV. Our findings suggest that a DNA vaccine formulation can be safe, immunogenic and partially protective in infant monkeys injected as early as 1.5 months of age. These findings also suggest that, while moderate levels of pre-existing RSVspecific antibodies may affect humoral responses to DNA vaccines, they do not prevent the induction of specific IgG upon subsequent RSV exposure. Moreover, the presence of these pre-existing antibodies did not affect vaccine-induced cellular immunity, and therefore the ability of these monkeys to clear virus from their lungs. Whether these pre-existing antibodies were maternally derived or naturally acquired cannot be determined from this study. However, their presence is consistent with the natural scenario of RSV infection in human infants, and therefore is relevant to include in this investigation. Taken together, these data support the assertion that DNA vaccination may be an ideal vaccine strategy for use against RSV infection and/or disease in human neonates,

2929

and that the use of highly homologous bovine RSV genes may be useful in the presence of pre-existing RSV-specific antibodies.

2. Methods and materials 2.1. Animals and study design Infant rhesus monkeys (Macaca mulatta) were provided by the California National Primate Research Center (CNPRC, Davis, CA). The CNPRC maintains a colony of captive breeding adults for research purposes. The infants used in this study were nursery-reared, and at the time of the initial inoculation, were 1.5 months of age. Age-matched infants were included as controls. Due to their young age, the infants were housed in pairs for the duration of this study. The animal studies described herein were approved by the UC Davis’s Animal Use and Care Administrative Advisory Committee (AUCAAC). 2.2. Preparation of plasmid DNA The full-length fusion and nucleoprotein genes of BRSV (provided by Ursula Buchholz, Federal Research Center for Virus Diseases of Animals, Insel Riems, Germany) were subcloned into the BglII and XhoI sites of the eukaryotic expression vector pND (provided by Gary H. Rhodes, University of California, Davis, Davis, CA). DNA sequence homology between the bovine and human virus F and N genes 81% and 90%, respectively (GeneBank sequence analysis using Clone Manager 5, Scientific and Education Software, Durham, NC). The pND-F and pND-N constructs were then propagated in Escherichia coli, and transformants were selected based on their growth in the presence of ampicillin. Restriction enzyme analysis and DNA sequencing were performed to confirm the correct orientation and identity of the inserted genes. Constructs were prepared for injection using alkaline/SDS lysis, followed by two rounds of CsCl–EtBr gradient ultracentrifugation. Each plasmid was then evaluated for protein expression in vitro by Western blot analysis of cell supernatants following liposome-mediated cell transfection and then in vivo, by performing RSV-specific ELISA on sera from inoculation of mice (data not shown). 2.3. Vaccination and RSV challenge protocol Four of the six infants were vaccinated with plasmid DNA encoding the fusion (F) and nucleoprotein (N) of bovine RSV. Two of the six infants were unvaccinated controls. [A description of the preparation of each construct (pND-F and pNDN) is provided below.] Each vaccinated monkey received an injection of 200 ␮g of plasmid DNA in a total volume of 200 ␮l of sterile saline. All four vaccines received both pND-F and pND-N, injected separately into the quadriceps (200 ␮g of each plasmid in 200 ␮l injected into each mus-

2930

K. Vaughan et al. / Vaccine 23 (2005) 2928–2942

cle). All vaccinated animals received their first injection at 1.5 months of age, followed by a booster injection 1 month later. All six infant monkeys were experimentally infected with RSV 8 weeks following their initial inoculation. Three of the six animals were sacrificed on day 7 of infection to document histopathological and virological changes within the lungs. The remaining three animals were sequestered for a period of 72 days post-infection to compare the longevity of humoral responses among vaccinated and unvaccinated animals. Each infant pair was infected via aerosolization (day 0) [details of aerosolization procedure provided below] with a clinical isolate of human RSV. The animals were then monitored over a period of 7–10 days. Mock-infected infants (receiving supernatant from uninfected cells) were included as negative (uninfected and unvaccinated) controls. Over the course of experimental infection, daily physical examinations were performed in order to assess clinical disease progression. Immunological and virological assays were also performed to evaluate the immunogenicity and protective efficacy of the vaccine formulation. On day 7 of infection, necropsy was performed on three of six infected animals, and all of the mock-infected controls, in order to make virological and histopathological determination of pulmonary disease severity. Table 1 provides an outline of the experimental groups, and Fig. 1 provides a timeline of the vaccination protocol.

2.4. Clinical examinations Following exposure to virus, blinded physical examinations were performed daily to assess, and document, the development of clinical disease in each animal. The examinations included: rectal temperature, respiratory and heart rates, body weight, and auscultation of the lungs. Adventitious breath sounds were recorded as present (+) or not present (−). Peripheral blood was drawn via saphenous venipuncture to monitor serum antibody levels and to isolate PBMCs for assaying cellular effector function.

Table 1 Animal and treatments Animal

Treatment

RSV-infected infants MMU 32832 MMU 32834 MMU 32836* MMU 32837* MMU 32839 MMU 32845*

Vaccinated Unvaccinated control Vaccinated Unvaccinated control Vaccinated Vaccinated

Mock-infected controls MMU 33172* MMU 33189* MMU 33190*

Unvaccinated Unvaccinated Unvaccinated

The above table provides an overview of participating animals and their corresponding treatments. A total of six study animals were divided into two groups. All six were exposed to virus. Three of the infants were sacrificed on day 7 post-infection and three were monitored for an extended period, in order to monitor and compare serological responses. Each group consisted of two vaccinated animals and one unvaccinated control. Three age-matched infants were used as negative mock-infected controls. (* ) indicates animals euthanized day 7 post-infection or post mock-infection for necropsy.

2.5. Virus propagation HEp-2 cells were seeded onto a 150 cm2 tissue culture flask and grown overnight to 80% confluency. The cells were washed with sterile Hank’s Balanced Salts (HBSS, Sigma Chemical Co., St. Louis, MO) and inoculated with a clinical isolate of human RSV strain A (provided by the UCD Medical Center, Sacramento, CA and propagated from frozen stock maintained in the laboratory of the PI) using a minimal volume of Dulbecco’s MEM containing 10% FCS and antibiotics (DMEM-10, Sigma, St. Louis, MO). The virus was then allowed to absorb for one hour at 37 ◦ C (5% CO2 ). Following absorption, fresh media was added, and the infected cells were grown at 37 ◦ C for 5 days, or until the first sign of cytopathic effect (CPE). The virus was prepared for aerosolization by first removing the culture medium from the cells to retain any extracellular virus. This was reserved on ice. The cells were then rapidly frozen and thawed in order to lyse the cell membrane and release intracellular virus. The

Fig. 1. Timeline of vaccination protocol: infant monkeys were immunized at 1.5 months of age (week 0). Four animals received a vaccine formulation containing plasmid DNA encoding both immunogens (F and N), and two animals remained unvaccinated controls. Four weeks later, identical booster injections were administered. Eight weeks following the initial vaccination, all six monkeys were experimentally changed with a clinical isolate of human RSV. The period of experimental infection was 10 days. Three animals were sacrificed on day 7 of infection in order to assess the quantity of virus within the lung and disease severity. Three animals were monitored immunologically for 71 days post infection.

