- Email: [email protected]
Down-regulation of Telomerase Activity Is an Early Event in the Differentiation of HL60 Cells
BIOCHEMICAL AND BIOPHYSICAL RESEARCH COMMUNICATIONS ARTICLE NO.
226, 329–334 (1996)
1356
Down-regulation of Telomerase Activity Is an Early Event in the Differentiation of HL60 Cells Ericka Savoysky,* Kenji Yoshida,* Toshihiko Ohtomo,* Yohsuke Yamaguchi,† Ken-ichi Akamatsu,* Tatsumi Yamazaki,* Shonen Yoshida,† and Masayuki Tsuchiya*,1 *Chugai Pharmaceutical Co. Ltd., Fuji Gotemba Research Laboratories, 135 Komakado 1-chome, Gotemba-shi, 412, Japan; and †Laboratory of Cancer Cell Biology, Research Institute for Disease Mechanism and Control, Nagoya University School of Medicine, Showa-ku, Nagoya 466, Japan Received July 31, 1996 Telomerase has been shown to be essential for unlimited cell proliferation and has been linked to immortality. However, still very little is known about the mechanism by which this enzyme is activated or inactivated. To investigate its regulation, we closely monitored telomerase activity during HL60 cell differentiation induced by either 1a,25-dihydroxyvitamin D3 or all-trans retinoic acid. To that effect, we used a new combination of TRAP assay and SPA, which provides reproducible data for the quantitation and detection of variations in enzyme activity. We thereby observed that the decrease in telomerase activity after induction of differentiation by either of these agents is an early event of the differentiation process rather than its consequence, and that it is independent of the growth arrest pathway. It is neither due to a reduced expression of its RNA component nor to the appearance of a telomerase inhibitor in differentiating cells but is parallel to an increase in p21 and Rb mRNA expression. q 1996 Academic Press, Inc.
During cell division and proliferation of normal diploid cells in culture, their telomeres become progressively shorter and may contribute to cellular senescence or mortality stage 1, M1 (1-4). Transformation of these cells with viral oncogenes or alterations in p53 or Rb protein function increase their life-span. They continue to divide until reaching a second crisis (mortality stage 2 or M2) when most of the cells die. Very few cells can escape this crisis and therefore become immortal, usually in association with the reactivation of telomerase, a ribonucleoprotein which adds TTAGGG hexanucleotide repeats at the ends of chromosomes (5). Telomerase has been found in most tumor cells and tissues examined to date, as well as in germ line tissues, but not in normal cells, thus linking this enzyme to cell immortality (6, 7). Although two protein subunits of Tetrahymena telomerase and the RNA component of human telomerase have recently been cloned (8, 9), very little is known about the mechanism by which this enzyme is activated or inactivated. Human promyelocytic leukemia cells (HL60) can be easily induced to differentiate into monocytes or granulocytes after treatment by 1a,25-dihydroxyvitamin D3 (Vit.D3) or all-trans retinoic acid (ATRA), respectively (10) and these systems have become the model of choice in identifying the pathways and genes involved in cellular differentiation. The signals induce the transcription of p21WAF1,CIP1 (11), a ubiquitous inhibitor of cyclin kinases and an integral component of cell cycle control (12-14). Therefore, these models might also be useful for studying telomerase regulation. In this report, we examined the effect of either 1a,25-dihydroxyvitamin D3- or all-trans retinoic acid-induced differentiation on telomerase activity in comparison with differentiation markers. We established a combination of TRAP assay and scintillation proximity assay which 1
To whom requests for reprints should be addressed. 329 0006-291X/96 $18.00 Copyright q 1996 by Academic Press, Inc. All rights of reproduction in any form reserved.
