Downregulation of TGFβ isoforms and their receptors contributes to keratinocyte hyperproliferation in psoriasis vulgaris

Journal of Dermatological Science (2003) 33, 7 /16

www.elsevier.com/locate/jdermsci

Downregulation of TGFb isoforms and their receptors contributes to keratinocyte hyperproliferation in psoriasis vulgaris Hisao Doia, Masa-Aki Shibatab, Kimihiro Kiyokanea, Yoshinori Otsukib,* a

Department of Dermatology, Osaka Medical College, 2-7 Daigaku-machi, Takatsuki, Osaka 569-8686, Japan b Department of Anatomy and Biology, Osaka Medical College, 2-7 Daigaku-machi, Takatsuki, Osaka 5698686, Japan Received 20 February 2003; received in revised form 17 April 2003; accepted 17 April 2003

KEYWORDS TGFb; TGFb receptors; Psoriasis; A dominant-negative TGFb type II receptor

Summary Background: Psoriasis vulgaris is a chronic inflammatory disorder characterized by epidermal hyperproliferation. Transforming growth factor b (TGFbs) have a major antiproliferative action in epidermis. Objective: We evaluated the distribution and levels of expression of TGFb isoforms and their receptors in psoriatic versus normal skin with the goal of discovering potential alterations in TGFb signal transduction associated with psoriasis. Methods: Expression of TGFb isoforms and their receptors was analyzed in normal and psoriatic skin using immunohistochemistry and reverse transcriptase-polymerase chain reaction (RT-PCR) techniques. Furthermore, DNA synthesis was measured in normal keratinocytes transfected with a dominant-negative TGFb receptor II (TbRII) vector that eliminated most of the cytoplasmic TbRII domain. Results: Marked elevations in DNA synthesis, as assessed by BrdU incorporation and proliferating cell nuclear antigen (PCNA) immunoreactivity, were confirmed in psoriatic epithelial cells. Using immunohistochemistry and RT-PCR analysis, expression of TGFb2 and 3 was diminished in the psoriatic epidermis as compared with those observed in normal skin. With respect to TGFb receptors, expression of TbRI and II was markedly decreased in the psoriatic epidermis. In addition, levels of Smad2 mRNA were also decreased in psoriatic skin. Transfection of normal keratinocytes with the dominant-negative TbRII vector significantly elevated DNA synthesis as compared with keratincoytes transfected with control vector (under condition of TGFb addition), suggesting that the dominant-negative TbRII mutant inhibits the antiproliferative effects of TGFb. Conclusion: The present investigation strongly suggest that the TGFb signaling pathway is downregulated in psoriatic skin and this situation leads to abnormal cell proliferation due to a functional decrease in growth regulation. – 2003 Japanese Society for Investigative Dermatology. Published by Elsevier Ireland Ltd. All rights reserved.

*Corresponding author. Tel.:
/81-726-84-6411; fax:
/81-726-84-6511. E-mail address: [email protected] (Y. Otsuki). 0923-1811/03/$30.00 – 2003 Japanese Society for Investigative Dermatology. Published by Elsevier Ireland Ltd. All rights reserved. doi:10.1016/S0923-1811(03)00107-5

8

1. Introduction Psoriasis vulgaris is a chronic skin disease characterized by hyperproliferation of epidermal keratinocytes with capillary elongation and dilatation accompanied by an influx of inflammatory cells [1]. Transforming growth factor b (TGFb) is a member of a family of growth factors having inhibitory effects on epithelial cell proliferation [2,3] as well as immunosuppressive effects [4]. Three isoforms of TGFb */TGFb1, TGFb2 and TGFb3 */have been identified in various human tissues [5,6] and often display similar inhibitory activity and potency; however, the site and amount of expression of each isoform differs [6]. It was previously reported that TGFb1 and 3 demonstrate similar immunoreactivity in both psoriatic and normal skin, while TGFb2 is lacked in psoriatic skin, suggesting that lack of the latter isoform may contribute to epidermal hyperplasia [7]. TGFb receptors type I (TbRI), II (TbRII), and III (TbRIII) are expressed in many different types of normal cells. TbRIII is apparently not directly involved in the signal transduction pathway, but appears to function in enhancing the binding affinity of TGFb isoforms to TbRI and TbRII [8]. Recent studies have shown that binding of at least two of the receptors (TbRI and TbRII) are necessary for TGFb signaling [9,10] and TbRI mediates signal transduction after interaction with the TGFb/TbRII moiety. Immunoreactivity of TbRI and TbRII is distinctly reduced or lacking in psoriatic skin [11]. We used skin samples donated by a number of patients with psoriasis vulgaris for immunohistochemical assessment of TGFb expression, and additionally used reverse transcriptase-polymerase chain reaction (RT-PCR) to investigate alterations in TGFb signal transduction in normal and psoriatic skin. Furthermore, a dominant-negative TbRII vector was transfected into normal adult keratinocytes and levels of DNA synthesis was evaluated.