K. Vaughan et al. / Vaccine 23 (2005) 2928–2942

lysed cells were then pelleted by centrifugation at 3000 rpm for 10 min. The two supernatants were pooled and reserved on ice for aerosolization. The inoculum for the mock-infected controls was prepared as above, with the exclusion of virus. 2.6. Virus titration To determine the titer of the virus used in each exposure, a standard TCID50 was performed on the viral supernatant, prior to and following aerosolization. For this, 48 well tissue culture plates (Corning, New York, NY) were seeded with HEp-2 cells and grown to 80% confluency. The cells were then washed once with HBSS and 1 ml of fresh DMEM-10 was added to each well. Serial dilution of virus was then performed, in triplicate, using 0.1 ml of the viral supernatant. The dilutions ranged from 10−1 to 10−7 . Negative controls were included. The plate was incubated at 37 ◦ C (5% CO2 ) and read at 5–7 days. At this time, the cells were examined for the presence of CPE (syncytial formation and/or cell lysis) and the titer was calculated by determining the reciprocal of the highest dilution at which 50% of the inoculated wells were infected. [Note: Virus potency is not affected through the process of exposure. Viral titers remain unchanged postaerosolization (data not shown)]. 2.7. RSV aerosol infection Infant monkeys were exposed to virus aerosol using a concurrent flow spirometry inhalation exposure system, as described previously [19]. Briefly, an aerosol of the viral supernatant was generated in a closed system using a commercially adapted nebulizer (MiniHEARTTM , Westmed Inc.). The aerosolized virus was then conveyed directly into a facemask forming an airtight seal with the muzzle of the animal. A pneumotachograph, pressure transducer and a computerbased pulmonary physiology platform (Ponemah, Gould Instruments Systems Inc.) functioned as a spirometer, which provided real-time measurements of the respiratory rates and volumes during the exposure period. Prior to exposure, each infant monkey received a baseline physical examination. At this time, peripheral blood was drawn for serology and cellular assays. Each animal was then anesthetized using Telazol (10 mg/kg) and fitted with a modified veterinary anesthesia mask (Jorgensen Laboratories Inc.). Each animal received an aerosol of approximately 1 × 107 TCID50 of the clinical isolate of human RSV. Each infant was exposed to 4 ml of aerosolized virus over a period of 30 min. Mock-infected control infants received an aerosol of cell lysate and media alone. 2.8. RSV-specific IgG The serum of each infant was assayed for the presence of total anti-RSV IgG. This was accomplished using a standard ELISA. Ninety-six well, flat-bottom microtiter plates (Becton Dickinson, Franklin Lakes, NJ) were sensitized using

2931

sucrose density gradient purified RSV (strain A2; provided by Barney S. Graham, Vanderbilt University, Nashville, TN) at 1 ␮g/well. Each plate was then incubated overnight at 4 ◦ C. The plates were blocked with 100 ␮l/well of 1% rabbit serum albumin (RSA), and all washes were performed using a 0.1% solution of PBS-Tween 20. Control and sample sera were then added at 100 ␮l/well at a dilution of 1:25. Serum from an adult rhesus monkey immunized with a FI-RSV (propagated and inactivated in the laboratory of the PI) was used as a positive control. Pooled negative (normal) sera (donor animals from CRPRC) and 0.1 M PBS were used as negative controls. The detecting antibody [goat anti-rhesus IgG (H + L) − HRP, Southern Biotechnology Associates, Birmingham, AL] was used at a dilution of 1:3000 in PBS. Each plate was developed using 200 ␮l/well of the substrate (ophenylenediamine). Absorbance (OD) values were measured using a microplate reader (Molecular Devices, Menlo Park, CA) at dual wavelength (450–650 nm). RSV-specific IgG was not determined for mock-infected controls, as humoral responses were not used in the evaluation of disease severity. Data presented represent corrected absorbance values (OD). In order to make comparisons between plates, corrected sample absorbances (CSA) were calculated by multiplying the individual sample ODs by the mean of positive control values from all plates and dividing by the positive control OD from each plate. Due to the presence of RSV-specific antibodies in a majority of CNPRC macaques, the evaluation of vaccine responsiveness in this study was made by demonstrating a change in RSV-IgG levels from baseline (day 0, week 0). 2.9. Histopathology Necropsy was performed day 7 of infection on three of the six infected infants: MMU 32836 (vaccinated), MMU 32837 (unvaccinated control) and MMU 33845 (vaccinated), and all three of the mock-infected controls (MMU 33172, MMU 33189 and MMU 33190). Sections of lung (cranial, middle and caudal) and lymph nodes (tracheobronchial) were removed for blinded histopathological examination. Samples were preserved in formalin, paraffin-embedded and stained with haematoxylin and eosin for microscopic examination. Histopathological changes were documented and described. 2.10. Elispot assay Elispot assays were performed in order to determine the frequency of RSV-specific, IFN␥-producing T lymphocytes. Ninety-six well nitrocellulose plates (Multiscreen-HA, Millipore, Bedford, MA) were coated overnight at 4 ◦ C with 50 ␮l of 10 ␮g/ml of mouse anti-human (with rhesus crossreactivity) IFN␥ monoclonal antibody (GZ-4, MABTECH AB, Nacka, Sweden). Plates were washed with 0.1 M PBS with 0.25% Tween 20 and then blocked with RPMI-10 for 1 h at 37 ◦ C. Fresh peripheral blood mononuclear cells (PBMC) from each monkey were used as virus-infected syngeneic targets, uninfected controls and effectors. Targets were infected