AID
BBRC 5329
/
6909$$$$21
08-26-96 06:11:42
bbrca
AP: BBRC
Vol. 226, No. 2, 1996
BIOCHEMICAL AND BIOPHYSICAL RESEARCH COMMUNICATIONS
allowed the detection and quantification of variations in telomerase activity (15). We found that telomerase was inhibited in a dose-dependent manner and that loss of activity was an early event in the differentiation process. Expression of its RNA component was not affected by either Vit.D3- and ATRA-induced differentiation. Moreover, decrease in telomerase activity was not due to the appearance of a telomerase inhibitor in differentiating cells and was independent of cell growth arrest. MATERIALS AND METHODS Cells and cell culture. HL60 cells were cultured in RPMI-1640 medium (GIBCO), supplemented with L-glutamine (0.3 g/l), kanamycin (80 mg/l) and 10% heat-inactivated fetal calf serum, at 377C, under 5% CO2 . For differentiation experiments, the cell suspension (105 cells / ml) was incubated as indicated in the presence of 1a,25(OH)2D3 (Vit.D3) or all-trans retinoic acid (ATRA), solubilized in absolute ethanol (0.1% final concentration in growth medium). Assay for cellular differentiation. Cell differentiation was estimated by production of superoxide anion by differentiated cells: cells incubated in 24-well plates were centrifuged for 5 min. at 1800 rpm., and the supernatant replaced by 1 ml of gelatin buffer (GHBSS) containing 9.8 g/l Hanks solution, 0.3 g/l NaHCO3 and 0.1% gelatin. After mixing for 20 s., 500 ml of 21 reaction buffer (240 mM cytochrome C, 750 ng/ml phorbolmyristate acetate in GHBSS) was added to each well and the plates were incubated for 1 h. at 377C. After centrifugation for 5 min. at 1800 rpm., the difference in absorbance of the supernatant at 550 and 540 nm was measured and the concentration of superoxide anion was estimated (absorption coefficient of cytochrome C: 19.1 1 103 cm01). Telomerase activity. Telomerase activity was detected by TRAP assay coupled to scintillation proximity assay (SPA) on HL60 CHAPS extracts corresponding to 104 cells as previously described (15). Extraction of total RNA. Total RNA corresponding to 106 cells was extracted with RNAzol (Biotecx) according to the manufacturer’s protocol. RT-PCR detection of RNA transcripts. First strand cDNA synthesis was carried out on 5 ml of total RNA with First-Strand cDNA kit (Pharmacia Biotech) in the presence of 20 mM of 3* specific primers in a final volume of 15 ml. After denaturation for 5 min. at 957C, the total amount of reaction products was amplified by PCR for 32 cycles (947C, 1 min.; 557C, 1min.; 727C, 2 min.) in the presence of 20 mM of 5* specific primers and analyzed by 1% agarose gel electrophoresis and ethidium bromide staining. The primers were hTR-3* (TGTGAGCCGAGTCCTGGGTGCACG) and hTR-5* (TTTGTCTAACCCTAACTGAGAAGG) for telomerase RNA, RB-3* (AAGAAGACAAGCAGATTCAAGGTG) and RB-5* (ATGTCGTTCACTTTACTGAGCTAC) for Rb protein, p21-3* (TTAGGGCTTCCTCTTGGAGAAGAT) and p21-5* (ATGTCAGAACCGGCTGGGGATGTC) for p21WAF1/CIP1 and were obtained from Sawadi Technology (Japan). Human b-actin Control Amplimer set was obtained from Clontech. Effect of anti TGFb antibody. HL60 cells were adapted to 2% FCS for 3 or 4 passages. ATRA was added at a final concentration of 1006M at day 0. AntiTGFb (Genzyme) was added at 10 mg/ml at day 0 and day 1 and the cells were incubated for 4 days. Cell number was estimated every day, telomerase activity and superoxide anion production were assayed after 4 days.
RESULTS
Inhibition of telomerase activity during differentiation of HL60 cells. Monitoring of superoxide anion production as a function of time indicates that cells are committed to differentiation after only 2 or 3 cell cycles, i.e. 24 or 48 hours in the presence of 1007 M Vit.D3 or 1006 M ATRA, respectively (Fig.1b). Similar results were obtained by analysis of cell surface antigens CD14 and CD15 using the corresponding FITC-labeled mouse anti-human IgG antibodies. This was accompanied by a reduced growth rate in the presence of either agents (Fig.1a). Telomerase assay carried out in parallel showed that the enzyme activity significantly decreased as early as 24 hours after treatment by 1007 M Vit.D3 or by 1006M ATRA and was almost abolished after 4 days of incubation (Fig.1c). If incubation was prolonged up to 7 days, superoxide anion production decreased in parallel with the number of viable cells, indicating cell death (data not shown). This effect could be reproducibly quantified due to the use of SPA detection method. These events were accompanied by morphological changes characteristic of monocytes or granulocytes depending on the inducer as observed by Giemsa staining (11and data not shown). We also confirmed that the decrease in telomerase activity is not due to the subsequent expression of an inhibitor in treated cells, since addition of extracts from differentiated cells did not inhibit telomerase activity of control cells (Fig.1d). These results therefore 330
AID
BBRC 5329
/
6909$$$$22
08-26-96 06:11:42
bbrca
AP: BBRC
Vol. 226, No. 2, 1996
BIOCHEMICAL AND BIOPHYSICAL RESEARCH COMMUNICATIONS
FIG. 1. Time course experiment. HL60 cells were seeded in 24-well plates at a density of 105 cells/ml. Cell number (a), superoxide anion production(b) and telomerase activity (c) were measured in the absence (j) or in the presence of 1007 M Vit.D3 (h) or 1006 M ATRA (s) for the indicated times. CHAPS extracts of untreated cells were assayed for telomerase activity and superoxide anion production (d) in the absence (0) or in the presence (/) of Vit.D3treated cell extracts.