2. Materials and methods 2.1. Tissue samples Skin specimens were obtained from patients of the Department of Dermatology, Osaka Medical College, under informed consent. For molecular biological analysis, psoriatic skin samples were taken from two patients (two males, 49 and 67 years) and two samples of normal skin were taken from the neck of a 36-year-old male; these samples were immediately frozen in liquid nitrogen and stored at /80 8C until needed. Moreover, the

H. Doi et al.

following paraffin-embedded and frozen tissue samples were used for immunohistochemical studies. Ten paraffin-embedded skin samples of normal human skin (from six males and four females, age range 21/72 years) and 21 specimens from the advancing margin of psoriatic plaques from patients with active untreated disease (15 males and six females, age range 21 /77 years) were collected retrospectively from the pathology archives of the Department of Dermatology in Osaka Medical College. For frozen tissue samples, normal skin samples obtained from surgical resections performed on three patients without psoriasis (three males, age range 33 /46 years), and specimens of psoriatic plaques from three patients with active disease (three males, age range 49 /65 years) were embedded in Tissue-Tek OCT compound (Miles, Elkhart, IN, USA), frozen in liquid nitrogen, and stored at /80 8C. A biopsy taken from the arm of a 67-year-old male psoriasis patient provided the cells for in vitro study.

2.2. Cell cultures 2.2.1. Psoriatic human keratinocytes The fresh biopsy specimen was immediately placed in Dulbecco’s phosphate-buffered saline at resection, then sequentially rinsed with 70% ethanol for 20 s; quickly rinse 70% ethanol with 0.15 mM calcium; and with serum-free KGM medium (Clonetics Co., San Diego, CA, USA) containing 10 ng/ ml EGF, 5 mg/ml insulin, 0.5 mg/ml hydrocortisone, and 0.4% v/v bovine pituitary extract. Dermis and adipose tissues were removed with a sterile scalpel blade and the epidermal keratinocytes detached by incubation in a solution of 0.05% trypsin/0.53 mM EDTA-4Na at room temperature for 10 min. After this incubation period, the epidermis was scraped with a Falcon Cell Strainer (Becton Dickinson Co., Franklin Lakes, NJ, USA) and the keratinocytes plated in 96-well plastic culture dishes in KGM medium in an incubator with 5% CO2. After 2 /3 days, small clusters of adherent cells were apparent and the KGM was changed every 2 or 3 days as needed due to the subsequent appearance of progressively larger colonies of keratinocytes. 2.2.2. Normal human keratinocytes Adult normal human keratinocytes (NHEK-Ad) were obtained from Bio Whittaker, Walkersville, MD, USA. Cells were seeded onto 25 cm2 tissue culture flasks and grown in KGM as described above. Keratinocytes were passaged when they reached 70 /90% confluency.

Downregulation of TGFbs and their receptors in psoriasis

2.3. BrdU incorporation Cells (psoriatic keratinocytes and normal keratinocytes) were plated in 2-well plates and incubated in KGM in an incubator with 5% CO2. The number of cells per well was counted using a hemocytometer and in vitro DNA synthesis was determined as previously described [12]. Briefly, cells were incubated for 60 min in KGM containing 50 mM 5-bromo-2?-deoxyuridine (BrdU; Sigma, St. Louis, MO, USA) and then fixed in 3.7% formaldehyde in phosphate-buffered saline. DNA was denatured by a 20 min incubation in 4 N HCl for 20 min at 37 8C. The incorporated BrdU was incubated with anti-BrdU mouse monoclonal antibody/peroxidase conjugate (Fab fragment, Roche Diagnostics GmbH, Mannheim, Germany) for 1 h, and then exposed to a luminous substrate (Roche Diagnostics GmbH). Luminescence levels were measured using a Luminoskan (A Thermo BioAnalysis Co., Helsinki, Finland).