2932

K. Vaughan et al. / Vaccine 23 (2005) 2928–2942

for 24 h with RSV A2 at 1:100 dilution (1 × 107 TCID50 ). The targets were then irradiated at 3000 rads and resuspended at a concentration of 4 × 104 cells/ml. Pooled effector cells from each group were added to the plate and diluted two-fold (in quadruplicate). PBMCs from unvaccinated infants were included as a negative control. Samples were tested in parallel with uninfected targets. Effector cells were incubated with targets at E:T ratios of 50:1, 25:1 and 12.5:1 for 24 h at 37 ◦ C (5% CO2 ) in a total volume of 100 ␮l. Following incubation, all wells were washed and remaining cells were lysed with DI water. Fifty microliters of 5 ␮g/ml biotinylated mouse anti-human (with rhesus crossreactivity) IFN␥ (7-B6-1, MABTECH AB, Nacka, Sweden) were then added and the plate was incubated at room temperature for 2 h. All wells were washed and 50 ␮l of streptavidin alkaline phosphate (BioRad, Richmond, CA) at 1/1000 dilution was added. The plate was incubated at room temperature for 1 h. Finally, plates were developed for 30 min using a BCIP-NBT substrate (BioRad, Hercules, CA). The resulting spots were counted using a dissecting microscope and were reported as the number of virus-specific, IFN␥producing cells/106 PBMC. 2.11. RNA isolation from lung tissue Total RNA was isolated from the lungs of each monkey using a guanidinium thiocyanate (GIT), phenol–chloroform extraction. Briefly, the entire left lung lobe of each animal (5 g) was aseptically homogenized in 1 ml of RNAzolTM B reagent (Tel-Test Inc., Friendswood, TX) Each sample was then centrifuged at 3000 rpm for 10 min to pellet cellular debris. The resulting supernatant was stored on ice. Total RNA was then isolated using phenol–chloroform extraction, followed by isopropanol precipitation. RNA pellets were resuspended in appropriate volumes of diethyl pyrocarbonate (DEPC)-treated water. Concentrations were determined by spectrophotometric analysis at 260 and 280 nm. 2.12. Determination of RSV RNA in lungs post-challenge Extracts of RNA from lung tissue were subjected to semiquantitative PCR coupled with reverse transcription analysis to compare the relative levels of viral mRNA between vaccinated, unvaccinated and control monkeys. Viral RNA from RSV strain A (isolated from tissue culture) was included as the positive control. Primers directed against HRSV N were adapted from Loveys et al. [20]: 5 taactcaaa gctctacatcat3 (forward) and 5 acgcgtcgaccacagcttctatgaagtg3 (reverse). Briefly, 1 ␮g of total RNA was reverse transcribed using oligo dT primers to drive first strand synthesis in the following 20 ␮l reaction: 50 mM KCl, 10 mM Tris–HCl (pH 8.3), 5 mM MgCl2 , 1 mM each of deoxynucleotide triphosphate (dNTP), 1 U RNase inhibitor and 2.5 U MuLV reverse transcriptase. The mixture was then incubated for 10 min at 25 ◦ C, 30 min at 42 ◦ C and 5 min at 98 ◦ C. The resulting products were am-

plified in the following 100 ␮l reaction: 2 mM MgCl2 , 40 mM KCl, 8 mM HCl (pH 8.3) and 2.5 U AmpliTaq® using 50 pmol of each primer. The PCR reaction mixture was incubated for 2 min at 95 ◦ C, and then 35 cycles of 45 s at 95 ◦ C, 45 s at 55 ◦ C, and 1 min at 72 ◦ C. A 7 min final extension step was run at 72 ◦ C. PCR products were analyzed by electrophoresis through a 1.8% gel in the presence of ethidium bromide. The presence of a band at 441 bp was considered positive for RSV. Semi-quantitative analysis was performed by densitometry using Alphaimager 3.2 software and the IS-1000 Digital Imaging System (Alpha Innotech Corporation, San Leandro, CA). Raw densitometry scores for each animal were normalized by comparison to that of the positive RSV RNA standard. Sample to positive ratios were also generated for all sacrificed infants (MMU 32836, MMU 32837, MMU 32845, MMU 33172, MMU 33189 and MMU 33190). Note these data represent relative, and not absolute values. 2.13. Cytokine analysis The level of IL-2, IL-4, IL-6, IL-12p40, IL-15 and IFN␥ mRNA in the lungs of vaccinated, unvaccinated and control infants was measured using RT-PCR (RNA Core Kit Applied Biosystems, Branchburg, NJ). Briefly, 1 ␮g of total RNA was reverse transcribed as described above. PCR products were analyzed by electrophoresis through 1.8% gels in the presence of ethidium bromide. Semi-quantitative analysis was performed by densitometry using Alphaimager 3.2 software and the IS-1000 Digital Imaging System (Alpha Innotech Corporation, San Leandro, CA). Raw densitometry scores for each cytokine were normalized by comparison to the scores of mock-infected controls. The sequences and sources for all cytokine primers used are listed in Table 2. 2.14. Data analysis One-tailed Student’s t-tests were used to establish statistical significance between vaccinated and unvaccinated animals for serology using baseline values (week 0) as a set point. These differences were then compared to data obtained from healthy, mock-infected controls. Statistical significance was assigned to p values of less then 0.05. Vaccine immunogenicity and disease severity were assessed using histopathological evidence and virology (RSV RNA and TCID50 ). Distinctions in experimental outcome were made both qualitatively and quantitatively. Due to the low number of animals per group, statistical significance could not be determined for all of the data herein.

3. Results 3.1. Clinical findings Daily physical examinations were performed on all infant monkeys in order to document clinical changes following

K. Vaughan et al. / Vaccine 23 (2005) 2928–2942

2933

Table 2 Sequence and sources of cytokine-specific PCR primers Cytokine

Sequence

Source

5 ATGTACAGGATCCAACTCCTGTCTT3

IL-2

(S) (A) 5 GTTAGTGTTGAGATGATGCTTTGAC3

Arredondo et al. [50]

IL-4

(S) 5 ATGGGTCTCACCTCCCAACTG3 (A) 5 TCAGCTCGAACACTTTGAATATTTCTCTCT 3

Arredondo et al. [50]

IL-6

(S) 5 ATGAACTCCTTCTCCACAAG 3 (A) 5 CGGATTTCTACATTTGCCGAAGAGCCCTCAG3

Arredondo et al. [50]

IFN␥

(S) 5 CAGCTCTGCATTGTTTTGGGT3 (A) 5 CATCTGACTCCTTTTTCGCTT3

Arredondo et al. [50]

IL-12p40

(S) 5 GCCCAGAGCAAGATGTGTCA3 (A) 5 GCTTAGAGCCTCGCCTCCT3

Villinger et al. [51]

IL-15

(S) 5 GACTCGAGAAGCTTAAGGATTTACCGTGGCTTTGAG3 (A) 5 TCGAATTCTAAGCAGCAGAGTGATGTTCGTT3

Villinger et al. [51]

All primers are specific to Rhesus macaques and were adapted and modified from listed citations [50,51].

