- Email: [email protected]
Drosophila melanogaster as a model for arbovirus infection of adult salivary glands
Virology 543 (2020) 1–6
Contents lists available at ScienceDirect
Virology journal homepage: www.elsevier.com/locate/virology
Drosophila melanogaster as a model for arbovirus infection of adult salivary glands
T
William H. Palmer, Mark Dittmar, Beth Gordesky-Gold, Jennifer Hofmann, Sara Cherry∗ Department of Microbiology, Perelman School of Medicine, University of Pennsylvania, 472A Stemmler Hall, 3450 Hamilton Walk, Philadelphia, PA, 19104, USA
A R T I C LE I N FO
A B S T R A C T
Keywords: Arbovirus Innate immunity Salivary gland Drosophila melanogaster Tissue barrier Zika virus Vesicular stomatitis virus
Arboviruses are an emerging threat to public health. Arbovirus transmission to vertebrates hinges on dissemination from the arthropod gastrointestinal tract, and ultimately infection of the arthropod salivary glands. Therefore, salivary gland immunity impacts arbovirus transmission; however, these immune responses are poorly understood. Here, we describe the utility of Drosophila melanogaster as a salivary gland infection model. First, we describe the use of a salivary gland-specific driver to launch RNA interference or virus replicon transgenes. Next, we infect flies with an arbovirus panel and find multiple viruses that infect Drosophila salivary glands, albeit inefficiently. We find that this infection is not controlled by antiviral RNA silencing; thus, we silence a panel of immune genes in the salivary glands, but do not observe changes in infection. These data suggest that Drosophila may be used to study salivary gland infection, and that there are likely unexplored pathways controlling infection of this tissue.
1. Introduction Arthropod-borne viruses (arboviruses) are an increasing burden on global health, with current outbreaks of dengue (DENV), Zika (ZIKV), and chikungunya (CHIKV) viruses associated with hemorrhagic fever, microcephaly, and arthritic disease, respectively (Labeaud et al., 2011; Mayer et al., 2017). These, and other, emerging arboviruses are transmitted between vertebrates and blood-feeding arthropods, such as mosquitoes. Following a viremic blood meal, arboviruses replicate in the mosquito gastrointestinal tract (also known as the mosquito alimentary tract), eventually disseminating into the body cavity resulting in systemic infection and ultimately salivary gland infection, a tropism requisite for transmission back to vertebrates during the next blood meal. The progression of arbovirus infection through the mosquito host is thus met with multiple tissue barriers to infection, including infection and escape from the midgut and salivary gland tissues (Franz et al., 2015). These barriers are both physical and immunological in nature (Ruckert et al., 2014), and highly efficient as evidenced by severe bottlenecks in viral populations as infection progresses through them (Grubaugh et al., 2016). However, while the importance of tissue barriers during arbovirus infection of arthropods is clear, we have only a rudimentary understanding of the molecular mechanisms that underlie this immune protection. Infection of the salivary glands is the ultimate tropism required for
∗
transmission to vertebrates, and therefore an understanding of virushost interactions in this tissue is of great importance. While studies have implicated antiviral pathways such as RNA interference, NF-κB, and JAK-STAT as important immune defences during arbovirus infection of mosquitoes, only a handful of studies have focussed specifically on salivary gland immunity (Ruckert et al., 2014; Wang et al., 2018). In general, these studies extend the role for NF-κB (Toll and Imd pathways in insects) in salivary gland defence in mosquitoes. For example, differential expression analyses of DENV-infected salivary glands identified a NF-κB-responsive membrane permeabilizing cecropin-like peptide that is induced during infection and inactivates DENV and CHIKV, as well as an antiviral cystatin and ankyrin-repeat containing protein (Luplertlop et al., 2011; Ribeiro et al., 2007; Sim et al., 2012). Additionally, a DENV subgenomic RNA preferentially inhibits Toll signaling in salivary glands, suggesting its importance in this tissue (Pompon et al., 2017). Further dissection of salivary gland immune pathways could benefit from genetic tools to control gene expression in vivo; however, currently the genetic toolkit available in mosquitoes remains limited (although see e.g. (Chaverra-Rodriguez et al., 2018; Kistler et al., 2015; Matthews et al., 2018)). On the other hand, Drosophila melanogaster has proven itself as a useful model for dissection of immune pathways, primarily due to a wealth of genetic resources. Indeed, our knowledge of immunity in insects is owed, in large part, to the resourcefulness of the Drosophila
Corresponding author. E-mail address: [email protected] (S. Cherry).
https://doi.org/10.1016/j.virol.2020.01.010 Received 24 September 2019; Received in revised form 21 January 2020; Accepted 22 January 2020 Available online 25 January 2020 0042-6822/ © 2020 Published by Elsevier Inc.
Virology 543 (2020) 1–6
W.H. Palmer, et al.
the proventriculus barely visible from the abdomen, with three smaller tubule-like structures. The first is the tract leading from the proventriculus to the crop, and the other two are the salivary gland ducts, the anterior-most portion of the salivary glands. Finally, the proventriculus and crop are pulled from the abdomen, and the salivary glands are severed from the digestive tract.
model, with some discoveries illuminating even more broadly conserved immune mechanisms (e.g. the Toll-like receptors (Lemaitre et al., 1996)). The fly model has been useful in the study of arbovirus infection (e.g. (Chotkowski et al., 2008; Goic et al., 2013; Liu et al., 2018; Rose et al., 2011; Shelly et al., 2009; Van Rij et al., 2006; Xu et al., 2012; Xu et al., 2013; Yasunaga et al., 2014)). While not a native host, arboviruses can infect Drosophila intestinal epithelial cells following oral challenge, and these viruses display broad tropism within the body cavity infecting a number of different tissues upon systemic challenge, allowing the study of immune responses at play during enteric infection and following midgut escape, respectively (Sansone et al., 2015; Xu et al., 2013). Studies in flies have characterized antiviral pathways that defend against arbovirus infection, and identified antiviral roles for ERK, STING, autophagy, each of which have a conserved antiviral function in vertebrates ((Liu et al., 2018) and reviewed in (Buchon et al., 2014; Palmer et al., 2018)). Despite the success of these approaches, to date the Drosophila model has not been used to study salivary gland infection of dipterans, and the adult Drosophila salivary gland remains poorly characterized. Here, we aim to assess the utility of Drosophila model in the study of salivary gland infections. We perform the initial characterization of a salivary gland-specific promoter and use this as a tool to launch a Sindbis virus (SINV) replicon (Avadhanula et al., 2009). Next, we infect flies with a panel of arboviruses from diverse families, and find that a subset can infect the salivary gland secretory cells, albeit at a low frequency. We find that of this panel, Zika virus (ZIKV) infection is most striking and is associated with salivary gland pathology. Lastly, we tested the role of previously described innate immune pathways in the salivary gland. Our findings suggest that the antiviral RNA silencing pathway and other well-characterized immune pathways do not control infection of the salivary glands. Thus, we hope these characterizations will provide a starting point for future studies of salivary gland immunity in Drosophila.
2.3. Infection of Drosophila Females from fly genotypes of interest were microinjected with approximately 100 nL into the anterior ventral abdomen using an Eppendorf Femtojet. Viruses included vesicular stomatitis virus expressing GFP, (VSVGFP; 1.35 × 109 pfu/mL) (Shelly et al., 2009), La Crosse virus (LACV original strain; 1.9 × 108 pfu/mL) (Hopkins et al., 2013), Zika virus (ZIKV strain MR766; 1.7 × 109 pfu/mL) (Liu et al., 2018), dengue-2 virus (DENV-2 NGC; 5.5 × 107 pfu/mL) (Sansone et al., 2015), West Nile virus (WNV-Kunjin; 8 × 107 pfu/mL) (Yasunaga et al., 2014), Sindbis virus expressing GFP (SINVGFP strain hrSp; 1.9 × 109 pfu/mL) (Rose et al., 2011) and Mayaro virus (MAYV; 8 × 107 pfu/mL). Infected flies were transferred to fresh medium weekly, and salivary glands dissected for downstream processing at the indicated time point. 2.4. Immunostaining of adult salivary glands Salivary glands from adult female flies were dissected in cold PBS, transferred to 4% paraformaldehyde for 30 min, and washed three times with PBS containing 0.1% Triton-X (PBST). Glands were blocked for 1 h with 5% Donkey serum in PBST (PBTD), then incubated overnight at 4° with primary antibodies diluted in PBTD. Primary antibody was removed, glands washed 3 times in PBST, and then incubated at room temperature for 2 h with secondary antibody (Alexa Fluor, ThermoFisher, 1:400) and Hoechst (1:500) diluted in PBTD. Finally, glands were washed 3 times in PBST, once in PBS, and allowed to equilibrate in Vectashield (Vector laboratories, Inc) for 30 min before mounting on glass slides. Fluorescent imaging was performed on a Leica DM5500 Q confocal microscope. Primary antibodies used were J2 (antidsRNA, 1:500) (Schonborn et al., 1991), 4G2 (anti-flavivirus, 1:1000) (Nawa et al., 2001), 807.31 (anti-LACV G1, 1:1000) (Soldan et al., 2005), and 265 (anti-alphavirus, 1:1000) (Pal et al., 2013).
2. Materials and methods 2.1. Drosophila rearing and genetics Fruit flies were housed in 25C incubators on a standard cornmeal diet during maintenance and following infections. The following fly stocks can be obtained from Bloomington Drosophila Stock Center (BDSC): w1118 (e.g. BDSC#3605), Irk1-GAL4 (BDSC#62587), UASAgo2IR (BDSC#34799), UAS-STINGIR (BDSC#31565), UAS-relIR (BDSC#33661), UAS-Atg16IR (BDSC#34358), UAS-STAT92EIR IR (BDSC#31317), UAS-imd (BDSC#3933) and UAS-TAK1IR (BDSC#53377). The following fly stocks can be obtained from Vienna Drosophila Resource Center: UAS-MyD88IR (VDRC#25402) and UASpelleIR (VDRC#2889), where IR indicates an RNAi transgene targeted against the gene of interest. Other fly stocks used were AGO2414 (Okamura et al., 2004) UAS-SINVrepGFP (Avadhanula et al., 2009), and UAS-Socs36E (Callus and Mathey-Prevot, 2002). Crosses between these lines were performed on dry yeasted cornmeal medium. Flies were allowed to mate for 3–4 days, and F1 progeny collected every 3–4 days following initial eclosion. 7–10 day old flies were used for infection assays as described below.