indicate a strong correlation between telomerase activity and the cell’s commitment to differentiation. Expression of telomerase RNA. RT-PCR reactions using specific primers were carried out on total RNA extracted from control and either Vit.D3- or ATRA-treated HL60 cells. No variation in telomerase RNA levels could be observed after 4 days of incubation for both control and treated cells, as well (Fig.2). This suggests that the mechanism leading to telomerase inactivation does not directly involve its RNA subunit. In contrast, a time-dependent elevation in Rb protein mRNA was observed in Vit.D3- or ATRA-treated cells but not in control. It was preceded by an increase in p21 mRNA expression as early as 2 or 6 hours after induction by ATRA and Vit.D3 , respectively. Effect of cell growth on telomerase activity. Since the differentiation process is accompanied by reduced cell growth, we examined whether the simple growth arrest induced by serum 331
AID
BBRC 5329
/
6909$$$$22
08-26-96 06:11:42
bbrca
AP: BBRC
Vol. 226, No. 2, 1996
BIOCHEMICAL AND BIOPHYSICAL RESEARCH COMMUNICATIONS
FIG. 2. Expression of telomerase RNA, p21 and Rb protein during cell differentiation. HL60 cells (106 cells) were incubated for the indicated times in the absence or in the presence of 1007M Vit.D3 or 1006M RA. Total RNA corresponding to 106 cells for each sample was extracted and used for RT-PCR in the presence of telomerase RNA, Rb protein, p21 and b-actin specific primers. Reaction products were visualized after 1% agarose gel electrophoresis and ethidium bromide staining.
starvation could lead to a decrease in telomerase activity. For that purpose, HL60 cells were cultured in the absence or in the presence of 10% FCS during 3 days. An almost complete growth arrest was observed as early as 24 hours after incubation in the absence of FCS (Fig.3a). However, telomerase activity was not affected by serum starvation (Fig.3b), indicating that cell cycle exit is not sufficient for suppressing telomerase activity. Addition of anti-TGFb antibody to ATRA-treated HL60 cells released the cells from the growth arrest induced by ATRA (Fig.3c) but did not suppress telomerase inhibition and the accompanying differentiation (Fig.3d). Both experiments therefore enforce the correlation of telomerase with differentiation. DISCUSSION
We investigated the variation of telomerase activity, characteristic of uncontrolled cell growth, after treatment of HL60 cells by two inducers of differentiation, 1a,25-hydroxyvitamin D3- and all-trans retinoic acid. Production of superoxide anion shows that cells are committed to differentation after 24 h or 48 h. in the presence of Vit.D3 or ATRA, respectively. This is accompanied by morphological changes into monocytes or granulocytes depending on the inducer. Telomerase assay carried out in parallel showed a significant loss of activity as early as 24 h after induction by either agent until an almost complete inhibition after 4 days. This effect could be reproducibly quantified due to the sensitivity of SPA detection method (15) which allows the detection of relatively small variations in the enzyme activity. It should be noted, however, that the values obtained with TRAP/SPA method are still not linear with respect to the enzyme dose, as it is also the case with the conventional TRAP assay, but rather logarithmic: 10 times more enzyme results only in double cpm values (15). This indicates that the decrease in telomerase activity (Fig.1c) is more drastic than actually observed, and is partially masked by the PCR amplification step. However, SPA detection itself does not affect the linearity of the reaction, but provides an easier measurement of the reaction products. This might explain the apparent discrepancy with another report (16) in which a significant decrease of telomerase activity was observed only after 3 days of treatment by Vit.D3 or ATRA, and separation of TRAP products by electrophoresis followed by autoradiography. Moreover, this loss of activity is not due to the expression of an inhibitor in treated cells, since incubation 332
AID
BBRC 5329
/
6909$$$$22
08-26-96 06:11:42
bbrca
AP: BBRC
Vol. 226, No. 2, 1996
BIOCHEMICAL AND BIOPHYSICAL RESEARCH COMMUNICATIONS
FIG. 3. Effect of serum starvation on telomerase activity. HL60 cells were seeded at 105 cells/ml in RPMI supplemented with 10% FCS or in medium alone and incubated as indicated. Cell number (a) and telomerase activity (b) were estimated in the presence (j) or in the absence (m) of FCS. Effect of antiTGFb antibody. ATRA-treated cells were incubated in the absence (j) or in the presence (m) of antiTGFb antibody in parallel with untreated cells (h) as control. Cell number (c) was estimated at day 0, 1, 2, 3 and 4. Telomerase activity and superoxide anion production (d) were measured at day 4.