RSV infection. These data were used to assess possible differences in disease severity between vaccinated and unvaccinated groups. There were no significant differences in heart rate or body weight values over the period of infection for any group. Quantitative and qualitative differences were observed in body temperature, respiratory rates and lung sounds. Fig. 2 shows respiratory rate and body temperature values recorded over the course of experimental infection (days 0–7) for vaccinated, unvaccinated and mock-infected monkeys. Mean body temperatures and respiratory rates were higher in unvaccinated animals. Fig. 2(a) shows mean body temperatures of 101.1 ◦ F [±0.035], 100.4 ◦ F [±0.72] and 101 ◦ F [±0.14] for unvaccinated, vaccinated and mock infected controls, respectively. Fig. 2(b) shows mean respiratory rates of 63.9 [±22.45], 58.1 [±6.62] and 55.7 [±1.13] breaths per minute for unvaccinated, vaccinated and mock-infected controls, respectively. Interestingly, the mean body temperature of the mock-infected controls was nearly equal to that of the unvaccinated infants. However, data from a previous study suggest that the determination of the average increase in body temperature over baseline is more representative of changes due to experimental infection [19]. Indeed, the average increase in body temperature (◦ F) from baseline values (on day 0) was highest for the unvaccinated infants, and lowest for the mock-infected controls (Fig. 2(c)). Mild to moderate lungs sounds were noted in both unvaccinated infants and three out of four vaccinated infants. In all, unvaccinated infants exhibited lung sounds 56.3% of days infected, and vaccinated infants exhibited lungs sounds 43.8% of days infected (data not shown). No adventitious lung sounds were recorded on any day for mock-infected controls. 3.2. RSV-specific IgG Changes in RSV-specific IgG were determined using standard ELISA. Sera from all infants were drawn at intervals over the periods of immunization and experimental infection. Results are presented as mean corrected absorbance values.

The data for all six animals are presented in Fig. 3. This figure depicts virus-specific antibody responses baseline (day 0) through sacrifice on day 7 (Fig. 3(a)), or through day 22 for the infants that were not sacrificed (Fig. 3(b)). Two of the four vaccinated infants (MMU 32832 and MMU 32845) showed vaccine-induced antibody responses, increasing incrementally from the time of initial vaccination (weeks 0–8). These two vaccinated animals demonstrated statistically significant increases (from week 0) in RSV-specific antibodies as soon as week 4 (p = 0.001, MMU 32845), on week 6 (p = 0.004, MMU 32832 and p = 0.0007, MMU 32845) and on week 8 (p = 0.004, MMU 32832 and p = 0.0002, MMU 32845). The other two vaccinated infants (MMU 32836 and MMU 32839) appeared to be non-responsive following vaccination. In these animals it is possible that higher levels of preexisting, RSV-specific antibodies may have interfered with the induction of humoral responses. Fig. 4 provides a comparison of the levels of RSV-specific IgG pre-vaccination. Indeed, higher levels of RSV-specific antibody were measured in the two non-responsive infants (MMU 32836 and MMU 32839) prior to immunization. When comparisons were made of RSV-specific antibodies present at all three points, neonate, 1 month and day 0, the non-responsive animals (average of MMU 32836 and MMU 32839) had levels 66%, 87% and 47%, respectively, greater than the four other animals on the same days. Following immunization, little or no change in specific antibody was observed for unvaccinated monkeys, weeks 0–8. The evaluation of responses following RSV challenge show that when compared to the unvaccinated controls (MMU 32834 and MMU 32837), the vaccinated infants (MMU 32832 and MMU 32845) responded more vigorously by days 7 and 14 post-infection. Fig. 5 compares antibody levels measured week 8 (post-vaccination, pre-challenge) with serum samples drawn days 51 and 72 post-infection (three animals not sacrificed day 7). More than 2 months after experimental RSV infection, all infants showed similar levels of elevated RSV-specific antibody. Although MMU 32839 was unresponsive immediately following vaccination (as evident

2934

K. Vaughan et al. / Vaccine 23 (2005) 2928–2942

Fig. 2. Clinical evaluations of all infants over the period of experimental (and mock) RSV infection revealed quantitative differences between groups. (a) and (b) depict the mean temperature increase (◦ F) from baseline (day 0) and respiratory rates (breaths/min), respectively, for all three groups (vaccinated, unvaccinated and mock-infected controls) days 0–7. (c) and (d) represent summaries of group responses for body temperature and respiratory rates, respectively. Comparisons between groups for mean body temperatures were 100.4 ◦ F [±0.72] for vaccinated, 101.1 ◦ F [±0.035] for unvaccinated and 101 ◦ F [±0.14] for mock-infected controls. Mean respiratory rates (in breaths/min) for all groups were 58.1 [±6.62] for vaccinated, 63.9 [±22.45] for unvaccinated and 55.7 [±1.13] for mock-infected controls.

by RSV-IgG levels week 8), this animal did produce comparable levels of RSV-specific IgG by day 72. Importantly, this suggests that the initial unresponsiveness of this animal to DNA vaccination did not appear to alter its ability to respond humorally to subsequent RSV infection. Sera from a representative panel of infant monkeys, referred to as normals, were tested to establish baseline levels of RSV-specific IgG in un-infected, like animals (data not shown). When the levels of RSV-specific antibodies for normals were compared to the levels of study animals on day 0, percent of positive control were 41% and 40%, respectively.

3.3. RSV-specific cellular responses RSV-specific cellular responses were determined by measuring the production of IFN␥ by peripheral blood lymphocytes in vitro. Fig. 6 depicts RSV-specific IFN␥ production by the infants not sacrificed day 7. By day 14 post-infection, the vaccinated infants demonstrated higher numbers of virus-specific IFN␥ secreting cells than the unvaccinated control. The spot formation data, presented as spot forming units (SFU) per 106 PBMCs, indicated a frequency of 23.3 SFU/106 cells for MMU 32832, 23.3 SFU/106

K. Vaughan et al. / Vaccine 23 (2005) 2928–2942

2935

Fig. 3. RSV-specific IgG: serological data of RSV-specific IgG for those infants sacrificed day 7 following live viral challenge (a), and those infants that were sequestered (not sacrificed on day 7) post-infection through day 22 (b). The arrows indicate the time of RSV challenge. Data represents mean absorbance values (and standard deviations) for each time point. When compared to unvaccinated monkeys (MMU 32834 and MMU 32837), two of the vaccinated monkeys (MMU 32832 and MMU 32845) had significantly higher RSV-specific antibody levels generated between weeks 0 and 8 pre-challenge (p = 0.004 and p = 0.0001, respectively).

cells for MMU 32839 (vaccinated) and 16.7 SFU/106 cells for MMU 32834 (unvaccinated). Attempts to measure RSVspecific IFN␥ production in the animals sacrificed on day 7 failed due to very low cell numbers obtained from peripheral blood. While the low numbers of responding animals prevents the evaluation of statistical significance, these data do show a difference in RSV-specific IFN␥ production between at least one vaccinated infant (MMU 32839) and the unvaccinated control (MMU 32834). While the observed data for the second vaccinated animal (MMU 32832) was equal to that of MMU 32839, high background measured in the un-infected control cells for this animal prevents us from drawing significance from this data. Elispot assays performed pre-vaccination indicated no RSV-specific IFN␥

production prior to immunization in any animal (data not shown). 3.4. Virus titration in the lung Standard TCID50 was performed to determine the titer of RSV in the lungs of infants sacrificed on day 7, in order to make comparisons between groups. The titration of lung supernatants revealed active viral replication in the lungs of only MMU 32837 (unvaccinated control [1 TCID50 /ml]). No virus was re-isolated from the lungs of either vaccinated infant (MMU 32836 and MMU 32845), nor mock-infected controls (MMU 33172, MMU 33189 and MMU 33190). While viral titers measured here were seemingly low, these data are