2.5. RNA extraction and RT-qPCR Salivary glands from approximately 30 female flies were dissected in PBS and transferred to TRIzol Reagent (Ambion). Each sample was DNase-treated and RNA was extracted using the RNA Clean and Concentrator kit (Zymo research). M-MLV reverse transcriptase (Invitrogen) was used to produce cDNA, which was used as a template for quantitative PCR using Power SYBR Green PCR Master Mix (Applied Biosystems). Relative virus RNA levels were obtained by normalizing virus RNA by the fruit fly housekeeping gene, RpL32. The primers used in this study were directed against Drosophila melanogaster AGO2 (Forward: GTCGGTCGTTCCTTCTTTAAGAT, Reverse: GACCAGGGCCT CGTATCCAT), Zika NS5 (Forward: ACTTGGTGGTGCAGCTTATC, Reverse: CACTTTCTCTGGCTTCCTCAA) and Drosophila melanogaster RpL32 (Forward: AAGAAGCGCACCAAGCACTTCATC, Reverse: TCTGT TGTCGATACCCTTGGGCTT) (Liu et al., 2018).
2.2. Dissection of adult salivary glands
3. Results and discussion
The adult salivary glands span the length of the thorax, where they adhere to the fly digestive tract (i.e. alimentary tract), and begin to curl once in the abdomen (Fig. 1). Dissection of salivary glands were performed with forceps and a glass dish filled with PBS. First, the head of the fly was severed, taking care not to remove any tissues from the thorax. Next the thorax was gripped lightly with the left forcep, with the right forcep forcefully pinched at the thorax-abdomen boundary, and the abdomen pulled from the thorax. This motion should result in
3.1. Irk1-GAL4 as a salivary gland-specific GAL4 driver The Drosophila salivary glands have been well-studied for their polytene chromosomes in larvae, but poorly characterized in adults. The study of Drosophila tissues has benefited from the GAL4-UAS system, where GAL4 binds to and induces transcription of a transgene 2
Virology 543 (2020) 1–6
W.H. Palmer, et al.
Fig. 1. Genetic tools useful for studying immune responses in the salivary gland. (A) A schematic of the use of the GAL4-UAS system to drive mCherry expression in the salivary glands. (B) Irk1 is among the most highly expressed and tissue-specific genes in the salivary gland. Data from FlyAtlas were analyzed to plot log-transformed intensity of each microarray probe (log2(Expression)) against a measure of tissue-specificity (τ) for the set of probes with highest expression in the salivary gland as compared to other tissues. (C) Irk1-GAL4 was crossed with UAS-mCherry and expression observed in the salivary gland in D. melanogaster adults (mCherry, red; nuclei, blue). (D) The anterior-most salivary gland exhibits autofluorescent puncta, (E) while the posterior gland curls back on itself. (F) mCherry is detected in the salivary gland lumen following expression in the secretory cells with Irk1GAL4. (G) Irk1-GAL4 was crossed with UAS-SINVGFP replicon (GFP, green; nuclei, blue). G′ shows a GFP expressing cells and G″ shows dsRNA production (anti-J2) in the GFP-expressing cell demonstrating replication. Scale bar 100 μm.
of salivary gland molecular pathways, such as those involved in innate immunity. As a proof of principle, we next used Irk1-GAL4 to drive expression of a UAS-responsive Sindbis virus replicon (SINVrepGFP), in which the structural proteins have been replaced by GFP (Avadhanula et al., 2009). Expression of GAL4 launches SINVrepGFP RNA, which expresses GFP upon successful viral replication. We observed a subset of cells across the salivary gland are permissive to replication of the SINV replicon, as evidenced by expression of GFP (Fig. 1G). We further verified that these cells had productive and ongoing replication by costaining with an antibody against dsRNA which is a replication intermediate (Fig. 1G).
with a UAS (Upstream Activating Sequence) promoter. Therefore, a transgenic Drosophila line with GAL4 under the control of an adult salivary gland-specific promoter could be crossed with UAS-controlled RNAi or overexpression transgenes to control expression of genes of interest in this tissue of progeny (Fig. 1A). To identify a GAL4 line suitable for the study of adult Drosophila salivary glands, we mined data from FlyAtlas, a resource for tissue-specific expression data in Drosophila (Robinson et al., 2013), to identify genes with high and specific expression in the adult salivary glands. We calculated τ (Yanai et al., 2005), a measure of tissue specificity that varies between 0 (no specificity) and 1 (highly tissue-specific), for all probes with highest intensities in salivary glands, plotted them against the intensity for that probe, and cross-referenced outliers with available GAL4 lines. Irk1 was one of the few genes with both high, tissue-specific expression and an available transgene with GAL4 line expressed downstream of the promoter (Fig. 1B and C). To confirm this tissue-specificity, we crossed Irk1-GAL4 to the UAS-mCherry reporter line, and dissected F1 progeny. Indeed, in Irk1-GAL4, UAS-mCherry (Irk1 > mCherry) flies we observed strong mCherry expression in the adult salivary glands, which are mostly composed of larger Irk1-expressing secretory cells, and smaller duct cells in the anterior-most tip (Fig. 1C). Of note, we observed some limited expression in other tissues, consistent with FlyAtlas data indicating Irk1 expression in the brain, intestine (i.e. midgut), and malpighian tubules (Robinson et al., 2013). Consistent with a secretory role, we observed strong mCherry accumulation in apical secretory cells and the salivary gland lumen of Irk1 > mCherry flies, indicating secretion of cytoplasmic contents may not be highly specific (Fig. 1F). We also observed autofluorescent puncta in the anterior-most secretory cells bordering the duct (Fig. 1D), suggesting region-specific roles for salivary gland secretory cells reminiscent of the regionalization of the Drosophila midgut (Buchon et al., 2013; Marianes and Spradling, 2013). Therefore, Irk1-GAL4 is a tool that can be used for genetic dissection
3.2. Drosophila salivary glands are susceptible to infection by multiple arboviruses Drosophila has been instrumental in the discovery of conserved insect antiviral immune pathways, including those with a role during arbovirus infection of mosquitoes. Most studies using the Drosophila model of arbovirus infection have focused on systemic infections and more recently neural and intestinal infections (Liu et al., 2018; Palmer et al., 2018; Sansone et al., 2015). Whether adult Drosophila salivary glands can be infected by mosquito-borne viruses has not been explored. Therefore, we systemically challenged Drosophila with arboviruses from different families of viruses. We tested the rhabdovirus vesicular stomatitis virus (VSV), the bunyavirus La Crosse virus (LACV), three flaviviruses (Zika virus, ZIKV; dengue virus, DENV; and West Nile virus, WNV), and 2 alphaviruses (Sindbis virus, SINV; Mayaro virus, MAYV). We also compared infection of wild type flies with flies carrying a null mutation for the key antiviral RNAi effector AGO2 (AGO2414, referred to as AGO2−/−). We used this genotype because AGO2 mutants are known to be more susceptible to infection of many arboviruses 3
Virology 543 (2020) 1–6
W.H. Palmer, et al.
previously shown for ZIKV (Liu et al., 2018). Generally, Drosophila salivary glands were remarkably resistant to arbovirus infection. For VSV, LACV, SINV, DENV and MAYV, we only observed infection of a small subset (< 10) of secretory cells, even in AGO2 mutants (Fig. 2B and C). For SINV infection, we observed low levels of infection that were not clearly impacted by AGO2−/− status. Since GFP reporters are robust, we next challenged flies with VSVGFP or SINVGFP for up to 60 days, but we did not observe increased infection by these viruses in either background (not shown). We also observed that AGO2−/− fat bodies were susceptible to WNV-Kunjin infection, and this was associated with greater adherence of fat body cells to salivary glands following dissection even though the overall levels of infection were similar in WT versus AGO2−/− whole animals (Fig. 2B, Fig. S1). This made it difficult to determine if there was a low level of salivary gland infection. We also observed this phenotype in DENV-infected AGO2−/− fat bodies, although with a lower penetrance (Fig. 2B). It suggests that WNV and DENV-infected cells display increased adherence. Of the viruses tested, we found that ZIKV infection of Drosophila salivary glands was the most striking (Figs. 2B and 3B). While the proportion of infected salivary glands was comparable to other viruses (approximately 5% of challenged wild-type individuals become infected), many more cells per salivary gland were infected, with associated strong staining of the flavivirus E protein antibody. Additionally, the tropism differed from most other infections. While VSV, LACV, DENV, and SINV were found to infect secretory cells along the middle of the anterior-posterior salivary gland axis, ZIKV infected the curled posterior end of the salivary gland. This infection was associated with hypertrophy of the cells in the posterior salivary gland, causing significantly increased width of the posterior salivary gland (1.7 times
Fig. 2. Drosophila salivary glands are susceptible to infection by a subset of arboviruses. Wild-type flies or AGO2 mutants were challenged with a panel of arboviruses, dissected 5 (A), 10 (A), or 20 (A, B, C) days post infection, and visualized using fluorescent confocal microscopy (GFP, green; nuclei, blue). (A) Infection of AGO2 mutants by the rhabdovirus VSVGFP was readily observed in fat body cells associated with the salivary glands (white triangle with asterisk) by 10 days following infection and in salivary gland secretory cells (white triangle) by 20 days following infection. (B) The panel of arboviruses were assayed 20 dpi. Infection is observed for the bunyavirus LACV (anti-LACV G1), the flaviviruses ZIKV, WNV and DENV (anti-flavivirus E protein), and the alphaviruses SINV and MAYV (anti-alphavirus E2). (C) The proportion of wild-type and AGO2 mutant salivary glands in which infection was observed 20 days following intrathoracic injection with a panel of arboviruses (n > 10 individuals). Scale bars = 20 μm.
including VSV and SINV in both flies and mosquitoes (Chotkowski et al., 2008; Goic et al., 2013; Mussabekova et al., 2017; Okamura et al., 2004; Van Rij et al., 2006). We started with VSV because it is experimentally the most promiscuous virus in flies and other systems. We challenged WT and AGO2 mutant flies with VSVGFP and dissected salivary glands 5, 10, and 20 days after infection (Fig. 2A). We observed infection of the fat body as previously described (Shelly et al., 2009), and that fat body cells sometimes adhere to the salivary glands (Fig. 2A). We found VSVGFP was able to infect the salivary glands, albeit poorly (approximately 0–5 cells per salivary gland). By day 20, we observed VSV infection of a subset of single secretory cells of the salivary gland, and therefore we used this time point during infection with other arboviruses. We next challenged wild-type and AGO2 mutant flies with a panel of viruses and dissected salivary glands 20 days post infection (Fig. 2B) and in parallel quantified infection of wild type versus AGO2 mutant whole flies (Fig. S1). We and others have previously infected flies and detected viral replication in adult flies with all of these viruses except MAYV (Liu et al., 2018; Xu and Cherry, 2014). In addition to VSV (Mueller et al., 2010), SINV, MAYV and LACV presented with increased overall infection in AGO2 mutants while there were no significant differences in DENV, ZIKV and WNV infected whole animals as was
Fig. 3. ZIKV infection of Drosophila salivary gland is associated with pathology and not controlled by established immune pathways. Hypertrophy of posterior secretory cells is associated with ZIKV infection. The width of the widest observed portion of the posterior salivary gland (A-B white dotted lines) was normalized to the width of the middle of the salivary gland along the anterior-posterior axis (quantified in C). Shown are examples of the posterior salivary gland in wild-type (Irk1 > + or Irk1 > mCherry) females that are (A) uninfected, (B) ZIKV-infected (ZIKV infection, green; nuclei, blue). (C) Increased posterior gland width is associated with ZIKV infection (n = 8, per treatment; significance assessed with a linear model with a single predictor for infection status). (D) Irk1 driving an RNAi targeting AGO2 silences AGO2 expression, as measured by RT-qPCR of dissected salivary glands (n = 2; Mean ± SEM). (E) Flies with Irk1-driven salivary gland expression of the indicated RNAi transgenes against previously described innate immune pathways were infected with ZIKV and RT-qPCR performed on RNA from dissected salivary glands (n = 2; Mean ± SEM). Scale bars = 20 μm. 4
Virology 543 (2020) 1–6
W.H. Palmer, et al.