of such extracts with control cell extracts did not inhibit telomerase activity. These results therefore indicate a strong correlation between telomerase activity and cell differentiation. RT-PCR reactions using specific primers carried out on control and with either Vit.D3 or ATRA treated HL60 cells showed no variation in telomerase RNA levels after 4 days of incubation for both control and treated cells, as well. This suggests that the mechanism leading to telomerase inhibition does not directly involve its RNA subunit. Other hypotheses might be a direct inhibition of the enzymatic activity or involve the protein subunit(s), through their expression level, complex formation with cell cycle proteins or phosphorylation. However, this will remain unclear until identification of the protein components of telomerase. We found that, as also reported by other (12-14), both agents induced an early increase of p21 mRNA within a few hours, immediately followed by a time-dependent inhibition of telomerase activity. Our telomerase assay system providing a reproducible quantitation of the enzyme activity allowed us to observe this inhibition as soon as 24 hours after induction. It was also inversely correlated with Rb mRNA expression, indicating that these three factors 333
AID
BBRC 5329
/
6909$$$$22
08-26-96 06:11:42
bbrca
AP: BBRC
Vol. 226, No. 2, 1996
BIOCHEMICAL AND BIOPHYSICAL RESEARCH COMMUNICATIONS
are involved in the events leading to cellular differentiation. It has been reported that p21 through its action on cylin/cdk kinase, inhibits Rb phosphorylation, leading to growth arrest (17, 18). A similar mechanism could also explain telomerase inhibition following p21 induction. A more probable hypothesis is that expression of p21, first leads to a prolongation of G1 phase through Rb dephosphorylation and growth arrest. However, simple cycle exit is not sufficient for terminal differentiation and for loss of telomerase activity, as shown by serum starvation or by inhibition of TGFb by antiTGFb antibody. Therefore, rather than a consequence of differentiation, telomerase inhibition might be one of the events committing the cell to this final state, since it occurs very early after induction. Indeed, production of superoxide anion, index of cell differentiation, is only observed after 1 or 2 days. The cascade of events occuring between p21 induction and telomerase inhibition is still unknown, but a critical point seems to reside in the transition from simple growth arrest to differentiation. Idendification of the factors involved in this transition will certainly provide further insight in the regulation of telomerase activity and its role in tumorigenesis. REFERENCES 1. Greider, C. W. (1990) BioEssays 12, 363–369. 2. Vaziri, H., Dragowska, W., Allsopp, R. C., Thomas, T. E., Harley, C. B., and Lansdorp, P. M. (1994) Proc. Natl. Acad. Sci. USA 91, 9857–9860. 3. Counter, C. M., Avilion, A. A., LeFeuvre, C. E., Stewart, N. G., Greider, C. W., Harley, C. B., and Bacchetti, S. (1992) EMBO J. 11, 1921–1929. 4. Wright, W. E., and Shay, J. W. (1995) Trends Cell Biol. 5, 293–297. 5. Morin, G. B. (1989) Cell 59, 521–529. 6. Kim, N. W., Piatyszek, M. A., Prowse, K. R., Harley, C. B., West, M. D., Ho, P. L. C., Coviello, G. M., Wright, W. E., Weinrich, S. L., and Shay, J. W. (1994) Science 266, 2011–2015. 7. Counter, C. M., Hirte, H. W., Bachetti, S., and Harley, C. B. (1994) Proc. Natl. Acad. Sci. USA 91, 2900–2904. 8. Collins, K., Kobayashi, R., and Greider, C. W. (1995) Cell 81, 677–686. 9. Feng, J., Funk, W. D., Wang, S.-S., Weinrich, S. L., Avilion, A. A., Chiu, C.-P., Adams, R. R., Chang, E., Allsopp, R. C., Yu, J., Lee, S., West, M. D., Harley, C. B., Andrews, W. H., Greider, C. W., and Villeponteau, B. (1995) Science 269, 1236–1241. 10. Pan, P., Reddy, K., Lee, S., and Studzinski, G. P. (1991) Cell Prolif. 24, 159–165. 11. Liu, M., Lee, M. H., Bommakanti, M., and Freedman, L. P. (1996) Genes Dev. 10, 142–153. 12. Jiang, H., Lin, J., Su, Z.-z., Collart, F. R., Huberman, E., and Fisher, P. B. (1994) Oncogene 9, 3397–3406. 13. Steinman, R. A., Hoffman, B., Iro, A., Guillouf, C., Lieberman, D. A., and El-Houseini, M. E. (1994) Oncogene 9, 3389–3396. 14. MacLeod, K. F., Sherry, N., Hannon, G., Beach, D., Tokino, T., Kinzler, K., Vogelstein, B., and Jacks, T. (1995) Genes Dev. 9, 935–944. 15. Savoysky, E., Akamatsu, K., Tsuchiya, M., and Yamazaki, T. (1996) Nucleic Acids Res. 6, 1175–1176. 16. Sharma, H. W., Sokoloski, J. A., Perez, J. R., Maltese, J. Y., Sartorelli, A. C., Stein, C. A., Nichols, G., Khaled, Z., Telang, N. T., and Narayanan, R. (1995) Proc. Natl. Acad. Sci. USA 92, 12343–12346. 17. Sherr, C. J., and Roberts, J. M. (1995) Genes Dev. 9, 1149–1163. 18. Harper, J. W., Elledge, S. J., Keyomarsi, K., Dynlacht, B., Tsai, L. H., Zhang, P., Dobrowolski, S., Bai, C., Connell-Crowley, L., Swindell, E., Fox, M. P., and Wei, N. (1995) Mol. Biol. Cell 6, 387–400.