2936

K. Vaughan et al. / Vaccine 23 (2005) 2928–2942

Fig. 4. RSV-specific IgG levels prior to vaccination: in order to evaluate the possibility of antibody contributing to vaccine suppression, a comparison of RSV-specific antibody levels existing prior to vaccination (day 0) was made. Data represents mean absorbance values (and standard deviations) for neonatal sera, 4-week sera (1 month) and sera taken day 0. Higher levels of RSV-specific antibody were observed in the two non-responsive infants (MMU 32836 and MMU 32839) prior to immunization. When comparisons were made of RSV-specific antibodies present at all three time points, neonate, 1 month and day 0, the non-responsive animals (average of MMU 32836 and MMU 32839) had levels 66%, 87% and 47%, respectively, greater than the average of the four other animals on the same days.

consistent with previous titers determined using this model of infection [19]. It is possible that in this model maximal viral replication occurs later than day 7, and that we have missed the appropriate window for detection. This may be a worthy consideration for future studies. 3.5. RSV mRNA in the lung Total RNA isolated from the lungs of the animals sacrificed on day 7 was assayed for the presence of RSV N mRNA. The resulting cDNAs were visualized on agarose

gel in the presence of ethidium bromide, and band densities were quantified for comparison between animals. RT-PCR was performed in order to measure the RSV lung mRNA of vaccinated infants (MMU 32836 and MMU 32845) unvaccinated infant (MMU 32837) and mock-infected controls (MMU 33172, MMU 33189 and MMU 33190). RSV A2 RNA (provided by Dr. B. Graham; grown on HEp-2 cells) was used as positive control. The greatest band intensity was observed in lane 2 for MMU 32837 (unvaccinated). Faint bands can be observed in lane 1 (MMU 32836) and lane 3 (MMU 32845), however, these signals are just above background

Fig. 5. RSV-specific IgG through day 72 post-infection: ELISA data shows the level of RSV-specific IgG generated following vaccination, pre-challenge (week 8) and those levels achieved by days 51 and 72 post-infection. These data represent humoral responses in infants not sacrificed on day 7. Data represent mean absorbance values (and standard deviations) for each time point. More than 2 months after experimental RSV infection, all infants showed similar levels of elevated RSV-specific antibody. Although MMU 32839 was unresponsive immediately following vaccination (as evident by RSV-IgG levels week 8), this animal did produce comparable levels of RSV-specific IgG by days 51 and 72.

K. Vaughan et al. / Vaccine 23 (2005) 2928–2942

2937

Fig. 6. RSV-specific IFN␥ on day 14 post-infection: cellular responses were investigated using ELISPOT to measure the production of IFN␥ by PBMCs from vaccinated and unvaccinated animals in response to RSV infected targets. Results are presented as spot forming units (SFU) per million (106 ) cells. The frequency of IFN␥ production was as follows: 23.3 SFU/106 for MMU 32832 (vaccinated), 23.3 SFU/106 for MMU 32839 (vaccinated) and 16.7 SFU/106 for MMU 32834 (unvaccinated control). Higher background was observed for MMU 32832 un-infected targets.

levels. No signal was detected in the lung tissue of mockinfected controls. Relative lung RSV mRNA levels are presented in Fig. 7. These values represent the ratio of the sample band intensity to that of the positive RSV control. Background fluorescence was subtracted out using the values generated by the mock-infected controls. The sample to positive ratio calculated for each infant was as follows: MMU 32836 (0.093), MMU 32837 (0.571) and MMU 32845 (0.083). The level of RSV mRNA in lungs of the unvaccinated control was determined to be more than six times higher than levels mea-

sured for the two vaccinated animals sacrificed day 7 postinfection. 3.6. Histopathology of the lungs Blinded histopathological evaluations were made of lung tissue for those infants sacrificed on day 7 post-infection. Formalin-preserved, paraffin-embedded sections of lung were stained with H&E and then examined microscopically. All three animals evaluated showed mild pneumonia at the time of necropsy. This pneumonia was characterized by small

Fig. 7. Relative RSV mRNA levels in the lung of sacrificed monkeys: RSV mRNA signals were measured using RT-PCR and then quantified by densitometry on agarose gels. The presence of a band at 441 bp was considered positive. The values depicted above represent the relative ratio of integrated density values (IDV) to the positive control (RSV strain A). Background fluorescence was subtracted out using the values generated by the mock-infected controls. The sample to positive ratio calculated for each infant was as follows: MMU 32836 (0.093), MMU 32837 (0.571) and MMU 32845 (0.083).

2938

K. Vaughan et al. / Vaccine 23 (2005) 2928–2942

Fig. 8. Pulmonary histopathology: histopathological findings in the lungs of the infants sacrificed day 7 of infection. The above panels show findings typical for each animal. Note that while all infants show some degree of pneumonic consolidation, the extent of lymphocytic infiltration was less in vaccinated animals (MMU 32836 and MMU 32845), when compared with the unvaccinated control (MMU 32837). An image from a healthy, mock-infected control was provided for comparison (MMU 33190).

numbers of lymphocytic and histiocytic inflammatory cell infiltrates which were present in the walls and lumens of the terminal conducting airways, as well as in the septa and lumens of adjacent alveoli. MUU 32837 (unvaccinated) and MMU 32845 (vaccinated) both showed a higher degree of bronchiolar involvement. Interestingly, MMU 32845 also had areas of type II pneumocyte hyperplasia (image not available). The activity of this cell type is often associated with early reparative processes in the lung following RSV infection [21,22]. MMU 32836 showed very mild pneumonic consolidation when compared to MMU 32837 and MMU 32845. Fig. 8 provides images that show typical histopathological findings for each of the infants. Lung sections from healthy mock-infected controls were included for comparison. 3.7. IFN␥ in the lung Total RNA isolated from the lung of the infants sacrificed on day 7 was used to characterize differences in cytokine production between groups. RT-PCR was used to determine mRNA levels for each cytokine. Differences in the level of mRNA were observed for IFN␥, only. Band densities were quantified by densitometry and reported as integrated density values (IDV). Fig. 9 depicts the band densities recorded

for MMU 32836 (vaccinated), MMU 32837 (unvaccinated) and MMU 32845 (vaccinated), normalized to that of mockinfected controls. The inclusion of mock-infected control values was so that the data would more accurately reflect IFN␥ responses specific to RSV infection. Values for IFN␥ mRNA levels indicated that the unvaccinated monkey, MMU 32837, was nearly 1.8 and 4.3 times that of the vaccinated monkeys (MMU 32836 and MMU 32845, respectively). 4. Discussion Here we described a DNA vaccine formulation that was safe, immunogenic, and partially protective in infant rhesus monkeys immunized as early as 1.5 months of age. Moreover, it is possible that this partial protection was induced in the presence moderate levels of pre-existing RSV-specific antibody, despite its seemingly suppressive affect on vaccinespecific antibody responses early on. We believe that the moderate degree of protection observed in these infant monkeys was therefore a result of a combination of both humoral and cellular responses. This is not the first report of a gene-based vaccine tested against human respiratory syncytial virus [23–26]. However, this work does represent a