mechanism in Anopheles and Drosophila (Carissimo et al., 2015; Mondotte et al., 2018). When we challenged flies lacking the essential RNA silencing component AGO2, we observed increased systemic infection by many but not all of these viruses, and that there was only a modest effect on salivary gland infection across the arbovirus panel. This could be an indirect effect mediated by increased infection of other tissues, as salivary gland knockdown of AGO2 did not impact infection – a distinction that would have been more difficult to ascertain in the absence of tissue-specific genetic tools. That the intestinal midgut epithelium, the salivary gland epithelium and the ovarian epithelium (follicular epithelium) (Martins et al., 2019) are all resistant to infection largely independent of RNA silencing suggests that other innate or nonimmune pathways may play a larger role in polarized epithelial tissues. Indeed, we and others have begun to characterize additional antiviral pathways which are active in diverse tissues, including the gut and the brain (Buchon et al., 2014; Ferreira et al., 2014; Sansone et al., 2015). To selectively manipulate the salivary gland, we developed a tissue-specific driver and used this new tool to selectively deplete a panel of innate antiviral genes in the salivary gland. This included the antiviral RNAi pathway (AGO2), Toll signalling pathway (MyD88, pelle), Imd signalling pathway (TAK1, rel), STING, and autophagy (Atg16). We did not observe enhancement of either VSV or ZIKV infection upon loss of any of these well-characterized immune genes. This suggests that either immune responses in this tissue are unique, or there has been some degree of virus specialization in mosquito salivary glands (e.g. for entry receptors), rendering arboviruses unable to efficiently infect the Drosophila salivary gland. If the latter is true, this system could be used to disentangle the adaptive journey diverse arboviruses have taken to specialize on their mosquito hosts, for example, by expressing putative mosquito entry receptors in Drosophila and determining if there is associated increased infection. Thus, future studies are needed to define the pathways and players that control arbovirus infection of the salivary gland.
greater than the width of the middle salivary gland; p = 0.004; Fig. 3A, B, C). Since we observed systemic infection of each of these arboviruses (Fig. S1), these data suggest a salivary gland-specific barrier underlies the observed low infection rate. Together, these data suggest that the Drosophila salivary gland barrier is effective against diverse arboviruses, and that VSV and ZIKV are promising candidates for further study of salivary gland immune responses using the Drosophila model. While AGO2−/− mutant flies may be slightly more likely to have infected salivary glands than wild-type controls across the viral panel (Fig. 2; p = 0.07, binomial linear model) there are clearly additional mechanisms at play. 3.3. Abrogation of common innate immune pathways does not increase susceptibility to infection While the infection of AGO2 mutant animals was perhaps modestly increased, it seems likely that other pathways play more important roles in these cells. Therefore, we set out to test a panel of known immune genes silenced specifically in the salivary glands, by crossing Irk1GAL4 flies to flies carrying a UAS-driven RNAi transgene. Specifically, we knocked down genes required for antiviral RNAi (AGO2), Toll signalling (MyD88, pelle), Imd signalling (TAK1, rel, imd), JAK-STAT signalling (STAT92E), STING, and autophagy (Atg16) using established RNAi lines and overexpressed a negative regulator of JAK-STAT (Socs36E) (Billes et al., 2018; Callus and Mathey-Prevot, 2002; Liu et al., 2018; Nagy et al., 2016; Sansone et al., 2015; Schmid et al., 2014). We verified that RNA silencing is effective in this tissue (Fig. 3D; p < 0.001). However, we did not observe increased frequency or intensity of infection with VSVGFP or ZIKV in the salivary glands upon depletion of any of these genes using fluorescent confocal microscopy (data not shown). Next, we challenged a subset of these genotypes with ZIKV and dissected salivary glands to measure ZIKV levels by RT-qPCR. We did not observe significant differences between wild-type controls (Irk1 > +) and flies depleted of immune genes including STING, Rel and Atg16 which have been found to control ZIKV in the brain (Fig. 3E) (Liu et al., 2018). Moreover, as observed in whole body AGO2−/− animals, we did not observe increased infection in Irk1 > AGO2IR salivary glands. Taken together, we conclude that the Drosophila salivary gland is highly resistant to arbovirus infection, and that this protection may be defined by previously uncharacterized tissue-specific immune control.
Author contributions William Palmer: Conceptualization; Data curation; Methodology; Project administration; Visualization; Writing - original draft; Writing review & editing. Mark Dittmar: Resources. Beth Gordesky-Gold: Resources, Investigation. Jennifer Hofmann: Investigation. Sara Cherry: Conceptualization; Methodology; Project administration; Resources; Visualization; Funding acquisition; Supervision; Writing - original draft;Writing - review & editing.
4. Discussion Declaration of competing interest
The infection cycle of arthropod-borne viruses is complex. These viruses must cross two major barriers for transmission in the vector: the intestine (i.e. midgut) and the salivary gland. These barriers are both physical and immunological; however, our mechanistic understanding of the molecular mechanisms at play is incomplete. Many studies have explored the antiviral pathways in the gut, and that regulate systemic immunity while much fewer have tackled the salivary glands. This is in part due to difficulties in experimentally probing this tissue. Thus, we set out to develop a Drosophila model to allow for more facile study of salivary glands in a genetically tractable organism. In particular, the ability to perform studies selectively perturbing this tissue will allow us to identify antiviral mechanisms active in this tissue. We found that the adult salivary gland was highly resistant to infection by a panel of arboviruses. This was perhaps not surprising, as we and others have shown that the intestinal midgut epithelium is also highly resistant to arbovirus infection (Ferreira et al., 2014; Mondotte et al., 2018; Sansone et al., 2015; Xu et al., 2013). In addition, while it is clear that the antiviral RNA silencing pathway can be potently antiviral against systemic infection, studies have shown that the intestinal midgut epithelium does not restrict these viruses through this
The authors have no conflicts of interest to report. Acknowledgements We thank Richard Hardy for kindly sharing the SINVrepGFP fly line with us, Michael Diamond and Robert Tesh for arboviruses, Michael Diamond and Carolyn Coyne for sharing antibodies, the Bloomington and Vienna fly stock centers and community for flies. We thank members of the Cherry laboratory for advice and technical support. This work was supported by NIH grant 2T32AI055400 to W.H.P., and RO1AI122749, RO1AI150246 and R01AI140539 to S.C. Support was provided by the Burroughs Wellcome Investigators in the Pathogenesis of Infectious Disease Award to S.C. Appendix A. Supplementary data Supplementary data to this article can be found online at https:// doi.org/10.1016/j.virol.2020.01.010. 5
Virology 543 (2020) 1–6
W.H. Palmer, et al.
References
Mayer, S.V., Tesh, R.B., Vasilakis, N., 2017. The emergence of arthropod-borne viral diseases: a global prospective on dengue, chikungunya and zika fevers. Acta Trop. 166, 155–163. Mondotte, J.A., Gausson, V., Frangeul, L., Blanc, H., Lambrechts, L., Saleh, M.C., 2018. Immune priming and clearance of orally acquired RNA viruses in Drosophila. Nat. Microbiol. 3, 1394–1403. Mueller, S., Gausson, V., Vodovar, N., Deddouche, S., Troxler, L., Perot, J., Pfeffer, S., Hoffmann, J.A., Saleh, M.C., Imler, J.L., 2010. RNAi-mediated immunity provides strong protection against the negative-strand RNA vesicular stomatitis virus in Drosophila. Proc. Natl. Acad. Sci. U. S. A. 107, 19390–19395. Mussabekova, A., Daeffler, L., Imler, J.L., 2017. Innate and intrinsic antiviral immunity in Drosophila. Cell. Mol. Life Sci. 74, 2039–2054. Nagy, P., Kovacs, L., Sandor, G.O., Juhasz, G., 2016. Stem-cell-specific endocytic degradation defects lead to intestinal dysplasia in Drosophila. Dis. Model Mech. 9, 501–512. Nawa, M., Takasaki, T., Yamada, K.I., Akatsuka, T., Kurane, I., 2001. Development of dengue IgM-capture enzyme-linked immunosorbent assay with higher sensitivity using monoclonal detection antibody. J. Virol Methods 92, 65–70. Okamura, K., Ishizuka, A., Siomi, H., Siomi, M.C., 2004. Distinct roles for Argonaute proteins in small RNA-directed RNA cleavage pathways. Genes Dev. 18, 1655–1666. Pal, P., Dowd, K.A., Brien, J.D., Edeling, M.A., Gorlatov, S., Johnson, S., Lee, I., Akahata, W., Nabel, G.J., Richter, M.K.S., Smit, J.M., Fremont, D.H., Pierson, T.C., Heise, M.T., Diamond, M.S., 2013. Development of a highly protective Combination monoclonal antibody therapy against chikungunya virus. PLoS Pathog. 9, e1003312. Palmer, W.H., Varghese, F.S., van Rij, R.P., 2018. Natural variation in resistance to virus infection in Dipteran insects. Viruses 10, 118. Pompon, J., Manuel, M., Ng, G.K., Wong, B., Shan, C., Manokaran, G., Soto-Acosta, R., Bradrick, S.S., Ooi, E.E., Missé, D., Shi, P.