334
AID
BBRC 5329
/
6909$$$$22
08-26-96 06:11:42
bbrca
AP: BBRC
226, 329–334 (1996)
1356
Down-regulation of Telomerase Activity Is an Early Event in the Differentiation of HL60 Cells Ericka Savoysky,* Kenji Yoshida,* Toshihiko Ohtomo,* Yohsuke Yamaguchi,† Ken-ichi Akamatsu,* Tatsumi Yamazaki,* Shonen Yoshida,† and Masayuki Tsuchiya*,1 *Chugai Pharmaceutical Co. Ltd., Fuji Gotemba Research Laboratories, 135 Komakado 1-chome, Gotemba-shi, 412, Japan; and †Laboratory of Cancer Cell Biology, Research Institute for Disease Mechanism and Control, Nagoya University School of Medicine, Showa-ku, Nagoya 466, Japan Received July 31, 1996 Telomerase has been shown to be essential for unlimited cell proliferation and has been linked to immortality. However, still very little is known about the mechanism by which this enzyme is activated or inactivated. To investigate its regulation, we closely monitored telomerase activity during HL60 cell differentiation induced by either 1a,25-dihydroxyvitamin D3 or all-trans retinoic acid. To that effect, we used a new combination of TRAP assay and SPA, which provides reproducible data for the quantitation and detection of variations in enzyme activity. We thereby observed that the decrease in telomerase activity after induction of differentiation by either of these agents is an early event of the differentiation process rather than its consequence, and that it is independent of the growth arrest pathway. It is neither due to a reduced expression of its RNA component nor to the appearance of a telomerase inhibitor in differentiating cells but is parallel to an increase in p21 and Rb mRNA expression. q 1996 Academic Press, Inc.
During cell division and proliferation of normal diploid cells in culture, their telomeres become progressively shorter and may contribute to cellular senescence or mortality stage 1, M1 (1-4). Transformation of these cells with viral oncogenes or alterations in p53 or Rb protein function increase their life-span. They continue to divide until reaching a second crisis (mortality stage 2 or M2) when most of the cells die. Very few cells can escape this crisis and therefore become immortal, usually in association with the reactivation of telomerase, a ribonucleoprotein which adds TTAGGG hexanucleotide repeats at the ends of chromosomes (5). Telomerase has been found in most tumor cells and tissues examined to date, as well as in germ line tissues, but not in normal cells, thus linking this enzyme to cell immortality (6, 7). Although two protein subunits of Tetrahymena telomerase and the RNA component of human telomerase have recently been cloned (8, 9), very little is known about the mechanism by which this enzyme is activated or inactivated. Human promyelocytic leukemia cells (HL60) can be easily induced to differentiate into monocytes or granulocytes after treatment by 1a,25-dihydroxyvitamin D3 (Vit.D3) or all-trans retinoic acid (ATRA), respectively (10) and these systems have become the model of choice in identifying the pathways and genes involved in cellular differentiation. The signals induce the transcription of p21WAF1,CIP1 (11), a ubiquitous inhibitor of cyclin kinases and an integral component of cell cycle control (12-14). Therefore, these models might also be useful for studying telomerase regulation. In this report, we examined the effect of either 1a,25-dihydroxyvitamin D3- or all-trans retinoic acid-induced differentiation on telomerase activity in comparison with differentiation markers. We established a combination of TRAP assay and scintillation proximity assay which 1
To whom requests for reprints should be addressed. 329 0006-291X/96 $18.00 Copyright q 1996 by Academic Press, Inc. All rights of reproduction in any form reserved.