2.4. Immunohistochemistry The avidin/biotin complex (ABC) method was used for immunohistochemical analysis (Vectastain ABC Elite Kit, Vector Laboratories, Burlingame, CA, USA). Paraffin-embedded sections were deparaffinized in xylene and hydrated through standard graded ethanol solutions. The sections for immunohistochemistry of TGFbs and their receptors were immersed in distilled water and heated by microwave for antigen retrieval [13]. For frozen tissue, these samples were cut at 5 mm in thickness, mounted, and fixed in acetone for 15 min. Endogenous peroxidase activity was quenched by exposure to 0.3% hydrogen peroxidase for 5 min. Rabbit polyclonal antibodies to TGFb1, 2, and 3 (Clone V, Santa Cruz Biotechnology, Santa Cruz, CA, USA) and goat polyclonal antibodies (Santa Cruz Biotechnology) to TbRI (Clone V-22), TbRII (Clone C-16), and to proliferating cell nuclear antigen, PCNA (PC10, Dako Co., Glostrup, Denmark) were used at a dilution of 1:50. The clone V anti-TGFb1 / 3 antibodies we used specifically recognize the mature form of TGFbs. The chromogen used for visualization of the antibody conjugates was 3amino-9-ethylcarbazole with Mayer’s hematoxylin as the counterstain. We confirmed a specificity of anti-TbRII (C-16) antibody to a membranous form (68 kDa) using Western blotting (data not shown) because of cytoplasmic staining. The numbers of PCNA-positive nuclei per 1000 basal cells were counted in randomly chosen fields under a light microscope at /400 magnification. Data were expressed as percentage of immunor-

9

eactive cells/field and categorized by comparing relative staining intensity. The percentage of immunoreactive cells was classified as follows: / (negative), less than 5% of the total cells were stained; 9/ (slight), 5 /50% of the total cells were stained;
/ (weak), 50 /70% of the total cells were stained;
/
/ (moderate), 70 /90% of the total cells were stained;
/
/
/ (strong), almost all cells were stained. Evaluations of the observation were performed in duplicate by two separate observers (Hisao Doi, Masa-Aki Shibata).

2.5. RT-PCR analysis Total RNA was extracted from frozen skin tissues using the RNeasy Mini Kit (Qiagen, Valencia, CA, USA) according to the manufacturer’s protocol. RTPCR reactions were performed with the one-step RT-PCR (Qiagen) using two pairs of gene-specific primers in each reaction. Glyceraldehyde-3-phosphate (GAPDH) was used as an internal control. Primer sequences and the size of PCR products are shown in Table 1. RNA (250 ng) was used for RT-PCR analysis using a thermal cycler (GeneAmp PCR System 2400, Perkin /Elmer Co., Foster, CA, USA). PCR was carried out in 45 cycles at 94 8C for 1 min, 60 8C for 1 min, and 72 8C for 1 min. PCR products were loaded onto 1% agarose gels and visualized with ethidium bromide under UV light at 312 nm. Intensity of the bands on films was measured with the NIH Image Program. The individual intensities were corrected with GAPDH intensity.

2.6. Transfection of a dominant-negative TbRII vector Transfection was conducted using the amaxa Nucleofector (amaxa GmbH, Ko ¨ln, Germany). The pcDNA3-DNR expression vector for a dominantnegative TbRII was kindly provided by Dr Lalage M. Wakefield, National Institutes of Health, Bethesda, MD, USA [14]; pcDNA3-DNR, a construct with a truncation that eliminates most of the cytoplasmic domain, acts in a dominant-negative fashion. In the transfection process, 1 /105 NHEKAd cells were suspended in 100 ml of Nucleofector solution (Kit 2951, amaxa GmbH) to which 5 mg of pcDNA3-DNR was added. Electrogene transfer was then conducted using the amaxa Nucleofector. pEGFP-N1 vector (Clontech Laboratories, Inc., Palo Alto, CA, USA) was used as a control vector. Transfected cells were resuspended in 1.5 ml KGM culture medium/sample, gently mixed, plated in a 96-microwell optical bottom plate (Nalge Nunc International Co., Rochester, NY, USA) at 333 ml/

10

H. Doi et al.

Table 1 RT-PCR primer sequences and PCR product sizes Gene

Primer sequence (5? /3?)