-Y., Garcia-Blanco, M.A., 2017. Dengue subgenomic flaviviral RNA disrupts immunity in mosquito salivary glands to increase virus transmission. PLoS Pathog. 13, e1006535. Ribeiro, J.M.C., Arcà, B., Lombardo, F., Calvo, E., Phan, V.M., Chandra, P.K., Wikel, S.K., 2007. An annotated catalogue of salivary gland transcripts in the adult female mosquito, Aedes aegypti. BMC Genom. 8, 6. Robinson, S.W., Herzyk, P., Dow, J.A.T., Leader, D.P., 2013. FlyAtlas: database of gene expression in the tissues of Drosophila melanogaster. Nucleic Acids Res. 41, D744–D750. Rose, P.P., Hanna, S.L., Spiridigliozzi, A., Wannissorn, N., Beiting, D.P., Ross, S.R., Hardy, R.W., Bambina, S.A., Heise, M.T., Cherry, S., 2011. Natural resistance-associated macrophage protein is a cellular receptor for sindbis virus in both insect and mammalian hosts. Cell Host Microbe 10, 97–104. Ruckert, C., Bell-Sakyi, L., Fazakerley, J.K., Fragkoudis, R., 2014. Antiviral responses of arthropod vectors: an update on recent advances. Virus disease 25, 249–260. Sansone, Christine L., Cohen, J., Yasunaga, A., Xu, J., Osborn, G., Subramanian, H., Gold, B., Buchon, N., Cherry, S., 2015. Microbiota-dependent priming of antiviral intestinal immunity in Drosophila. Cell Host Microbe 18, 571–581. Schmid, M.R., Anderl, I., Vesala, L., Vanha-aho, L.-M., Deng, X.-J., Rämet, M., Hultmark, D., 2014. Control of Drosophila blood cell activation via Toll signaling in the fat body. PloS One 9, e102568. Schonborn, J., Oberstrass, J., Breyel, E., Tittgen, J., Schumacher, J., Lukacs, N., 1991. Monoclonal antibodies to double-stranded RNA as probes of RNA structure in crude nucleic acid extracts. Nucleic Acids Res. 19, 2993–3000. Shelly, S., Lukinova, N., Bambina, S., Berman, A., Cherry, S., 2009. Autophagy is an essential component of Drosophila immunity against vesicular stomatitis virus. Immunity 30, 588–598. Sim, S., Ramirez, J.L., Dimopoulos, G., 2012. Dengue virus infection of the Aedes aegypti salivary gland and chemosensory apparatus induces genes that modulate infection and blood-feeding behavior. PLoS Pathog. 8, e1002631. Soldan, S.S., Plassmeyer, M.L., Matukonis, M.K., González-Scarano, F., 2005. La Crosse virus nonstructural protein NSs counteracts the effects of short interfering RNA. J. Virol. 79, 234–244. Van Rij, R.P., Saleh, M.C., Berry, B., Foo, C., Houk, A., Antoniewski, C., Andino, R., 2006. The RNA silencing endonuclease Argonaute 2 mediates specific antiviral immunity in Drosophila melanogaster. Genes Dev. 20, 2985–2995. Wang, Y.H., Chang, M.M., Wang, X.L., Zheng, A.H., Zou, Z., 2018. The immune strategies of mosquito Aedes aegypti against microbial infection. Dev. Comp. Immunol. 83, 12–21. Xu, J., Cherry, S., 2014. Viruses and antiviral immunity in Drosophila. Dev. Comp. Immunol. 42, 67–84. Xu, J., Grant, G., Sabin, L.R., Gordesky-Gold, B., Yasunaga, A., Tudor, M., Cherry, S., 2012. Transcriptional pausing controls a rapid antiviral innate immune response in Drosophila. Cell Host Microbe 12, 531–543. Xu, J., Hopkins, K., Sabin, L., Yasunaga, A., Subramanian, H., Lamborn, I., GordeskyGold, B., Cherry, S., 2013. ERK signaling couples nutrient status to antiviral defense in the insect gut. Proc. Natl. Acad. Sci. Unit. States Am. 110, 15025–15030. Yanai, I., Benjamin, H., Shmoish, M., Chalifa-Caspi, V., Shklar, M., Ophir, R., Bar-Even, A., Horn-Saban, S., Safran, M., Domany, E., Lancet, D., Shmueli, O., 2005. Genomewide midrange transcription profiles reveal expression level relationships in human tissue specification. Bioinformatics 21, 650–659. Yasunaga, A., Hanna, S.L., Li, J., Cho, H., Rose, P.P., Spiridigliozzi, A., Gold, B., Diamond, M.S., Cherry, S., 2014. Genome-wide RNAi screen identifies broadly-acting host factors that inhibit arbovirus infection. PLoS Pathog. 10, e1003914.
Avadhanula, V., Weasner, B.P., Hardy, G.G., Kumar, J.P., Hardy, R.W., 2009. A novel system for the launch of alphavirus RNA synthesis reveals a role for the Imd pathway in arthropod antiviral response. PLoS Pathog. 5, e1000582. Billes, V., Kovács, T., Manzéger, A., Lőrincz, P., Szincsák, S., Regős, Á., Kulcsár, P.I., Korcsmáros, T., Lukácsovich, T., Hoffmann, G., Erdélyi, M., Mihály, J., Takács-Vellai, K., Sass, M., Vellai, T., 2018. Developmentally regulated autophagy is required for eye formation in Drosophila. Autophagy 14, 1499–1519. Buchon, N., Osman, D., David, Fabrice P.A., Yu Fang, H., Boquete, J.P., Deplancke, B., Lemaitre, B., 2013. Morphological and molecular characterization of adult midgut compartmentalization in Drosophila. Cell Rep. 3, 1725–1738. Buchon, N., Silverman, N., Cherry, S., 2014. Immunity in Drosophila melanogaster–from microbial recognition to whole-organism physiology. Nat. Rev. Immunol. 14, 796–810. Callus, B.A., Mathey-Prevot, B., 2002. SOCS36E, a novel Drosophila SOCS protein, suppresses JAK/STAT and EGF-R signalling in the imaginal wing disc. Oncogene 21, 4812–4821. Carissimo, G., Pondeville, E., McFarlane, M., Dietrich, I., Mitri, C., Bischoff, E., Antoniewski, C., Bourgouin, C., Failloux, A.-B., Kohl, A., Vernick, K.D., 2015. Antiviral immunity of Anopheles gambiae is highly compartmentalized, with distinct roles for RNA interference and gut microbiota. Proc. Natl. Acad. Sci. Unit. States Am. 112, E176–E185. Chaverra-Rodriguez, D., Macias, V.M., Hughes, G.L., Pujhari, S., Suzuki, Y., Peterson, D.R., Kim, D., McKeand, S., Rasgon, J.L., 2018. Targeted delivery of CRISPR-Cas9 ribonucleoprotein into arthropod ovaries for heritable germline gene editing. Nat. Commun. 9, 3008. Chotkowski, H.L., Ciota, A.T., Jia, Y., Puig-Basagoiti, F., Kramer, L.D., Shi, P.Y., Glaser, R.L., 2008. West Nile virus infection of Drosophila melanogaster induces a protective RNAi response. Virology 377, 197–206. Ferreira, Á.G., Naylor, H., Esteves, S.S., Pais, I.S., Martins, N.E., Teixeira, L., 2014. The toll-dorsal pathway is required for resistance to viral oral infection in Drosophila. PLoS Pathog. 10, e1004507. Franz, A.W.E., Kantor, A.M., Passarelli, A.L., Clem, R.J., 2015. Tissue barriers to arbovirus infection in mosquitoes. Viruses 7, 3741–3767. Goic, B., Vodovar, N., Mondotte, J.A., Monot, C., Frangeul, L., Blanc, H., Gausson, V., Vera-Otarola, J., Cristofari, G., Saleh, M.-C., 2013. RNA-mediated interference and reverse transcription control the persistence of RNA viruses in the insect model Drosophila. Nat. Immunol. 14, 396–403. Grubaugh, N.D., Weger-Lucarelli, J., Murrieta, R.A., Fauver, J.R., Garcia-Luna, S.M., Prasad, A.N., Black, W.C., Ebel, G.D., 2016. Genetic drift during systemic arbovirus infection of mosquito vectors leads to decreased relative fitness during host switching. Cell Host Microbe 19, 481–492. Hopkins, K.C., McLane, L.M., Maqbool, T., Panda, D., Gordesky-Gold, B., Cherry, S., 2013. A genome-wide RNAi screen reveals that mRNA decapping restricts bunyaviral replication by limiting the pools of Dcp2-accessible targets for cap-snatching. Genes Dev. 27, 1511–1525. Kistler, Kathryn E., Vosshall, Leslie B., Matthews, Benjamin J., 2015. Genome engineering with CRISPR-Cas9 in the mosquito Aedes aegypti. Cell Rep. 11, 51–60. Labeaud, A.D., Bashir, F., King, C.H., 2011. Measuring the burden of arboviral diseases: the spectrum of morbidity and mortality from four prevalent infections. Popul. Health Metrics 9, 1. Lemaitre, B., Nicolas, E., Michaut, L., Reichhart, J.M., Hoffmann, J.A., 1996. The dorsoventral regulatory gene cassette spätzle/Toll/cactus controls the potent antifungal response in Drosophila adults. Cell 86, 973–983. Liu, Y., Gordesky-Gold, B., Leney-Greene, M., Weinbren, N.L., Tudor, M., Cherry, S., 2018. Inflammation-induced, STING-dependent autophagy restricts zika virus infection in the Drosophila brain. Cell Host Microbe 24, 57–68 e53. Luplertlop, N., Surasombatpattana, P., Patramool, S., Dumas, E., Wasinpiyamongkol, L., Saune, L., Hamel, R., Bernard, E., Sereno, D., Thomas, F., Piquemal, D., Yssel, H., Briant, L., Missé, D., 2011. Induction of a peptide with activity against a broad spectrum of pathogens in the Aedes aegypti salivary gland, following Infection with Dengue Virus. PLoS Pathog. 7, e1001252. Marianes, A., Spradling, A.C., 2013. Physiological and stem cell compartmentalization within the Drosophila midgut. eLife 2, e00886. Martins, N., Lemoine, A., Santiago, E., Paro, S., Imler, J.L., Meignin, C., 2019. A transgenic flock house virus replicon reveals an RNAi independent antiviral mechanism acting in Drosophila follicular somatic cells. G3 (Bethesda) 9, 403–412. Matthews, B.J., Dudchenko, O., Kingan, S.B., Koren, S., Antoshechkin, I., Crawford, J.E., Glassford, W.J., Herre, M., Redmond, S.N., Rose, N.H., Weedall, G.D., Wu, Y., Batra, S.S., Brito-Sierra, C.A., Buckingham, S.D., Campbell, C.L., Chan, S., Cox, E., Evans, B.R., Fansiri, T., Filipović, I., Fontaine, A., Gloria-Soria, A., Hall, R., Joardar, V.S., Jones, A.K., Kay, R.G.G., Kodali, V.K., Lee, J., Lycett, G.J., Mitchell, S.N., Muehling, J., Murphy, M.R., Omer, A.D., Partridge, F.A., Peluso, P., Aiden, A.P., Ramasamy, V., Rašić, G., Roy, S., Saavedra-Rodriguez, K., Sharan, S., Sharma, A., Smith, M.L., Turner, J., Weakley, A.M., Zhao, Z., Akbari, O.S., Black, W.C., Cao, H., Darby, A.C., Hill, C.A., Johnston, J.S., Murphy, T.D., Raikhel, A.S., Sattelle, D.B., Sharakhov, I.V., White, B.J., Zhao, L., Aiden, E.L., Mann, R.S., Lambrechts, L., Powell, J.R., Sharakhova, M.V., Tu, Z., Robertson, H.M., McBride, C.S., Hastie, A.R., Korlach, J., Neafsey, D.E., Phillippy, A.M., Vosshall, L.B., 2018. Improved reference genome of Aedes aegypti informs arbovirus vector control. Nature 563, 501–507.