K. Vaughan et al. / Vaccine 23 (2005) 2928–2942

2939

Fig. 9. IFN␥ mRNA levels in the lung day 7 post-infection: the figure depicts sample integrated density values (IDV) for each of the experimentally infected monkeys, minus IDV from the mock-infected controls. IDV were as follows: 9441 MMU 32836 (vaccinated), 18,111 MMU 32837 (unvaccinated), and 4239 MMU 32845 (vaccinated). Primers for PCR were adapted from Arrendondo et al. (details in Table 2).

novel approach to the induction of partial immunity, using a combination of viral immunogens in a plasmid DNA format. That this affect was elicited by genes taken from a heterologous virus (bovine RSV) underscores the ability of DNA vaccines to generate cross-protective immunity through the incorporation of conserved viral proteins [27]. This study also represents a unique approach to investigate immunization strategies for newborns, in a non-human primate model of RSV disease. The clinical evaluation of study animals revealed qualitative and quantitative differences between vaccinated and unvaccinated groups. All RSV infected infants demonstrated mild symptoms of clinical disease. This finding is consistent with earlier work in the laboratory of the PI [19]. However, subtle distinctions could be made between experimental groups. When comparisons were made between vaccinated, unvaccinated and mock-infected controls, unvaccinated infants showed higher mean respiratory rates, the greatest increase in body temperature and an increased frequency of adventitious lung sounds. While the statistical significance of these findings could not be made, comparisons between groups provided a means with which to establish meaningful trends. Perhaps most importantly, the degree of clinical severity was consistent with the virological and histopathological data observed in the lung at the time of necropsy. The characterization of antibody responses was performed in order to evaluate the immunogenicity the DNA vaccine formulation, and to determine its effect following live-virus challenge. Vaccine-induced humoral responses (weeks 0–8) were observed in only two of the four infants immunized. However, analysis of the pre-sera (taken prior to week 0) from the two non-responding infants revealed higher levels of preexisting RSV-specific IgG. This suggests that pre-existing antibody present at the time of initial inoculation may have had suppressive effects on vaccine-induced humoral responses in these infants. High levels of RSV-specific antibody have been documented in captive populations of infant rhesus monkeys

[28] [Vaughan, unpublished]. This unresponsiveness lasted through day 22 post-infection for at least one animal. It cannot be determined unequivocally from these data whether the preexisting antibody was maternally derived or naturally acquired. However, Elispot assays performed pre-vaccination (data not shown) indicated no virus-specific cellular activity in any animal, suggesting that these monkeys had not been previously exposed to virus. When comparisons were made between the RSV-specific IgG antibody levels of the unresponsive monkeys weeks 0–8, to levels achieved by the vaccine-responsive animals, the levels of specific antibody in the unresponsive infants during this time were determined to be equal to, or slightly greater than the levels achieved by immunized infants (observation from Fig. 4). It can be inferred from this that the levels of virus-specific antibody pre-existing in the unresponsive animals may have been adequate to provide some protection against challenge, despite their seemingly suppressive effects on antibody production following immunization. It is important to note that this apparent suppressive effect did not inhibit the subsequent induction of virus-specific IgG following experimental RSV infection as evidenced by data from days 51 and 72 postinfection. The induction of cellular responses using naked DNA is considered one of the major advantages of this vaccine modality. Thus, we sought to evaluate the extent of vaccine-induced cellular responses, and to correlate RSV-specific IFN␥ production in peripheral blood with the level of RSV in the lung. The assay performed on day 14 post-infection for the remaining infants did reveal higher levels of RSV-specific IFN␥ production in at least one of the vaccinated infants than in the unvaccinated control. Although it was anticipated that RSV-specific CMI would have been present by day 14 in all experimentally infected animals, these data suggest that vaccination may have enhanced responses in those infants that were immunized. Moreover, these findings are consistent with earlier work in which DNA vaccine-induced cellular

2940

K. Vaughan et al. / Vaccine 23 (2005) 2928–2942

responses were not affected/suppressed by pre-existing antibody [29–32]. Due to the absence of RSV-specific antibody recorded for MMU 32839 through day 22, it is reasonable to suggest that CMI played a dominant role in the attenuation of clinical signs observed in this animal. The frequency of RSV-specific IFN␥ secreting cells appears to be relatively low in these animals. However, a comparison of these responses to those found in the literature for other species, indicates that these infants are within the acceptable range for an out bred primate population [33–35]. Indeed, work by van Besouw et al. [36] suggests that the generation of IFN␥ producing cells in the peripheral blood of rhesus monkeys is age-related. It is therefore not surprising that infant monkeys would produce antigen-specific effector cells at much lower frequencies than those recorded in the current literature for adult animals. The higher background (RSV-specific IFN␥ in uninfected cells) observed for MMU 32832 is likely attributable to imperfections in the Elispot assay. Indeed, the use of syngeneic PBMCs as target cells increases the overall likelihood of background due to the potential for non-specific cell-to-cell interactions, despite irradiation treatment. The level of IFN␥ mRNA in the lung was assayed in order to gain insight into the cellular responses of those animals sacrificed on day 7. We hypothesized that lung IFN␥ levels on day 7 would be of parallel ratio between groups (not necessarily of equal magnitude) to IFN␥ production measured on day 14. However, the highest levels of lung IFN␥ mRNA from day 7 were observed in the unvaccinated animal. It is possible that the increased IFN␥ levels measured in the lung of this infant were a result of the ongoing viral replication, as measured by TCID50 and RT-PCR, and/or reflects an accelerated IFN␥ response (prior to day 7) in the vaccinated monkeys. Indeed, cytokine analysis of calves infected with bovine RSV show that peak IFN␥ responses occur on days 5–7 of infection [37]. Comparisons between the level of RSV and histopathological changes in the lung at the time of necropsy (day 7) were used to demonstrate the protective efficacy of the DNA vaccine formulation. While the lungs from all sacrificed infants showed some degree of histopathological change following RSV infection subtle differences were observed between vaccinated and unvaccinated animals. When compared to the unvaccinated control, lung from vaccinated infants had less pneumonic consolidation and/or evidence of early reparative processes. Indeed, the presence (and number) of type II pneumocytes along the alveolar walls and bronchiolar epithelium has been associated with reparative processes following RSV infection [21,38]. Histopathological findings, in concert with the virological and clinical data, provide evidence that disease severity may have been less in vaccinated infants. While vaccination did not prevent the development of pulmonary disease altogether, these data suggest that vaccinated infants had reduced histopathology and/or somewhat accelerated disease resolution following live-virus challenge.