PCR product (bp)

TGFb1 sense TGFb1 antisense TGFb2 sense TGFb2 antisense TGFb3 sense TGFb3 antisense TbRI sense TbRI antisense TbRII sense TbRII antisense Smad2 sense Smad2 antisense GAPDH sense GAPDH antisense

TGGCGATACCTCAGCAACC

405

CTCGTGGATCCACTTCCAG

keratinocytes cultured from a psoriatic lesion as compared with those observed in keratinocytes cultured from normal skin (Fig. 1A, in vitro). As can be seen in Fig. 1B (in vivo), the percentage of cells with immunopositive for PCNA in paraffinembedded psoriatic epidermis was also significantly increased to approximately 6-fold over normal.

ATCCCGCCCACTTTCTACAGAC 565

3.2. Immunohistochemistry

CATCCAAAGCACGCTTCTTCC TACTATGCCAACTTCTGCTC

522

AACTTACCATCCCTTTCCTC ACGGCGTTACAGTGTTCTG GGTGTGGCAGATATAGACC

358

AGCAACTGCAGCATCACCTC TGATGTCTGAGAAGATGTCC

688

TGTTAACCGAAATGCCACGG

293

In normal skin, keratinocytes positive for PCNA were observed in the basal layer of the epidermis (Fig. 2A), whereas many PCNA-positive nuclei were seen in the suprabasilar layers of psoriatic skin (Fig. 2B). We found that the levels epidermal expression of the three TGFb isoforms differed between normal and psoriatic skin samples (Fig. 2C /H). Although

TCTTATGGTGCACATTCTAG GCAGGGGGGAGCCAAAAGGG 566 TGCCAGCCCCAGCGTCAAAG

well, and placed in a incubator with 5% CO2. The culture medium was changed within 24 h, added 5 ng/ml TGFb1 in the medium and then placed in a incubator again. Following the BrdU exposure and incorporation procedure previously outlined in Section 2.3, BrdU incorporation was measured 72 h after transfection.

2.7. Statistical analysis The significance of differences between normal skin and psoriatic skin in BrdU incorporation and PCNA levels was analyzed using the two-sided Student’s t -test.

3. Results 3.1. Cell proliferation in psoriasis ( in vitro and in vivo) DNA synthesis, as assessed by BrdU incorporation, was significantly elevated about 4-fold in

Fig. 1 Cell proliferation in psoriatic skin. Data presented are mean9/S.D. values; (A) in vitro study: BrdU incorporation was dramatically elevated about 4-fold in keratinocytes cultured from psoriatic skin (**P B/0.01) as compared with those observed in cultured adult normal keratinocytes (NHEK-Ad). Data were calculated from three repeated experiments, rlu; relative light unit; (B) in vivo study: the percentage cells positive for PCNA were significantly increased about 6-fold in psoriatic skin tissues (**P B/0.01) as compared with that observed in normal skin tissues. Number of normal and psoriatic skin from different patients was 10 and 21, respectively.

Downregulation of TGFbs and their receptors in psoriasis

11

Fig. 2 Location and distribution of PCNA-positive keratinocytes and TGFb expression in psoriatic versus normal skin samples. PCNA-positive keratinocytes were observed in the basal layer of normal human epidermis (A), whereas many PCNA-positive nuclei were present in the suprabasilar layer of psoriatic epidermis (B). As compared with that in normal human epidermis (inset, C), expression of TGFb1 was slightly decreased in psoriatic skin (inset, D). Expression of TGFb2 was dramatically decreased in psoriatic skin (F) as compared with that in normal human epidermis (E). Expression of TGFb3 was much lower in psoriatic skin (H) than in normal (G). Note that the staining intensities of all TGFb isoforms were similar in psoriatic and normal dermis (C /H). A /H, ABC immunohistochemistry, /165, C, D insets, /330.