AID
BBRC 5329
/
6909$$$$21
08-26-96 06:11:42
bbrca
AP: BBRC
Vol. 226, No. 2, 1996
BIOCHEMICAL AND BIOPHYSICAL RESEARCH COMMUNICATIONS
allowed the detection and quantification of variations in telomerase activity (15). We found that telomerase was inhibited in a dose-dependent manner and that loss of activity was an early event in the differentiation process. Expression of its RNA component was not affected by either Vit.D3- and ATRA-induced differentiation. Moreover, decrease in telomerase activity was not due to the appearance of a telomerase inhibitor in differentiating cells and was independent of cell growth arrest. MATERIALS AND METHODS Cells and cell culture. HL60 cells were cultured in RPMI-1640 medium (GIBCO), supplemented with L-glutamine (0.3 g/l), kanamycin (80 mg/l) and 10% heat-inactivated fetal calf serum, at 377C, under 5% CO2 . For differentiation experiments, the cell suspension (105 cells / ml) was incubated as indicated in the presence of 1a,25(OH)2D3 (Vit.D3) or all-trans retinoic acid (ATRA), solubilized in absolute ethanol (0.1% final concentration in growth medium). Assay for cellular differentiation. Cell differentiation was estimated by production of superoxide anion by differentiated cells: cells incubated in 24-well plates were centrifuged for 5 min. at 1800 rpm., and the supernatant replaced by 1 ml of gelatin buffer (GHBSS) containing 9.8 g/l Hanks solution, 0.3 g/l NaHCO3 and 0.1% gelatin. After mixing for 20 s., 500 ml of 21 reaction buffer (240 mM cytochrome C, 750 ng/ml phorbolmyristate acetate in GHBSS) was added to each well and the plates were incubated for 1 h. at 377C. After centrifugation for 5 min. at 1800 rpm., the difference in absorbance of the supernatant at 550 and 540 nm was measured and the concentration of superoxide anion was estimated (absorption coefficient of cytochrome C: 19.1 1 103 cm01). Telomerase activity. Telomerase activity was detected by TRAP assay coupled to scintillation proximity assay (SPA) on HL60 CHAPS extracts corresponding to 104 cells as previously described (15). Extraction of total RNA. Total RNA corresponding to 106 cells was extracted with RNAzol (Biotecx) according to the manufacturer’s protocol. RT-PCR detection of RNA transcripts. First strand cDNA synthesis was carried out on 5 ml of total RNA with First-Strand cDNA kit (Pharmacia Biotech) in the presence of 20 mM of 3* specific primers in a final volume of 15 ml. After denaturation for 5 min. at 957C, the total amount of reaction products was amplified by PCR for 32 cycles (947C, 1 min.; 557C, 1min.; 727C, 2 min.) in the presence of 20 mM of 5* specific primers and analyzed by 1% agarose gel electrophoresis and ethidium bromide staining. The primers were hTR-3* (TGTGAGCCGAGTCCTGGGTGCACG) and hTR-5* (TTTGTCTAACCCTAACTGAGAAGG) for telomerase RNA, RB-3* (AAGAAGACAAGCAGATTCAAGGTG) and RB-5* (ATGTCGTTCACTTTACTGAGCTAC) for Rb protein, p21-3* (TTAGGGCTTCCTCTTGGAGAAGAT) and p21-5* (ATGTCAGAACCGGCTGGGGATGTC) for p21WAF1/CIP1 and were obtained from Sawadi Technology (Japan). Human b-actin Control Amplimer set was obtained from Clontech. Effect of anti TGFb antibody. HL60 cells were adapted to 2% FCS for 3 or 4 passages. ATRA was added at a final concentration of 1006M at day 0. AntiTGFb (Genzyme) was added at 10 mg/ml at day 0 and day 1 and the cells were incubated for 4 days. Cell number was estimated every day, telomerase activity and superoxide anion production were assayed after 4 days.
RESULTS
Inhibition of telomerase activity during differentiation of HL60 cells. Monitoring of superoxide anion production as a function of time indicates that cells are committed to differentiation after only 2 or 3 cell cycles, i.e. 24 or 48 hours in the presence of 1007 M Vit.D3 or 1006 M ATRA, respectively (Fig.1b). Similar results were obtained by analysis of cell surface antigens CD14 and CD15 using the corresponding FITC-labeled mouse anti-human IgG antibodies. This was accompanied by a reduced growth rate in the presence of either agents (Fig.1a). Telomerase assay carried out in parallel showed that the enzyme activity significantly decreased as early as 24 hours after treatment by 1007 M Vit.D3 or by 1006M ATRA and was almost abolished after 4 days of incubation (Fig.1c). If incubation was prolonged up to 7 days, superoxide anion production decreased in parallel with the number of viable cells, indicating cell death (data not shown). This effect could be reproducibly quantified due to the use of SPA detection method. These events were accompanied by morphological changes characteristic of monocytes or granulocytes depending on the inducer as observed by Giemsa staining (11and data not shown). We also confirmed that the decrease in telomerase activity is not due to the subsequent expression of an inhibitor in treated cells, since addition of extracts from differentiated cells did not inhibit telomerase activity of control cells (Fig.1d). These results therefore 330
AID
BBRC 5329
/
6909$$$$22
08-26-96 06:11:42
bbrca
AP: BBRC
Vol. 226, No. 2, 1996
BIOCHEMICAL AND BIOPHYSICAL RESEARCH COMMUNICATIONS
FIG. 1. Time course experiment. HL60 cells were seeded in 24-well plates at a density of 105 cells/ml. Cell number (a), superoxide anion production(b) and telomerase activity (c) were measured in the absence (j) or in the presence of 1007 M Vit.D3 (h) or 1006 M ATRA (s) for the indicated times. CHAPS extracts of untreated cells were assayed for telomerase activity and superoxide anion production (d) in the absence (0) or in the presence (/) of Vit.D3treated cell extracts.