6
Contents lists available at ScienceDirect
Virology journal homepage: www.elsevier.com/locate/virology
Drosophila melanogaster as a model for arbovirus infection of adult salivary glands
T
William H. Palmer, Mark Dittmar, Beth Gordesky-Gold, Jennifer Hofmann, Sara Cherry∗ Department of Microbiology, Perelman School of Medicine, University of Pennsylvania, 472A Stemmler Hall, 3450 Hamilton Walk, Philadelphia, PA, 19104, USA
A R T I C LE I N FO
A B S T R A C T
Keywords: Arbovirus Innate immunity Salivary gland Drosophila melanogaster Tissue barrier Zika virus Vesicular stomatitis virus
Arboviruses are an emerging threat to public health. Arbovirus transmission to vertebrates hinges on dissemination from the arthropod gastrointestinal tract, and ultimately infection of the arthropod salivary glands. Therefore, salivary gland immunity impacts arbovirus transmission; however, these immune responses are poorly understood. Here, we describe the utility of Drosophila melanogaster as a salivary gland infection model. First, we describe the use of a salivary gland-specific driver to launch RNA interference or virus replicon transgenes. Next, we infect flies with an arbovirus panel and find multiple viruses that infect Drosophila salivary glands, albeit inefficiently. We find that this infection is not controlled by antiviral RNA silencing; thus, we silence a panel of immune genes in the salivary glands, but do not observe changes in infection. These data suggest that Drosophila may be used to study salivary gland infection, and that there are likely unexplored pathways controlling infection of this tissue.
1. Introduction Arthropod-borne viruses (arboviruses) are an increasing burden on global health, with current outbreaks of dengue (DENV), Zika (ZIKV), and chikungunya (CHIKV) viruses associated with hemorrhagic fever, microcephaly, and arthritic disease, respectively (Labeaud et al., 2011; Mayer et al., 2017). These, and other, emerging arboviruses are transmitted between vertebrates and blood-feeding arthropods, such as mosquitoes. Following a viremic blood meal, arboviruses replicate in the mosquito gastrointestinal tract (also known as the mosquito alimentary tract), eventually disseminating into the body cavity resulting in systemic infection and ultimately salivary gland infection, a tropism requisite for transmission back to vertebrates during the next blood meal. The progression of arbovirus infection through the mosquito host is thus met with multiple tissue barriers to infection, including infection and escape from the midgut and salivary gland tissues (Franz et al., 2015). These barriers are both physical and immunological in nature (Ruckert et al., 2014), and highly efficient as evidenced by severe bottlenecks in viral populations as infection progresses through them (Grubaugh et al., 2016). However, while the importance of tissue barriers during arbovirus infection of arthropods is clear, we have only a rudimentary understanding of the molecular mechanisms that underlie this immune protection. Infection of the salivary glands is the ultimate tropism required for
∗
transmission to vertebrates, and therefore an understanding of virushost interactions in this tissue is of great importance. While studies have implicated antiviral pathways such as RNA interference, NF-κB, and JAK-STAT as important immune defences during arbovirus infection of mosquitoes, only a handful of studies have focussed specifically on salivary gland immunity (Ruckert et al., 2014; Wang et al., 2018). In general, these studies extend the role for NF-κB (Toll and Imd pathways in insects) in salivary gland defence in mosquitoes. For example, differential expression analyses of DENV-infected salivary glands identified a NF-κB-responsive membrane permeabilizing cecropin-like peptide that is induced during infection and inactivates DENV and CHIKV, as well as an antiviral cystatin and ankyrin-repeat containing protein (Luplertlop et al., 2011; Ribeiro et al., 2007; Sim et al., 2012). Additionally, a DENV subgenomic RNA preferentially inhibits Toll signaling in salivary glands, suggesting its importance in this tissue (Pompon et al., 2017). Further dissection of salivary gland immune pathways could benefit from genetic tools to control gene expression in vivo; however, currently the genetic toolkit available in mosquitoes remains limited (although see e.g. (Chaverra-Rodriguez et al., 2018; Kistler et al., 2015; Matthews et al., 2018)). On the other hand, Drosophila melanogaster has proven itself as a useful model for dissection of immune pathways, primarily due to a wealth of genetic resources. Indeed, our knowledge of immunity in insects is owed, in large part, to the resourcefulness of the Drosophila
Corresponding author. E-mail address: [email protected] (S. Cherry).
https://doi.org/10.1016/j.virol.2020.01.010 Received 24 September 2019; Received in revised form 21 January 2020; Accepted 22 January 2020 Available online 25 January 2020 0042-6822/ © 2020 Published by Elsevier Inc.
Virology 543 (2020) 1–6
W.H. Palmer, et al.
the proventriculus barely visible from the abdomen, with three smaller tubule-like structures. The first is the tract leading from the proventriculus to the crop, and the other two are the salivary gland ducts, the anterior-most portion of the salivary glands. Finally, the proventriculus and crop are pulled from the abdomen, and the salivary glands are severed from the digestive tract.
model, with some discoveries illuminating even more broadly conserved immune mechanisms (e.g. the Toll-like receptors (Lemaitre et al., 1996)). The fly model has been useful in the study of arbovirus infection (e.g. (Chotkowski et al., 2008; Goic et al., 2013; Liu et al., 2018; Rose et al., 2011; Shelly et al., 2009; Van Rij et al., 2006; Xu et al., 2012; Xu et al., 2013; Yasunaga et al., 2014)). While not a native host, arboviruses can infect Drosophila intestinal epithelial cells following oral challenge, and these viruses display broad tropism within the body cavity infecting a number of different tissues upon systemic challenge, allowing the study of immune responses at play during enteric infection and following midgut escape, respectively (Sansone et al., 2015; Xu et al., 2013). Studies in flies have characterized antiviral pathways that defend against arbovirus infection, and identified antiviral roles for ERK, STING, autophagy, each of which have a conserved antiviral function in vertebrates ((Liu et al., 2018) and reviewed in (Buchon et al., 2014; Palmer et al., 2018)). Despite the success of these approaches, to date the Drosophila model has not been used to study salivary gland infection of dipterans, and the adult Drosophila salivary gland remains poorly characterized. Here, we aim to assess the utility of Drosophila model in the study of salivary gland infections. We perform the initial characterization of a salivary gland-specific promoter and use this as a tool to launch a Sindbis virus (SINV) replicon (Avadhanula et al., 2009). Next, we infect flies with a panel of arboviruses from diverse families, and find that a subset can infect the salivary gland secretory cells, albeit at a low frequency. We find that of this panel, Zika virus (ZIKV) infection is most striking and is associated with salivary gland pathology. Lastly, we tested the role of previously described innate immune pathways in the salivary gland. Our findings suggest that the antiviral RNA silencing pathway and other well-characterized immune pathways do not control infection of the salivary glands. Thus, we hope these characterizations will provide a starting point for future studies of salivary gland immunity in Drosophila.
2.3. Infection of Drosophila Females from fly genotypes of interest were microinjected with approximately 100 nL into the anterior ventral abdomen using an Eppendorf Femtojet. Viruses included vesicular stomatitis virus expressing GFP, (VSVGFP; 1.35 × 109 pfu/mL) (Shelly et al., 2009), La Crosse virus (LACV original strain; 1.9 × 108 pfu/mL) (Hopkins et al., 2013), Zika virus (ZIKV strain MR766; 1.7 × 109 pfu/mL) (Liu et al., 2018), dengue-2 virus (DENV-2 NGC; 5.5 × 107 pfu/mL) (Sansone et al., 2015), West Nile virus (WNV-Kunjin; 8 × 107 pfu/mL) (Yasunaga et al., 2014), Sindbis virus expressing GFP (SINVGFP strain hrSp; 1.9 × 109 pfu/mL) (Rose et al., 2011) and Mayaro virus (MAYV; 8 × 107 pfu/mL). Infected flies were transferred to fresh medium weekly, and salivary glands dissected for downstream processing at the indicated time point. 2.4. Immunostaining of adult salivary glands Salivary glands from adult female flies were dissected in cold PBS, transferred to 4% paraformaldehyde for 30 min, and washed three times with PBS containing 0.1% Triton-X (PBST). Glands were blocked for 1 h with 5% Donkey serum in PBST (PBTD), then incubated overnight at 4° with primary antibodies diluted in PBTD. Primary antibody was removed, glands washed 3 times in PBST, and then incubated at room temperature for 2 h with secondary antibody (Alexa Fluor, ThermoFisher, 1:400) and Hoechst (1:500) diluted in PBTD. Finally, glands were washed 3 times in PBST, once in PBS, and allowed to equilibrate in Vectashield (Vector laboratories, Inc) for 30 min before mounting on glass slides. Fluorescent imaging was performed on a Leica DM5500 Q confocal microscope. Primary antibodies used were J2 (antidsRNA, 1:500) (Schonborn et al., 1991), 4G2 (anti-flavivirus, 1:1000) (Nawa et al., 2001), 807.31 (anti-LACV G1, 1:1000) (Soldan et al., 2005), and 265 (anti-alphavirus, 1:1000) (Pal et al., 2013).
2. Materials and methods 2.1. Drosophila rearing and genetics Fruit flies were housed in 25C incubators on a standard cornmeal diet during maintenance and following infections. The following fly stocks can be obtained from Bloomington Drosophila Stock Center (BDSC): w1118 (e.g. BDSC#3605), Irk1-GAL4 (BDSC#62587), UASAgo2IR (BDSC#34799), UAS-STINGIR (BDSC#31565), UAS-relIR (BDSC#33661), UAS-Atg16IR (BDSC#34358), UAS-STAT92EIR IR (BDSC#31317), UAS-imd (BDSC#3933) and UAS-TAK1IR (BDSC#53377). The following fly stocks can be obtained from Vienna Drosophila Resource Center: UAS-MyD88IR (VDRC#25402) and UASpelleIR (VDRC#2889), where IR indicates an RNAi transgene targeted against the gene of interest. Other fly stocks used were AGO2414 (Okamura et al., 2004) UAS-SINVrepGFP (Avadhanula et al., 2009), and UAS-Socs36E (Callus and Mathey-Prevot, 2002). Crosses between these lines were performed on dry yeasted cornmeal medium. Flies were allowed to mate for 3–4 days, and F1 progeny collected every 3–4 days following initial eclosion. 7–10 day old flies were used for infection assays as described below.