TGFb1 was infrequently expressed in the intracellular space and cytoplasm of the suprabasal epidermis in normal human skin (Fig. 2C), the overall

relative expression was even lower in psoriatic skin (Fig. 2D). Both TGFb2 and TGFb3 were markedly decreased in psoriatic skin (Fig. 2F, H) as compared

12

with normal skin (Fig. 2E, G). Individual immunohistochemical data for the samples analyzed (ten normal and 21 psoriatic skin) are illustrated in Fig. 4. Psoriatic skin showed a tendency for decrease expression of TGFb1, 2 and 3. TbRI was strongly expressed in cytoplasms, partially in cell membranes, within all epidermal layers in normal skin (Fig. 3A), but we detected only weak immunostaining in psoriatic skin (Fig. 3B). Similarly, moderate expression of TbRII was observed in all normal epidermal layers (Fig. 3C) and weak staining for TbRII in psoriatic skin (Fig. 3D). In contrast to psoriatic lesion, moderate to strong expression of TGFb isoforms and their receptors was observed in normal region in adjacent to psoriatic skin (data not shown).

H. Doi et al.

/20, 62 and 42% reductions, respectively, as compared with the averaged control levels. The levels of TbRI mRNA were slightly decreased in psoriatic skin as compared with normal skin. TbRII mRNA, on the other hand, was barely detectable in psoriasis. The densitmetric analysis estimated that average levels of TbRI and TbRII mRNA showed 32 and 65% reductions, respectively, as compared with the averaged control levels. Smad2 mRNA, while weakly expressed in normal skin, was also not detected by RT-PCR in samples of psoriasis. No PCR product was detected in negative control and levels of GAPDH mRNA, run as internal controls, were almost equal.

3.4. Effect of a dominant-negative TbRII transfection

3.3. RT-PCR analysis Results of RT-PCR are presented in Fig. 5. Levels of TGFb1 mRNA were slightly decreased in psoriatic epidermis as compared with normal epidermis, while mRNA levels of both TGFb2 and TGFb3 were strongly decreased. In a densitmetric analysis with correction of GAPDH intensity, average levels of TGFb1, TGFb2 and TGFb3 mRNA in psoriasis showed

DNA synthesis, as indicated by BrdU labeling, was measured in keratinocytes 72 h after the dominantnegative TbRII transfection. As shown in Fig. 6, BrdU incorporation was significantly elevated in keratinocytes transfected with the dominant-negative TbRII vector, pcDNA3-DNR, when compared with labeling indices in keratinocytes transfected with the control vector (pEGFP-N1).

Fig. 3 Expression of TbRI and TbRII in skin samples. As compared with normal human epidermis (A, C), expression of TbRI (B) and TbRII (D) was strongly decreased in psoriatic epidermis. A /D, ABC immunohistochemistry, /330.

Downregulation of TGFbs and their receptors in psoriasis

13

Fig. 5 TGFb and Smad2 mRNA levels in skin samples as analyzed by RT-PCR. The levels of TGFb1 and TbRI mRNA were slightly decreased in psoriatic epidermis as compared with the normal epidermis, but levels of TGb2 and 3 mRNA were strongly decreased in psoriatic skin. Note that the levels of TbRII mRNA especially were markedly decreased in psoriatic epidermis as compared with normal epidermis. Smad2 mRNA was barely detected in psoriatic skin, but was weakly expressed in normal skin. GAPDH was used as the internal control.

Fig. 4 Immunohistochemical reactivity for TGFb in skin samples. The dots represent the immunohistochemical grading for expression of TGFb isoforms in normal human skin specimens (n /10) and in samples of psoriasis vulgaris (n/21). Psoriatic skin showed tendency for decrease of expression in all TGFb 1,2 and 3 as compared with those observed in normal skin.

Fig. 6 DNA synthesis, as assessed by BrdU incorporation, was measured in NHEK-Ad transfected with pcDNA3-DNR vector, a dominant-negative TbRII receptor (with 5 ng/ml TGFb1). DNA synthesis was significantly increased in NHEK-Ad cells transfected with pcDNA3-DNR vector (n/6) as compared with the levels of DNA synthesis in NHEK-Ad cells transfected with pEGFP vector as a control (n/8). Data presented are mean9/S.D. values. Significantly different from the control value at * P B/0.05, rlu; relative light unit.