indicate a strong correlation between telomerase activity and the cell’s commitment to differentiation. Expression of telomerase RNA. RT-PCR reactions using specific primers were carried out on total RNA extracted from control and either Vit.D3- or ATRA-treated HL60 cells. No variation in telomerase RNA levels could be observed after 4 days of incubation for both control and treated cells, as well (Fig.2). This suggests that the mechanism leading to telomerase inactivation does not directly involve its RNA subunit. In contrast, a time-dependent elevation in Rb protein mRNA was observed in Vit.D3- or ATRA-treated cells but not in control. It was preceded by an increase in p21 mRNA expression as early as 2 or 6 hours after induction by ATRA and Vit.D3 , respectively. Effect of cell growth on telomerase activity. Since the differentiation process is accompanied by reduced cell growth, we examined whether the simple growth arrest induced by serum 331
AID
BBRC 5329
/
6909$$$$22
08-26-96 06:11:42
bbrca
AP: BBRC
Vol. 226, No. 2, 1996
BIOCHEMICAL AND BIOPHYSICAL RESEARCH COMMUNICATIONS
FIG. 2. Expression of telomerase RNA, p21 and Rb protein during cell differentiation. HL60 cells (106 cells) were incubated for the indicated times in the absence or in the presence of 1007M Vit.D3 or 1006M RA. Total RNA corresponding to 106 cells for each sample was extracted and used for RT-PCR in the presence of telomerase RNA, Rb protein, p21 and b-actin specific primers. Reaction products were visualized after 1% agarose gel electrophoresis and ethidium bromide staining.
starvation could lead to a decrease in telomerase activity. For that purpose, HL60 cells were cultured in the absence or in the presence of 10% FCS during 3 days. An almost complete growth arrest was observed as early as 24 hours after incubation in the absence of FCS (Fig.3a). However, telomerase activity was not affected by serum starvation (Fig.3b), indicating that cell cycle exit is not sufficient for suppressing telomerase activity. Addition of anti-TGFb antibody to ATRA-treated HL60 cells released the cells from the growth arrest induced by ATRA (Fig.3c) but did not suppress telomerase inhibition and the accompanying differentiation (Fig.3d). Both experiments therefore enforce the correlation of telomerase with differentiation. DISCUSSION
We investigated the variation of telomerase activity, characteristic of uncontrolled cell growth, after treatment of HL60 cells by two inducers of differentiation, 1a,25-hydroxyvitamin D3- and all-trans retinoic acid. Production of superoxide anion shows that cells are committed to differentation after 24 h or 48 h. in the presence of Vit.D3 or ATRA, respectively. This is accompanied by morphological changes into monocytes or granulocytes depending on the inducer. Telomerase assay carried out in parallel showed a significant loss of activity as early as 24 h after induction by either agent until an almost complete inhibition after 4 days. This effect could be reproducibly quantified due to the sensitivity of SPA detection method (15) which allows the detection of relatively small variations in the enzyme activity. It should be noted, however, that the values obtained with TRAP/SPA method are still not linear with respect to the enzyme dose, as it is also the case with the conventional TRAP assay, but rather logarithmic: 10 times more enzyme results only in double cpm values (15). This indicates that the decrease in telomerase activity (Fig.1c) is more drastic than actually observed, and is partially masked by the PCR amplification step. However, SPA detection itself does not affect the linearity of the reaction, but provides an easier measurement of the reaction products. This might explain the apparent discrepancy with another report (16) in which a significant decrease of telomerase activity was observed only after 3 days of treatment by Vit.D3 or ATRA, and separation of TRAP products by electrophoresis followed by autoradiography. Moreover, this loss of activity is not due to the expression of an inhibitor in treated cells, since incubation 332
AID
BBRC 5329
/
6909$$$$22
08-26-96 06:11:42
bbrca
AP: BBRC
Vol. 226, No. 2, 1996
BIOCHEMICAL AND BIOPHYSICAL RESEARCH COMMUNICATIONS
FIG. 3. Effect of serum starvation on telomerase activity. HL60 cells were seeded at 105 cells/ml in RPMI supplemented with 10% FCS or in medium alone and incubated as indicated. Cell number (a) and telomerase activity (b) were estimated in the presence (j) or in the absence (m) of FCS. Effect of antiTGFb antibody. ATRA-treated cells were incubated in the absence (j) or in the presence (m) of antiTGFb antibody in parallel with untreated cells (h) as control. Cell number (c) was estimated at day 0, 1, 2, 3 and 4. Telomerase activity and superoxide anion production (d) were measured at day 4.