2.5. RNA extraction and RT-qPCR Salivary glands from approximately 30 female flies were dissected in PBS and transferred to TRIzol Reagent (Ambion). Each sample was DNase-treated and RNA was extracted using the RNA Clean and Concentrator kit (Zymo research). M-MLV reverse transcriptase (Invitrogen) was used to produce cDNA, which was used as a template for quantitative PCR using Power SYBR Green PCR Master Mix (Applied Biosystems). Relative virus RNA levels were obtained by normalizing virus RNA by the fruit fly housekeeping gene, RpL32. The primers used in this study were directed against Drosophila melanogaster AGO2 (Forward: GTCGGTCGTTCCTTCTTTAAGAT, Reverse: GACCAGGGCCT CGTATCCAT), Zika NS5 (Forward: ACTTGGTGGTGCAGCTTATC, Reverse: CACTTTCTCTGGCTTCCTCAA) and Drosophila melanogaster RpL32 (Forward: AAGAAGCGCACCAAGCACTTCATC, Reverse: TCTGT TGTCGATACCCTTGGGCTT) (Liu et al., 2018).
2.2. Dissection of adult salivary glands
3. Results and discussion
The adult salivary glands span the length of the thorax, where they adhere to the fly digestive tract (i.e. alimentary tract), and begin to curl once in the abdomen (Fig. 1). Dissection of salivary glands were performed with forceps and a glass dish filled with PBS. First, the head of the fly was severed, taking care not to remove any tissues from the thorax. Next the thorax was gripped lightly with the left forcep, with the right forcep forcefully pinched at the thorax-abdomen boundary, and the abdomen pulled from the thorax. This motion should result in
3.1. Irk1-GAL4 as a salivary gland-specific GAL4 driver The Drosophila salivary glands have been well-studied for their polytene chromosomes in larvae, but poorly characterized in adults. The study of Drosophila tissues has benefited from the GAL4-UAS system, where GAL4 binds to and induces transcription of a transgene 2
Virology 543 (2020) 1–6
W.H. Palmer, et al.
Fig. 1. Genetic tools useful for studying immune responses in the salivary gland. (A) A schematic of the use of the GAL4-UAS system to drive mCherry expression in the salivary glands. (B) Irk1 is among the most highly expressed and tissue-specific genes in the salivary gland. Data from FlyAtlas were analyzed to plot log-transformed intensity of each microarray probe (log2(Expression)) against a measure of tissue-specificity (τ) for the set of probes with highest expression in the salivary gland as compared to other tissues. (C) Irk1-GAL4 was crossed with UAS-mCherry and expression observed in the salivary gland in D. melanogaster adults (mCherry, red; nuclei, blue). (D) The anterior-most salivary gland exhibits autofluorescent puncta, (E) while the posterior gland curls back on itself. (F) mCherry is detected in the salivary gland lumen following expression in the secretory cells with Irk1GAL4. (G) Irk1-GAL4 was crossed with UAS-SINVGFP replicon (GFP, green; nuclei, blue). G′ shows a GFP expressing cells and G″ shows dsRNA production (anti-J2) in the GFP-expressing cell demonstrating replication. Scale bar 100 μm.
of salivary gland molecular pathways, such as those involved in innate immunity. As a proof of principle, we next used Irk1-GAL4 to drive expression of a UAS-responsive Sindbis virus replicon (SINVrepGFP), in which the structural proteins have been replaced by GFP (Avadhanula et al., 2009). Expression of GAL4 launches SINVrepGFP RNA, which expresses GFP upon successful viral replication. We observed a subset of cells across the salivary gland are permissive to replication of the SINV replicon, as evidenced by expression of GFP (Fig. 1G). We further verified that these cells had productive and ongoing replication by costaining with an antibody against dsRNA which is a replication intermediate (Fig. 1G).
with a UAS (Upstream Activating Sequence) promoter. Therefore, a transgenic Drosophila line with GAL4 under the control of an adult salivary gland-specific promoter could be crossed with UAS-controlled RNAi or overexpression transgenes to control expression of genes of interest in this tissue of progeny (Fig. 1A). To identify a GAL4 line suitable for the study of adult Drosophila salivary glands, we mined data from FlyAtlas, a resource for tissue-specific expression data in Drosophila (Robinson et al., 2013), to identify genes with high and specific expression in the adult salivary glands. We calculated τ (Yanai et al., 2005), a measure of tissue specificity that varies between 0 (no specificity) and 1 (highly tissue-specific), for all probes with highest intensities in salivary glands, plotted them against the intensity for that probe, and cross-referenced outliers with available GAL4 lines. Irk1 was one of the few genes with both high, tissue-specific expression and an available transgene with GAL4 line expressed downstream of the promoter (Fig. 1B and C). To confirm this tissue-specificity, we crossed Irk1-GAL4 to the UAS-mCherry reporter line, and dissected F1 progeny. Indeed, in Irk1-GAL4, UAS-mCherry (Irk1 > mCherry) flies we observed strong mCherry expression in the adult salivary glands, which are mostly composed of larger Irk1-expressing secretory cells, and smaller duct cells in the anterior-most tip (Fig. 1C). Of note, we observed some limited expression in other tissues, consistent with FlyAtlas data indicating Irk1 expression in the brain, intestine (i.e. midgut), and malpighian tubules (Robinson et al., 2013). Consistent with a secretory role, we observed strong mCherry accumulation in apical secretory cells and the salivary gland lumen of Irk1 > mCherry flies, indicating secretion of cytoplasmic contents may not be highly specific (Fig. 1F). We also observed autofluorescent puncta in the anterior-most secretory cells bordering the duct (Fig. 1D), suggesting region-specific roles for salivary gland secretory cells reminiscent of the regionalization of the Drosophila midgut (Buchon et al., 2013; Marianes and Spradling, 2013). Therefore, Irk1-GAL4 is a tool that can be used for genetic dissection
3.2. Drosophila salivary glands are susceptible to infection by multiple arboviruses Drosophila has been instrumental in the discovery of conserved insect antiviral immune pathways, including those with a role during arbovirus infection of mosquitoes. Most studies using the Drosophila model of arbovirus infection have focused on systemic infections and more recently neural and intestinal infections (Liu et al., 2018; Palmer et al., 2018; Sansone et al., 2015). Whether adult Drosophila salivary glands can be infected by mosquito-borne viruses has not been explored. Therefore, we systemically challenged Drosophila with arboviruses from different families of viruses. We tested the rhabdovirus vesicular stomatitis virus (VSV), the bunyavirus La Crosse virus (LACV), three flaviviruses (Zika virus, ZIKV; dengue virus, DENV; and West Nile virus, WNV), and 2 alphaviruses (Sindbis virus, SINV; Mayaro virus, MAYV). We also compared infection of wild type flies with flies carrying a null mutation for the key antiviral RNAi effector AGO2 (AGO2414, referred to as AGO2−/−). We used this genotype because AGO2 mutants are known to be more susceptible to infection of many arboviruses 3
Virology 543 (2020) 1–6
W.H. Palmer, et al.
previously shown for ZIKV (Liu et al., 2018). Generally, Drosophila salivary glands were remarkably resistant to arbovirus infection. For VSV, LACV, SINV, DENV and MAYV, we only observed infection of a small subset (< 10) of secretory cells, even in AGO2 mutants (Fig. 2B and C). For SINV infection, we observed low levels of infection that were not clearly impacted by AGO2−/− status. Since GFP reporters are robust, we next challenged flies with VSVGFP or SINVGFP for up to 60 days, but we did not observe increased infection by these viruses in either background (not shown). We also observed that AGO2−/− fat bodies were susceptible to WNV-Kunjin infection, and this was associated with greater adherence of fat body cells to salivary glands following dissection even though the overall levels of infection were similar in WT versus AGO2−/− whole animals (Fig. 2B, Fig. S1). This made it difficult to determine if there was a low level of salivary gland infection. We also observed this phenotype in DENV-infected AGO2−/− fat bodies, although with a lower penetrance (Fig. 2B). It suggests that WNV and DENV-infected cells display increased adherence. Of the viruses tested, we found that ZIKV infection of Drosophila salivary glands was the most striking (Figs. 2B and 3B). While the proportion of infected salivary glands was comparable to other viruses (approximately 5% of challenged wild-type individuals become infected), many more cells per salivary gland were infected, with associated strong staining of the flavivirus E protein antibody. Additionally, the tropism differed from most other infections. While VSV, LACV, DENV, and SINV were found to infect secretory cells along the middle of the anterior-posterior salivary gland axis, ZIKV infected the curled posterior end of the salivary gland. This infection was associated with hypertrophy of the cells in the posterior salivary gland, causing significantly increased width of the posterior salivary gland (1.7 times
Fig. 2. Drosophila salivary glands are susceptible to infection by a subset of arboviruses. Wild-type flies or AGO2 mutants were challenged with a panel of arboviruses, dissected 5 (A), 10 (A), or 20 (A, B, C) days post infection, and visualized using fluorescent confocal microscopy (GFP, green; nuclei, blue). (A) Infection of AGO2 mutants by the rhabdovirus VSVGFP was readily observed in fat body cells associated with the salivary glands (white triangle with asterisk) by 10 days following infection and in salivary gland secretory cells (white triangle) by 20 days following infection. (B) The panel of arboviruses were assayed 20 dpi. Infection is observed for the bunyavirus LACV (anti-LACV G1), the flaviviruses ZIKV, WNV and DENV (anti-flavivirus E protein), and the alphaviruses SINV and MAYV (anti-alphavirus E2). (C) The proportion of wild-type and AGO2 mutant salivary glands in which infection was observed 20 days following intrathoracic injection with a panel of arboviruses (n > 10 individuals). Scale bars = 20 μm.
including VSV and SINV in both flies and mosquitoes (Chotkowski et al., 2008; Goic et al., 2013; Mussabekova et al., 2017; Okamura et al., 2004; Van Rij et al., 2006). We started with VSV because it is experimentally the most promiscuous virus in flies and other systems. We challenged WT and AGO2 mutant flies with VSVGFP and dissected salivary glands 5, 10, and 20 days after infection (Fig. 2A). We observed infection of the fat body as previously described (Shelly et al., 2009), and that fat body cells sometimes adhere to the salivary glands (Fig. 2A). We found VSVGFP was able to infect the salivary glands, albeit poorly (approximately 0–5 cells per salivary gland). By day 20, we observed VSV infection of a subset of single secretory cells of the salivary gland, and therefore we used this time point during infection with other arboviruses. We next challenged wild-type and AGO2 mutant flies with a panel of viruses and dissected salivary glands 20 days post infection (Fig. 2B) and in parallel quantified infection of wild type versus AGO2 mutant whole flies (Fig. S1). We and others have previously infected flies and detected viral replication in adult flies with all of these viruses except MAYV (Liu et al., 2018; Xu and Cherry, 2014). In addition to VSV (Mueller et al., 2010), SINV, MAYV and LACV presented with increased overall infection in AGO2 mutants while there were no significant differences in DENV, ZIKV and WNV infected whole animals as was
Fig. 3. ZIKV infection of Drosophila salivary gland is associated with pathology and not controlled by established immune pathways. Hypertrophy of posterior secretory cells is associated with ZIKV infection. The width of the widest observed portion of the posterior salivary gland (A-B white dotted lines) was normalized to the width of the middle of the salivary gland along the anterior-posterior axis (quantified in C). Shown are examples of the posterior salivary gland in wild-type (Irk1 > + or Irk1 > mCherry) females that are (A) uninfected, (B) ZIKV-infected (ZIKV infection, green; nuclei, blue). (C) Increased posterior gland width is associated with ZIKV infection (n = 8, per treatment; significance assessed with a linear model with a single predictor for infection status). (D) Irk1 driving an RNAi targeting AGO2 silences AGO2 expression, as measured by RT-qPCR of dissected salivary glands (n = 2; Mean ± SEM). (E) Flies with Irk1-driven salivary gland expression of the indicated RNAi transgenes against previously described innate immune pathways were infected with ZIKV and RT-qPCR performed on RNA from dissected salivary glands (n = 2; Mean ± SEM). Scale bars = 20 μm. 4
Virology 543 (2020) 1–6
W.H. Palmer, et al.