4. Discussion Much evidence has now accumulated to suggest that dysfunction of TGFb regulation can lead to a pathological situation. The TGFbs have been im-

plicated in various inflammatory diseases such as liver cirrhosis, nephritis, pulmonary fibrosis, rheumatoid arthritis and so on [8]. In the field of

14

cancer, many reports have implicated a dysfunction of TGFb regulation. Mutations of TGFb receptors have been reported in human squamous cell carcinoma cell lines [15,16] and decreased levels of TbRI or TbRII have been shown in a number of pathological lesions, including colon [17] and gastric cancers [18]. In addition, transgenic mice carrying mutant TbRII driven by metallothionein promoter show hyperproliferation of acinar cells in pancreas [19]. It is believed that the genes relating to the TGFb signaling pathway are important factors in repressing oncogenesis [14,20]. In this study, we evaluated the distribution and levels of expression of TGFb isoforms and their receptors in psoriatic versus normal skin with the goal of discovering potential alterations in TGFb signal transduction associated with psoriasis. In the present study, immunohistochemical data consisted of ten normal and 21 psoriatic samples demonstrated a tendency for decrease expression of TGFb1, 2 and 3. In addition, we found decreases in TbRI and TbRII in psoriatic skin. These results were supported by RT-PCR analysis. Furthermore, transfection of the dominant-negative TbRII vector significantly increased DNA synthesis in normal keratinocytes. The present study suggests that downregulation of TbRII expression may lead to hyperproliferation of epidermal keratinocytes in psoriatic skin. Psoriasis is due to a dramatic increase in epidermal keratinocyte proliferation as compared with that of normal epidermal keratinocytes [21]. This was amply demonstrated in our psoriatic skin cultures and paraffin-embedded tissues when we investigated cell proliferation using BrdU incorporation and PCNA immunoreactivity. These results confirmed hyperproliferative activity in psoriatic skin and corroborated previously reported results [22,23]. Certain types of cells, including normal human keratinocytes, express TbRI and TbRII [24]. Initially, TGFb binds to TbRII; TbRI is subsequently recruited into the complex and phosphorylated by TbRII kinase [9,10]. This, in turn, leads to the activation of Smad proteins in a signal transduction pathway effecting growth regulation [25]. As we found by immunohistochemistry, the expression of TGFb isoforms 1, 2 and 3 that of their receptors TbRI and TbRII were variably decreased in psoriatic epidermis as compared with normal skin. Expression of TGFb2, TGFb3, TbRI and TbRII, in particular, were dramatically reduced. RT-PCR analysis similarly demonstrated a marked diminishment in mRNA levels of TGFb2, TGFb3 and TbRII in psoriatic skin. This is somewhat at odds with an earlier study showing that, despite a decrease in expression of

H. Doi et al.

TbRII protein in psoriatic skin, the levels of TbRII mRNA are similar between psoriatic and normal skin as assessed by in situ hybridization [26], suggesting that the lack of epidermal TbRII expression in psoriasis specimens is due to post-transcriptional events [11]. In our study, this may be the case to explain the expression profile we saw for TbRI. However, TGFb2 and 3 and TbRII were dramatically decreased at both the mRNA and protein levels. Kane et al. reported that expression of mature TGFb1 was increased in psoriatic skin using an anti-CC antibody that cross-reacts with the mature form [27]. There are several likely reasons why our results conflict with the previous paper. In terms of expression of TGFb1, the clone V anti-TGFb1 antibody we used specifically recognizes the mature form of TGFb1. We found that weak expression of TGFb1 was observed in normal keratinocytes, but this protein was not detected in psoriatic skin. Since we employed a microwave antigen retrieval method, the difference of the results from Kane’s paper could be due differences in specimen preparation. Obviously, further investigation is needed on this point. Smad proteins are key mediators of TGFb-initiated signal transduction pathways, serving as both activators and inhibitors, thus making them useful as indicators of alterations in TGFb signaling. Phosphorylated Smad2 has been shown to inhibit G1 to S phase transition [9,28], and thus decreased Smad activity may result in a nonregulated or a poorly regulated cell-cycle resulting in increased cell proliferation. In our RT-PCR analyses, we discovered that, parallel to data on TGFb and their receptors, mRNA levels of Smad2 were also decreased in psoriatic skin. It was previously reported that the dominantnegative TbRII vector diminished the antiproliferative effects of TGFb in the Mv1Lu mink lung epithelial cell line, but only in response to addition of TGFb [14,29,30]. We also tested the pcDNA3DNR vector, which contains a truncated TbRII lacking most of the cytoplasmic domain, to see if the pcDNA3-DNR vector acts as a dominant-negative mutant when transfected into adult normal human epidermal keratinocytes. We found that pcDNA3-DNR significantly increased DNA synthesis in normal human epidermal keratinocytes. The results of the transfection study of the dominantnegative TbRII vector suggest to block the antiproliferative action induced by TGFbs, indicating that decreased function of TbRII in normal epidermal keratinocytes leads to cell proliferation. To summarize, we found that levels of TGFb2 and 3 and TbRII expression were markedly decreased in psoriatic skin as compared with normal skin, as was