of such extracts with control cell extracts did not inhibit telomerase activity. These results therefore indicate a strong correlation between telomerase activity and cell differentiation. RT-PCR reactions using specific primers carried out on control and with either Vit.D3 or ATRA treated HL60 cells showed no variation in telomerase RNA levels after 4 days of incubation for both control and treated cells, as well. This suggests that the mechanism leading to telomerase inhibition does not directly involve its RNA subunit. Other hypotheses might be a direct inhibition of the enzymatic activity or involve the protein subunit(s), through their expression level, complex formation with cell cycle proteins or phosphorylation. However, this will remain unclear until identification of the protein components of telomerase. We found that, as also reported by other (12-14), both agents induced an early increase of p21 mRNA within a few hours, immediately followed by a time-dependent inhibition of telomerase activity. Our telomerase assay system providing a reproducible quantitation of the enzyme activity allowed us to observe this inhibition as soon as 24 hours after induction. It was also inversely correlated with Rb mRNA expression, indicating that these three factors 333
AID
BBRC 5329
/
6909$$$$22
08-26-96 06:11:42
bbrca
AP: BBRC
Vol. 226, No. 2, 1996
BIOCHEMICAL AND BIOPHYSICAL RESEARCH COMMUNICATIONS
are involved in the events leading to cellular differentiation. It has been reported that p21 through its action on cylin/cdk kinase, inhibits Rb phosphorylation, leading to growth arrest (17, 18). A similar mechanism could also explain telomerase inhibition following p21 induction. A more probable hypothesis is that expression of p21, first leads to a prolongation of G1 phase through Rb dephosphorylation and growth arrest. However, simple cycle exit is not sufficient for terminal differentiation and for loss of telomerase activity, as shown by serum starvation or by inhibition of TGFb by antiTGFb antibody. Therefore, rather than a consequence of differentiation, telomerase inhibition might be one of the events committing the cell to this final state, since it occurs very early after induction. Indeed, production of superoxide anion, index of cell differentiation, is only observed after 1 or 2 days. The cascade of events occuring between p21 induction and telomerase inhibition is still unknown, but a critical point seems to reside in the transition from simple growth arrest to differentiation. Idendification of the factors involved in this transition will certainly provide further insight in the regulation of telomerase activity and its role in tumorigenesis. REFERENCES 1. Greider, C. W. (1990) BioEssays 12, 363–369. 2. Vaziri, H., Dragowska, W., Allsopp, R. C., Thomas, T. E., Harley, C. B., and Lansdorp, P. M. (1994) Proc. Natl. Acad. Sci. USA 91, 9857–9860. 3. Counter, C. M., Avilion, A. A., LeFeuvre, C. E., Stewart, N. G., Greider, C. W., Harley, C. B., and Bacchetti, S. (1992) EMBO J. 11, 1921–1929. 4. Wright, W. E., and Shay, J. W. (1995) Trends Cell Biol. 5, 293–297. 5. Morin, G. B. (1989) Cell 59, 521–529. 6. Kim, N. W., Piatyszek, M. A., Prowse, K. R., Harley, C. B., West, M. D., Ho, P. L. C., Coviello, G. M., Wright, W. E., Weinrich, S. L., and Shay, J. W. (1994) Science 266, 2011–2015. 7. Counter, C. M., Hirte, H. W., Bachetti, S., and Harley, C. B. (1994) Proc. Natl. Acad. Sci. USA 91, 2900–2904. 8. Collins, K., Kobayashi, R., and Greider, C. W. (1995) Cell 81, 677–686. 9. Feng, J., Funk, W. D., Wang, S.-S., Weinrich, S. L., Avilion, A. A., Chiu, C.-P., Adams, R. R., Chang, E., Allsopp, R. C., Yu, J., Lee, S., West, M. D., Harley, C. B., Andrews, W. H., Greider, C. W., and Villeponteau, B. (1995) Science 269, 1236–1241. 10. Pan, P., Reddy, K., Lee, S., and Studzinski, G. P. (1991) Cell Prolif. 24, 159–165. 11. Liu, M., Lee, M. H., Bommakanti, M., and Freedman, L. P. (1996) Genes Dev. 10, 142–153. 12. Jiang, H., Lin, J., Su, Z.-z., Collart, F. R., Huberman, E., and Fisher, P. B. (1994) Oncogene 9, 3397–3406. 13. Steinman, R. A., Hoffman, B., Iro, A., Guillouf, C., Lieberman, D. A., and El-Houseini, M. E. (1994) Oncogene 9, 3389–3396. 14. MacLeod, K. F., Sherry, N., Hannon, G., Beach, D., Tokino, T., Kinzler, K., Vogelstein, B., and Jacks, T. (1995) Genes Dev. 9, 935–944. 15. Savoysky, E., Akamatsu, K., Tsuchiya, M., and Yamazaki, T. (1996) Nucleic Acids Res. 6, 1175–1176. 16. Sharma, H. W., Sokoloski, J. A., Perez, J. R., Maltese, J. Y., Sartorelli, A. C., Stein, C. A., Nichols, G., Khaled, Z., Telang, N. T., and Narayanan, R. (1995) Proc. Natl. Acad. Sci. USA 92, 12343–12346. 17. Sherr, C. J., and Roberts, J. M. (1995) Genes Dev. 9, 1149–1163. 18. Harper, J. W., Elledge, S. J., Keyomarsi, K., Dynlacht, B., Tsai, L. H., Zhang, P., Dobrowolski, S., Bai, C., Connell-Crowley, L., Swindell, E., Fox, M. P., and Wei, N. (1995) Mol. Biol. Cell 6, 387–400.
334
AID
BBRC 5329
/
6909$$$$22
08-26-96 06:11:42
bbrca
AP: BBRC