mechanism in Anopheles and Drosophila (Carissimo et al., 2015; Mondotte et al., 2018). When we challenged flies lacking the essential RNA silencing component AGO2, we observed increased systemic infection by many but not all of these viruses, and that there was only a modest effect on salivary gland infection across the arbovirus panel. This could be an indirect effect mediated by increased infection of other tissues, as salivary gland knockdown of AGO2 did not impact infection – a distinction that would have been more difficult to ascertain in the absence of tissue-specific genetic tools. That the intestinal midgut epithelium, the salivary gland epithelium and the ovarian epithelium (follicular epithelium) (Martins et al., 2019) are all resistant to infection largely independent of RNA silencing suggests that other innate or nonimmune pathways may play a larger role in polarized epithelial tissues. Indeed, we and others have begun to characterize additional antiviral pathways which are active in diverse tissues, including the gut and the brain (Buchon et al., 2014; Ferreira et al., 2014; Sansone et al., 2015). To selectively manipulate the salivary gland, we developed a tissue-specific driver and used this new tool to selectively deplete a panel of innate antiviral genes in the salivary gland. This included the antiviral RNAi pathway (AGO2), Toll signalling pathway (MyD88, pelle), Imd signalling pathway (TAK1, rel), STING, and autophagy (Atg16). We did not observe enhancement of either VSV or ZIKV infection upon loss of any of these well-characterized immune genes. This suggests that either immune responses in this tissue are unique, or there has been some degree of virus specialization in mosquito salivary glands (e.g. for entry receptors), rendering arboviruses unable to efficiently infect the Drosophila salivary gland. If the latter is true, this system could be used to disentangle the adaptive journey diverse arboviruses have taken to specialize on their mosquito hosts, for example, by expressing putative mosquito entry receptors in Drosophila and determining if there is associated increased infection. Thus, future studies are needed to define the pathways and players that control arbovirus infection of the salivary gland.
greater than the width of the middle salivary gland; p = 0.004; Fig. 3A, B, C). Since we observed systemic infection of each of these arboviruses (Fig. S1), these data suggest a salivary gland-specific barrier underlies the observed low infection rate. Together, these data suggest that the Drosophila salivary gland barrier is effective against diverse arboviruses, and that VSV and ZIKV are promising candidates for further study of salivary gland immune responses using the Drosophila model. While AGO2−/− mutant flies may be slightly more likely to have infected salivary glands than wild-type controls across the viral panel (Fig. 2; p = 0.07, binomial linear model) there are clearly additional mechanisms at play. 3.3. Abrogation of common innate immune pathways does not increase susceptibility to infection While the infection of AGO2 mutant animals was perhaps modestly increased, it seems likely that other pathways play more important roles in these cells. Therefore, we set out to test a panel of known immune genes silenced specifically in the salivary glands, by crossing Irk1GAL4 flies to flies carrying a UAS-driven RNAi transgene. Specifically, we knocked down genes required for antiviral RNAi (AGO2), Toll signalling (MyD88, pelle), Imd signalling (TAK1, rel, imd), JAK-STAT signalling (STAT92E), STING, and autophagy (Atg16) using established RNAi lines and overexpressed a negative regulator of JAK-STAT (Socs36E) (Billes et al., 2018; Callus and Mathey-Prevot, 2002; Liu et al., 2018; Nagy et al., 2016; Sansone et al., 2015; Schmid et al., 2014). We verified that RNA silencing is effective in this tissue (Fig. 3D; p < 0.001). However, we did not observe increased frequency or intensity of infection with VSVGFP or ZIKV in the salivary glands upon depletion of any of these genes using fluorescent confocal microscopy (data not shown). Next, we challenged a subset of these genotypes with ZIKV and dissected salivary glands to measure ZIKV levels by RT-qPCR. We did not observe significant differences between wild-type controls (Irk1 > +) and flies depleted of immune genes including STING, Rel and Atg16 which have been found to control ZIKV in the brain (Fig. 3E) (Liu et al., 2018). Moreover, as observed in whole body AGO2−/− animals, we did not observe increased infection in Irk1 > AGO2IR salivary glands. Taken together, we conclude that the Drosophila salivary gland is highly resistant to arbovirus infection, and that this protection may be defined by previously uncharacterized tissue-specific immune control.
Author contributions William Palmer: Conceptualization; Data curation; Methodology; Project administration; Visualization; Writing - original draft; Writing review & editing. Mark Dittmar: Resources. Beth Gordesky-Gold: Resources, Investigation. Jennifer Hofmann: Investigation. Sara Cherry: Conceptualization; Methodology; Project administration; Resources; Visualization; Funding acquisition; Supervision; Writing - original draft;Writing - review & editing.
4. Discussion Declaration of competing interest
The infection cycle of arthropod-borne viruses is complex. These viruses must cross two major barriers for transmission in the vector: the intestine (i.e. midgut) and the salivary gland. These barriers are both physical and immunological; however, our mechanistic understanding of the molecular mechanisms at play is incomplete. Many studies have explored the antiviral pathways in the gut, and that regulate systemic immunity while much fewer have tackled the salivary glands. This is in part due to difficulties in experimentally probing this tissue. Thus, we set out to develop a Drosophila model to allow for more facile study of salivary glands in a genetically tractable organism. In particular, the ability to perform studies selectively perturbing this tissue will allow us to identify antiviral mechanisms active in this tissue. We found that the adult salivary gland was highly resistant to infection by a panel of arboviruses. This was perhaps not surprising, as we and others have shown that the intestinal midgut epithelium is also highly resistant to arbovirus infection (Ferreira et al., 2014; Mondotte et al., 2018; Sansone et al., 2015; Xu et al., 2013). In addition, while it is clear that the antiviral RNA silencing pathway can be potently antiviral against systemic infection, studies have shown that the intestinal midgut epithelium does not restrict these viruses through this
The authors have no conflicts of interest to report. Acknowledgements We thank Richard Hardy for kindly sharing the SINVrepGFP fly line with us, Michael Diamond and Robert Tesh for arboviruses, Michael Diamond and Carolyn Coyne for sharing antibodies, the Bloomington and Vienna fly stock centers and community for flies. We thank members of the Cherry laboratory for advice and technical support. This work was supported by NIH grant 2T32AI055400 to W.H.P., and RO1AI122749, RO1AI150246 and R01AI140539 to S.C. Support was provided by the Burroughs Wellcome Investigators in the Pathogenesis of Infectious Disease Award to S.C. Appendix A. Supplementary data Supplementary data to this article can be found online at https:// doi.org/10.1016/j.virol.2020.01.010. 5
Virology 543 (2020) 1–6
W.H. Palmer, et al.