Downregulation of TGFbs and their receptors in psoriasis

Smad2, a downstream mediator of TGFb signaling complexes. We thus conclude that a decrease in the expression levels of TbRII, a key component in the initial stage of the signal transduction pathway, is a mechanism underlying the development of hyperproliferation in psoriatic skin.

Acknowledgements We thank Dr Lalage M. Wakefield (Laboratory of Cell Regulation and Carcinogenesis, NCI, NIH, Bethesda, MD, USA) for kindly providing pcDNA3DNR vector. This work was partially supported by a Development of Characteristic Education Grant from the Private School Promotion Foundation and by a Grant from the High-Tech Research Program of Osaka Medical College from the Ministry of Education, Culture, Sports, Science, and Technology of Japan.

References [1] Christophers E, Sterry W, Psoriasis. In: Fitzpatrick TB, Aizen AZ, Wolff K, Freedberg IM, Austen KF, editors. Dermatology in general medicine, vol. 1, 4th ed. New York: McGraw-Hill, 1993:489 /514. [2] Roberts AB, Sporn MB. Physiological actions and clinical applications of transforming growth factor-b (TGFb). Growth Factors 1993;8:1 /9. [3] Shipley GD, Pittelkow MR, Wille JJ, Scott RE, Moses HL. Reversible inhibition of normal human prokeratinocyte proliferation by type b transforming growth factor-growth inhibitor in serum-free medium. Cancer Res 1986;46:2068 / 71. [4] Border WA, Ruoslahti E. Transforming growth factor-b in disease: the dark side of tissue repair. J Clin Invest 1992;90:1 /7. [5] Lyons RM, Moses HL. Transforming growth factors and the regulation of cell proliferation. Eur J Biochem 1990;187:467 /73. [6] Massague ´ J. The transforming growth factor-b family. Annu Rev Cell Biol 1990;6:597 /641. [7] Wataya-Kaneda M, Hashimoto K, Kato M, Miyazono K, Yoshikawa K. Differential localization of TGF-b-precursor isotypes in psoriatic human skin. J Dermatol Sci 1996;11:183 /8. [8] Lawrence DA. Transforming growth factor-b: a general review. Eur Cytokine Netw 1996;7:363 /74. [9] Massague ´ J. TGFb signaling: receptors, transducers, and mad proteins. Cell 1996;85:947 /50. [10] Wrana JL, Attisano L, Wieser R, Ventura F, Massague ´ J. Mechanism of activation of the TGF-b receptor. Nature 1994;370:341 /7. [11] Leivo T, Leivo I, Kariniemi AL, Keski-Oja J, Virtanen I. Down-regulation of transforming growth factor-b receptors I and II is seen in lesional but not non-lesional psoriatic epidermis. Br J Dermatol 1998;138:57 /62. [12] Shibata MA, Morimoto J, Otsuki Y. Suppression of murine mammary carcinoma growth and metastasis by HSVtk /GCV gene therapy using in vivo electroporation. Cancer Gene Ther 2002;9:16 /27.