The functional capacity of the neonatal immune system has been an ongoing question mark for vaccine efficacy in this population. Indeed, the immaturity of the neonatal immune system has been associated with increased morbidity and mortality in human infants exposed to infectious disease [39]. However, immunological evidence from the literature does provide encouragement [40–49]. The implication of these findings is that successful neonatal immunization should be an attainable goal. DNA-based vaccines represent the most adaptable of all vaccine strategies, and therefore may be uniquely useful in this respect. The study presented herein demonstrates not only the potential utility of DNA vaccines for use in neonates, but it also highlights the importance of evaluating candidate vaccines in immunologically parallel and relevant host systems. Our data suggest that a DNA vaccine formulation containing homologous but not identical genes was immunogenic and partially protective in infant rhesus monkeys immunized in the first few weeks of life. However, the influence of pre-existing antibody on vaccine-induced humoral responses remains unclear and warrants further investigation. The rhesus monkey model of RSV infection appears to be a useful system in which to assess candidate vaccine formulations and to define critical immunological factors, such as the influence of maternal antibody on the induction of a primary response following DNA immunization. Because RSV was initially isolated from the upper respiratory tract of a primate species, it is logical that nonhuman primate models provide an advantage in this respect. The data presented herein are encouraging, and justify the need for additional investigation to determine the feasibility of gene-based immunization in neonates.

Acknowledgements We gratefully acknowledge the excellent technical assistance of the staff at the California Regional Primate Research Center (CRPRC): Sarah Davis, Brian Tarkington, and Tim Duvall. We would like to thank veterinarian Laurie Brignolo for her clinical contribution and Dr. Ross Tarara for the histopathological analysis. We also thank Dr. Barney Graham for the generous provision of the RSV strain A2 and Dr. Ursula Buchholz for providing the BRSV F and NP clones. Funding: Pilot project from the California National Primate Research Center’s (CNPRC) Base Operating Grant NIH-NCRR #RR00169

References [1] Hall CB. Respiratory syncytial virus. In: Feigin RD, Cherry JD, editors. Textbook of pediatric infectious diseases, vol. 2. 3rd ed. Philadelphia: WB Saunders; 1992. p. 1633–56. [2] Glezen WP, Greenberg SB, Atmar RL, Piedra PA, Couch RB. Impact of respiratory virus infections on persons with chronic underlying conditions. JAMA 2000;283:499–505.

K. Vaughan et al. / Vaccine 23 (2005) 2928–2942 [3] Groothuis JR, Gutierrez KM, Lauer BA. Respiratory syncytial virus infection in children with bronchopulmonary dysplasia. Pediatrics 1988;82:199–203. [4] Hall CB, Powell KR, MacDonald NE, Gala CL, Menegus ME, Suffin SC, et al. Respiratory syncytial virus infection in children with compromised immune function. N Engl J Med 1986;315:77–81. [5] Albrecht P, Ennis FA, Saltzman EJ, Krugman S. Persistence of maternal antibody in infants beyond 12 months: mechanisms of measles vaccine failure. J Pediatr 1977;91:715–8. [6] Englund JA, Anderson EL, Reed G, George F, Decker MD, Edwards KM, et al. The effect of maternal antibody on the serologic response and the incidence of adverse reactions after primary immunization with acellular and whole-cell pertussis vaccines combined with diphtheria and tetanus toxoids. Pediatrics 1995;96:580–4. [7] Kovarik J, Siegrist C-A. Optimization of vaccine responses in early life: the role of delivery systems and immunomodulators. Immunol Cell Biol 1998;76:222–36. [8] Perkins FT, Yetts R, Gaisford W. Response of infants given a third dose of poliomyelitis vaccine ten to twelve months after primary immunization. Br Med J 1959;1:680–2. [9] Murphy BR, Collins PL, Lawrence L, Zubac J, Chanock RM, Prince GA. Immunosuppression of the antibody response to respiratory syncytial virus (RSV) by pre-existing serum antibodies: partial prevention by topical infection of the respiratory tract with vaccinia virusRSV recombinants. J Gen Virol 1989;70:2185–90. [10] Murphy BR, Olmsted RA, Collins PL, Chanock RM, Prince GA. Passive transfer of respiratory syncytial virus (RSV) antiserum suppresses the immune response to the RSV fusion (F) and large (G) glycoproteins expressed by recombinant vaccinia viruses. J Virol 1988;62:3907–10. [11] Murphy BR, Prince GA, Collins PL, Hildreth SW, Paradiso PR. Effect of passive antibody on the immune response of cotton rats to purified F and G glycoproteins of respiratory syncytial virus (RSV). Vaccine 1991;9:185–9. [12] Glezen WP, Paredes A, Allison JE, Taber LH, Frank AL. Risk of respiratory syncytial virus infection for infants from low-income families in relationship to age, sex, ethnic group, and maternal antibody level. J Pediatr 1981;98:708–15. [13] Ogilvie MM, Vathenen AS, Radford M, Codd J, Key S. Maternal antibody and respiratory syncytial virus infection in infancy. J Med Virol 1981;17:263–71. [14] Donnelly JJ, Ulmer JB, Shiver JW, Liu MA. DNA vaccines. Annu Rev Immunol 1997;15:617–48. [15] Prince AM, Whalen R, Brotman B. Successful nucleic acid based immunization of newborn chimpanzees against hepatitis B virus. Vaccine 1997;15:916–9. [16] Sarzotti M, Dean TA, Remington MP, Ly CD, Furth PA, Robbins DS. Induction of CTL responses in newborn mice by DNA immunization. Vaccine 1997;15:795–7. [17] Wang Y, Xiang Z, Pasquini S, Ertl HC. Immune response to neonatal genetic immunization. Virology 1997;228:278–84. [18] Martinez X, Brandt C, Saddallah F, et al. DNA immunization circumvents deficient induction of T helper type 1 and cytotoxic T lymphocyte responses in neonates and during early life. Proc Natl Acad Sci USA 1997;94:8726–31. [19] McArthur-Vaughan K, Gershwin LJ. A rhesus monkey model of respiratory syncytial virus (RSV) infection. J Med Primatol 2002;31(2):61–73. [20] Loveys DA, Kulkarni S, Atreya PL. Role of type I IFNs in the in vitro attenuation of live, temperature sensitive vaccine strains of human respiratory syncytial virus. Virology 2000;271(2):390– 400. [21] Bryson DG, McConnell S, McAliskey M, Nulty MS. Ultrastructural features of alveolar lesions in induced respiratory syncytial virus pneumonia of calves. Vet Pathol 1991;28:286–92. [22] Jones TC, Hunt RD, King NW, editors. Veterinary pathology. 6th ed. Baltimore: Williams & Wilkins; 1997.

2941

[23] Andersson C, Liljestrom P, Stahl S, Power UF. Protection against respiratory syncytial virus (RSV) elicited in mice by plasmid DNA immunization encoding a secreted RSV G protein-derived antigen. FEMS Immunol Med Microbiol 2000;29(4):247–53. [24] Kumar M, Behera AK, Matsuse H, Lockey RF, Mohapatra SS. Intranasal IFN-gamma gene transfer protects BALB/c mice against respiratory syncytial virus infection. Vaccine 1999;18(5–6):558–67. [25] Li X, Sambhara S, Li CX, Ettorre L, Switzer I, Cates G, et al. Plasmid DNA encoding the respiratory syncytial virus G protein is a promising vaccine candidate. Virology 2000;269:54–65. [26] Martinez X, Li X, Kovarik J, Klein M, Lambert P-H, Siegrist CA. Combining DNA and protein vaccines for early life immunization against respiratory syncytial virus in mice. Eur J Immunol 1999;29(10):3390–400. [27] Piazza FM. Bovine respiratory syncytial virus protects cotton rats against human respiratory syncytial virus infection. J Virol 1993;67(3):1503–10. [28] Abu-Nassar S. Detection of anti-RSV IgG in a population of rhesus monkeys to examine its role in experimental disease prevention, Masters Thesis, UC Davis, 1998. [29] Pertmer T, Oran M, Alp E, Moser JM, Madorin CA, Robinson HL. DNA vaccines for influenza virus: differential effects of maternal antibody on immune responses to hemagglutinin and nucleoprotein. J Virol 2000;74(17):7787–93. [30] Radu DL, Antohi S, Bot A, Miller A, Mirarchi A, Bona C. Effects of maternal antibodies on influenza virus-specific immune responses elicited by inactivated virus and naked DNA. Scand J Immunol 2001;53(5):475–82. [31] Siegrist C-A, Barrios C, Martinez X, Brandt C, Berney M, Cordova M, et al. Influence of maternal antibodies on vaccine responses: inhibition of antibody but not T cell responses allows successful early prime-boost strategies in mice. Eur J Immunol 1998;28(12):4138–48. [32] Siegrist C-A, Lambert P-H. Immunization with DNA vaccines in early life: advantages and limitations as compared to conventional vaccines. In: Raz E, editor. Gene vaccination: theory and practice. New York: Springer-Verlag; 1998. p. 131–41. [33] Dunbar PR, Ogg GS, Chen J, Rust N, van der Bruggen P, Cerundolo V. Direct isolation, phenotyping and cloning of low-frequency antigen-specific cytotoxic T lymphocytes from peripheral blood. Curr Biol 1998;8:413–6. [34] Kumar A, Weiss W, Tine JA, Hoffman SL, Rogers WO. ELISPOT assay for the detection of peptide specific interferon-gamma secreting cells in rhesus macaques. J Immunol Methods 2001;247:49–60. [35] van der Meide PH, Groenestein RJ, de Labie MCDC, Heeney J, Pala P, Slaoui M. Enumeration of lymphokine-secreting cells as a quantitative measure for cellular immune responses in rhesus macaques. J Med Primatol 1995;24:271–81. [36] van Besouw NM, van der Meide PH, Bakker NPM. The mitogeninduced generation of interferon-gamma producing cells in cultures of rhesus monkey peripheral blood mononuclear cells is agedependent. J Med Primatol 1994;23:42–8. [37] Gershwin LJ, Gunther RA, Anderson ML, Woolums AR, McArthurVaughan K, Randel KE, et al. Bovine respiratory syncytial virusspecific IgE is associated with interleukin-2 and -4, and interferon-␥ expression in pulmonary lymph of experimentally infected calves. Am J Vet Res 2000;61:291–8. [38] Bryson DG, Platten MF, McConnell S, McNulty MS. Ultrastructural features of lesions in bronchiolar epithelium in induced respiratory syncytial virus pneumonia in calves. Vet Pathol 1991;28:293– 9. [39] Wilson CB. Immunologic basis for increased susceptibility of the neonate to infection. J Pediatr 1986;108:1–12. [40] Adkins B, Ghanai A, Hamilton K. Up-regulation of murine neonatal T cell responses by accessory factors. J Immunol 1994;153:3378–85. [41] Pilarski LM. Ontogeny of cell-mediated immunity. I. Early development of alloantigen specific cytotoxic T cell precursors in postnatal mice. J Exp Med 1977;146:887–92.

2942

K. Vaughan et al. / Vaccine 23 (2005) 2928–2942

[42] Chipeta J, Komada Y, Zhang X-L, Azuma E, Yamamoto H, Sakurai M. Neonatal (cord blood) T cells can competently raise type 1 and 2 immune responses upon polyclonal activation. Cell Immunol 2000;205(2):110–9. [43] Halista SM, Johnson-Robbins LA, El-Mohandes AE, Lees A, Mond JJ, Katona IM. Characterization of early activation events in cord blood B cells after stimulation with T cell-independent activators. Pediatr Res 1998;43(4):496– 503. [44] Hodge S, Hodge G, Flower R, Han P. Cord blood leukocyte expression of functionally significant molecules involved in the regulation of cellular immunity. Scand J Immunol 2001;53(1):72– 8. [45] Lee SM, Suen Y, Chang L, Bruner V, Quian J, Indes J, et al. Decreased interleukin 12 (IL-12) from activated cord versus adult peripheral blood mononuclear cells and upregulation of interferongamma, natural killer and lymphokine-activated killer activity by IL-12 in cord blood. Blood 1996;88:945–54.

[46] Butts C, Zubkoff I, Robbins DS, Cao S, Sarzotti M. DNA immunization of infants: potential and limitations. Vaccine 1998;16(14–15):1444–9. [47] Forsthuber T, Yip HC, Lehmann PV. Induction of TH 1 and TH 2 immunity in neonatal mice. Science 1996;271:1728–30. [48] Ridge JP, Fuchs EJ, Matzinger P. Neonatal tolerance revisited: turning on newborn T cells with dendritic cells. Science 1996;271:1723–6. [49] Sarzotti M, Robbins DS, Hoffman PM. Induction of protective CTL responses in newborn mice by a murine retrovirus. Science 1996;271:1726–8. [50] Arredondo J, Lu FX, Villinger F, McChesney MB, McGhee JR, Miller CJ. Antigen-dependent cytokine mRNA expression by individual rhesus macaque T helper cells by flow cytometry. Cell Immunol 2000;210(2):94–108. [51] Villinger F, Sukhdev SB, Mayne A, Chikkala N, Ansari AA. Comparative sequence analysis of cytokine genes from human and nonhuman primates. J Immunol 1995;155:3946–54.