15

[13] Shibata MA, Jorcyk CL, Devor DE, Yoshidome K, Rulong S, Resau J, Roche N, Roberts AB, Ward JM, Green JE. Altered expression of transforming growth factor bs during urethral and bulbourethral gland tumor progression in transgenic mice carrying the androgen-responsive C3(1) 5? flanking region fused to SV40 large T antigen. Carcinogenesis 1998;19:195 /205. [14] Bo ¨ttinger EP, Jakubczak JL, Haines DC, Bagnall K, Wakefield LM. Transgenic mice overexpressing a dominant-negative mutant type II transforming growth factor b receptor show enhanced tumorigenesis in the mammary gland and lung in response to the carcinogen 7,12-dimethylbenz-[a]-anthracene. Cancer Res 1997;57:5564 /70. [15] Ichijo H, Momose F, Miyazono K. Biological effects and binding properties of transforming growth factor-b on human oral squamous cell carcinoma cells. Exp Cell Res 1990;187:263 /9. [16] Reiss M, Stash EB. High frequency of resistance of human squamous carcinoma cells to the anti-proliferative action of transforming growth factor b. Cancer Commun 1990;2:363 /9. [17] Markowitz S, Wang J, Myeroff L, Parsons R, Sun L, Lutterbaugh J, Fan RS, Zborowska E, Kinzler KW, Vogelstein B, Brattain M, Willson JK. Inactivation of the type II TGF-b receptor in colon cancer cells with microsatellite instability. Science 1995;268:1336 /8. [18] Takenoshita S, Tani M, Nagashima M, Hagiwara K, Bennett WP, Yokota J, Harris CC. Mutation analysis of coding sequences of the entire transforming growth factor beta type II receptor gene in sporadic human colon cancer using genomic DNA and intron primers. Oncogene 1997;14:1255 / 8. [19] Bo ¨ttinger EP, Jakubczak JL, Roberts ISD, Mumy M, Hemmati P, Bagnall K, Merlino G, Wakefield LM. Expression of a dominant-negative mutant TGF-b type II receptor in transgenic mice reveals essential roles for TGF-b in regulation of growth and differentiation in the exocrine pancreas. EMBO J 1997;16:2621 /33. [20] Cui W, Fowlis DJ, Bryson S, Duffie E, Ireland H, Balmain A, Akhurst RJ. TGFb1 inhibits the formation of benign skin tumors, but enhances progression to invasive spindle carcinomas in transgenic mice. Cell 1996;86:531 /42. [21] Iizuka H, Takahashi H. Psoriasis, involucrin, and protein kinase C. Int J Dermatol 1993;32:333 /8. [22] Wrone-Smith T, Mitra RS, Thompson CB, Jasty R, Castle VP, Nickoloff BJ. Keratinocytes derived from psoriatic plaques are resistant to apoptosis compared with normal skin. Am J Pathol 1997;151:1321 /9. [23] Castelijns FA, Gerritsen MJ, van Erp PE, van de Kerkhof PC. Cell-kinetic evidence for increased recruitment of cycling epidermal cells in psoriasis: the ratio histone and Ki-67 antigen expression is constant. Dermatology 2000;201:105 /10. [24] Segarini PR, Rosen DM, Seyedin SM. Binding of transforming growth factor-b to cell surface proteins varies with cell type. Mol Endocrinol 1989;3:261 /72. [25] Heldin CH, Miyazono K, ten Dijke P. TGF-b signalling from cell membrane to nucleus through SMAD proteins. Nature 1997;390:465 /71. [26] Matsuura H, Myokai F, Arata J, Noji S, Taniguchi S. Expression of type II transforming growth factor-b receptor mRNA in human skin, as revealed by in situ hybridization. J Dermatol Sci 1994;8:25 /32. [27] Kane CJM, Knapp AM, Mansbridge JN, Hanawalt PC. Transforming growth factor-b1 localization in normal and psoriatic epidermal keratinocytes in situ. J Cell Physiol 1990;144:144 /50.

16 [28] Iavarone A, Massague ´ J. Repression of the CDK activator Cdc25A and cell-cycle arrest by cytokine TGF-b in cells lacking the CDK inhibitor p15. Nature 1997;387:417 /22. [29] Wieser R, Attisano L, Wrana JL, Massague ´ J. Signaling activity of transforming growth factor b type II receptors

H. Doi et al. lacking specific domains in the cytoplasmic region. Mol Cell Biol 1993;13:7239 /47. [30] Chen R-H, Ebner R, Derynck R. Inactivation of the type II receptor reveals two receptor pathways for the diverse TGF-b activities. Science 1993;260:1335 /8.