References
Mayer, S.V., Tesh, R.B., Vasilakis, N., 2017. The emergence of arthropod-borne viral diseases: a global prospective on dengue, chikungunya and zika fevers. Acta Trop. 166, 155–163. Mondotte, J.A., Gausson, V., Frangeul, L., Blanc, H., Lambrechts, L., Saleh, M.C., 2018. Immune priming and clearance of orally acquired RNA viruses in Drosophila. Nat. Microbiol. 3, 1394–1403. Mueller, S., Gausson, V., Vodovar, N., Deddouche, S., Troxler, L., Perot, J., Pfeffer, S., Hoffmann, J.A., Saleh, M.C., Imler, J.L., 2010. RNAi-mediated immunity provides strong protection against the negative-strand RNA vesicular stomatitis virus in Drosophila. Proc. Natl. Acad. Sci. U. S. A. 107, 19390–19395. Mussabekova, A., Daeffler, L., Imler, J.L., 2017. Innate and intrinsic antiviral immunity in Drosophila. Cell. Mol. Life Sci. 74, 2039–2054. Nagy, P., Kovacs, L., Sandor, G.O., Juhasz, G., 2016. Stem-cell-specific endocytic degradation defects lead to intestinal dysplasia in Drosophila. Dis. Model Mech. 9, 501–512. Nawa, M., Takasaki, T., Yamada, K.I., Akatsuka, T., Kurane, I., 2001. Development of dengue IgM-capture enzyme-linked immunosorbent assay with higher sensitivity using monoclonal detection antibody. J. Virol Methods 92, 65–70. Okamura, K., Ishizuka, A., Siomi, H., Siomi, M.C., 2004. Distinct roles for Argonaute proteins in small RNA-directed RNA cleavage pathways. Genes Dev. 18, 1655–1666. Pal, P., Dowd, K.A., Brien, J.D., Edeling, M.A., Gorlatov, S., Johnson, S., Lee, I., Akahata, W., Nabel, G.J., Richter, M.K.S., Smit, J.M., Fremont, D.H., Pierson, T.C., Heise, M.T., Diamond, M.S., 2013. Development of a highly protective Combination monoclonal antibody therapy against chikungunya virus. PLoS Pathog. 9, e1003312. Palmer, W.H., Varghese, F.S., van Rij, R.P., 2018. Natural variation in resistance to virus infection in Dipteran insects. Viruses 10, 118. Pompon, J., Manuel, M., Ng, G.K., Wong, B., Shan, C., Manokaran, G., Soto-Acosta, R., Bradrick, S.S., Ooi, E.E., Missé, D., Shi, P.-Y., Garcia-Blanco, M.A., 2017. Dengue subgenomic flaviviral RNA disrupts immunity in mosquito salivary glands to increase virus transmission. PLoS Pathog. 13, e1006535. Ribeiro, J.M.C., Arcà, B., Lombardo, F., Calvo, E., Phan, V.M., Chandra, P.K., Wikel, S.K., 2007. An annotated catalogue of salivary gland transcripts in the adult female mosquito, Aedes aegypti. BMC Genom. 8, 6. Robinson, S.W., Herzyk, P., Dow, J.A.T., Leader, D.P., 2013. FlyAtlas: database of gene expression in the tissues of Drosophila melanogaster. Nucleic Acids Res. 41, D744–D750. Rose, P.P., Hanna, S.L., Spiridigliozzi, A., Wannissorn, N., Beiting, D.P., Ross, S.R., Hardy, R.W., Bambina, S.A., Heise, M.T., Cherry, S., 2011. Natural resistance-associated macrophage protein is a cellular receptor for sindbis virus in both insect and mammalian hosts. Cell Host Microbe 10, 97–104. Ruckert, C., Bell-Sakyi, L., Fazakerley, J.K., Fragkoudis, R., 2014. Antiviral responses of arthropod vectors: an update on recent advances. Virus disease 25, 249–260. Sansone, Christine L., Cohen, J., Yasunaga, A., Xu, J., Osborn, G., Subramanian, H., Gold, B., Buchon, N., Cherry, S., 2015. Microbiota-dependent priming of antiviral intestinal immunity in Drosophila. Cell Host Microbe 18, 571–581. Schmid, M.R., Anderl, I., Vesala, L., Vanha-aho, L.-M., Deng, X.-J., Rämet, M., Hultmark, D., 2014. Control of Drosophila blood cell activation via Toll signaling in the fat body. PloS One 9, e102568. Schonborn, J., Oberstrass, J., Breyel, E., Tittgen, J., Schumacher, J., Lukacs, N., 1991. Monoclonal antibodies to double-stranded RNA as probes of RNA structure in crude nucleic acid extracts. Nucleic Acids Res. 19, 2993–3000. Shelly, S., Lukinova, N., Bambina, S., Berman, A., Cherry, S., 2009. Autophagy is an essential component of Drosophila immunity against vesicular stomatitis virus. Immunity 30, 588–598. Sim, S., Ramirez, J.L., Dimopoulos, G., 2012. Dengue virus infection of the Aedes aegypti salivary gland and chemosensory apparatus induces genes that modulate infection and blood-feeding behavior. PLoS Pathog. 8, e1002631. Soldan, S.S., Plassmeyer, M.L., Matukonis, M.K., González-Scarano, F., 2005. La Crosse virus nonstructural protein NSs counteracts the effects of short interfering RNA. J. Virol. 79, 234–244. Van Rij, R.P., Saleh, M.C., Berry, B., Foo, C., Houk, A., Antoniewski, C., Andino, R., 2006. The RNA silencing endonuclease Argonaute 2 mediates specific antiviral immunity in Drosophila melanogaster. Genes Dev. 20, 2985–2995. Wang, Y.H., Chang, M.M., Wang, X.L., Zheng, A.H., Zou, Z., 2018. The immune strategies of mosquito Aedes aegypti against microbial infection. Dev. Comp. Immunol. 83, 12–21. Xu, J., Cherry, S., 2014. Viruses and antiviral immunity in Drosophila. Dev. Comp. Immunol. 42, 67–84. Xu, J., Grant, G., Sabin, L.R., Gordesky-Gold, B., Yasunaga, A., Tudor, M., Cherry, S., 2012. Transcriptional pausing controls a rapid antiviral innate immune response in Drosophila. Cell Host Microbe 12, 531–543. Xu, J., Hopkins, K., Sabin, L., Yasunaga, A., Subramanian, H., Lamborn, I., GordeskyGold, B., Cherry, S., 2013. ERK signaling couples nutrient status to antiviral defense in the insect gut. Proc. Natl. Acad. Sci. Unit. States Am. 110, 15025–15030. Yanai, I., Benjamin, H., Shmoish, M., Chalifa-Caspi, V., Shklar, M., Ophir, R., Bar-Even, A., Horn-Saban, S., Safran, M., Domany, E., Lancet, D., Shmueli, O., 2005. Genomewide midrange transcription profiles reveal expression level relationships in human tissue specification. Bioinformatics 21, 650–659. Yasunaga, A., Hanna, S.L., Li, J., Cho, H., Rose, P.P., Spiridigliozzi, A., Gold, B., Diamond, M.S., Cherry, S., 2014. Genome-wide RNAi screen identifies broadly-acting host factors that inhibit arbovirus infection. PLoS Pathog. 10, e1003914.
Avadhanula, V., Weasner, B.P., Hardy, G.G., Kumar, J.P., Hardy, R.W., 2009. A novel system for the launch of alphavirus RNA synthesis reveals a role for the Imd pathway in arthropod antiviral response. PLoS Pathog. 5, e1000582. Billes, V., Kovács, T., Manzéger, A., Lőrincz, P., Szincsák, S., Regős, Á., Kulcsár, P.I., Korcsmáros, T., Lukácsovich, T., Hoffmann, G., Erdélyi, M., Mihály, J., Takács-Vellai, K., Sass, M., Vellai, T., 2018. Developmentally regulated autophagy is required for eye formation in Drosophila. Autophagy 14, 1499–1519. Buchon, N., Osman, D., David, Fabrice P.A., Yu Fang, H., Boquete, J.P., Deplancke, B., Lemaitre, B., 2013. Morphological and molecular characterization of adult midgut compartmentalization in Drosophila. Cell Rep. 3, 1725–1738. Buchon, N., Silverman, N., Cherry, S., 2014. Immunity in Drosophila melanogaster–from microbial recognition to whole-organism physiology. Nat. Rev. Immunol. 14, 796–810. Callus, B.A., Mathey-Prevot, B., 2002. SOCS36E, a novel Drosophila SOCS protein, suppresses JAK/STAT and EGF-R signalling in the imaginal wing disc. Oncogene 21, 4812–4821. Carissimo, G., Pondeville, E., McFarlane, M., Dietrich, I., Mitri, C., Bischoff, E., Antoniewski, C., Bourgouin, C., Failloux, A.-B., Kohl, A., Vernick, K.D., 2015. Antiviral immunity of Anopheles gambiae is highly compartmentalized, with distinct roles for RNA interference and gut microbiota. Proc. Natl. Acad. Sci. Unit. States Am. 112, E176–E185. Chaverra-Rodriguez, D., Macias, V.M., Hughes, G.L., Pujhari, S., Suzuki, Y., Peterson, D.R., Kim, D., McKeand, S., Rasgon, J.L., 2018. Targeted delivery of CRISPR-Cas9 ribonucleoprotein into arthropod ovaries for heritable germline gene editing. Nat. Commun. 9, 3008. Chotkowski, H.L., Ciota, A.T., Jia, Y., Puig-Basagoiti, F., Kramer, L.D., Shi, P.Y., Glaser, R.L., 2008. West Nile virus infection of Drosophila melanogaster induces a protective RNAi response. Virology 377, 197–206. Ferreira, Á.G., Naylor, H., Esteves, S.S., Pais, I.S., Martins, N.E., Teixeira, L., 2014. The toll-dorsal pathway is required for resistance to viral oral infection in Drosophila. PLoS Pathog. 10, e1004507. Franz, A.W.E., Kantor, A.M., Passarelli, A.L., Clem, R.J., 2015. Tissue barriers to arbovirus infection in mosquitoes. Viruses 7, 3741–3767. Goic, B., Vodovar, N., Mondotte, J.A., Monot, C., Frangeul, L., Blanc, H., Gausson, V., Vera-Otarola, J., Cristofari, G., Saleh, M.-C., 2013. RNA-mediated interference and reverse transcription control the persistence of RNA viruses in the insect model Drosophila. Nat. Immunol. 14, 396–403. Grubaugh, N.D., Weger-Lucarelli, J., Murrieta, R.A., Fauver, J.R., Garcia-Luna, S.M., Prasad, A.N., Black, W.C., Ebel, G.D., 2016. Genetic drift during systemic arbovirus infection of mosquito vectors leads to decreased relative fitness during host switching. Cell Host Microbe 19, 481–492. Hopkins, K.C., McLane, L.M., Maqbool, T., Panda, D., Gordesky-Gold, B., Cherry, S., 2013. A genome-wide RNAi screen reveals that mRNA decapping restricts bunyaviral replication by limiting the pools of Dcp2-accessible targets for cap-snatching. Genes Dev. 27, 1511–1525. Kistler, Kathryn E., Vosshall, Leslie B., Matthews, Benjamin J., 2015. Genome engineering with CRISPR-Cas9 in the mosquito Aedes aegypti. Cell Rep. 11, 51–60. Labeaud, A.D., Bashir, F., King, C.H., 2011. Measuring the burden of arboviral diseases: the spectrum of morbidity and mortality from four prevalent infections. Popul. Health Metrics 9, 1. Lemaitre, B., Nicolas, E., Michaut, L., Reichhart, J.M., Hoffmann, J.A., 1996. The dorsoventral regulatory gene cassette spätzle/Toll/cactus controls the potent antifungal response in Drosophila adults. Cell 86, 973–983. Liu, Y., Gordesky-Gold, B., Leney-Greene, M., Weinbren, N.L., Tudor, M., Cherry, S., 2018. Inflammation-induced, STING-dependent autophagy restricts zika virus infection in the Drosophila brain. Cell Host Microbe 24, 57–68 e53. Luplertlop, N., Surasombatpattana, P., Patramool, S., Dumas, E., Wasinpiyamongkol, L., Saune, L., Hamel, R., Bernard, E., Sereno, D., Thomas, F., Piquemal, D., Yssel, H., Briant, L., Missé, D., 2011. Induction of a peptide with activity against a broad spectrum of pathogens in the Aedes aegypti salivary gland, following Infection with Dengue Virus. PLoS Pathog. 7, e1001252. Marianes, A., Spradling, A.C., 2013. Physiological and stem cell compartmentalization within the Drosophila midgut. eLife 2, e00886. Martins, N., Lemoine, A., Santiago, E., Paro, S., Imler, J.L., Meignin, C., 2019. A transgenic flock house virus replicon reveals an RNAi independent antiviral mechanism acting in Drosophila follicular somatic cells. G3 (Bethesda) 9, 403–412. Matthews, B.J., Dudchenko, O., Kingan, S.B., Koren, S., Antoshechkin, I., Crawford, J.E., Glassford, W.J., Herre, M., Redmond, S.N., Rose, N.H., Weedall, G.D., Wu, Y., Batra, S.S., Brito-Sierra, C.A., Buckingham, S.D., Campbell, C.L., Chan, S., Cox, E., Evans, B.R., Fansiri, T., Filipović, I., Fontaine, A., Gloria-Soria, A., Hall, R., Joardar, V.S., Jones, A.K., Kay, R.G.G., Kodali, V.K., Lee, J., Lycett, G.J., Mitchell, S.N., Muehling, J., Murphy, M.R., Omer, A.D., Partridge, F.A., Peluso, P., Aiden, A.P., Ramasamy, V., Rašić, G., Roy, S., Saavedra-Rodriguez, K., Sharan, S., Sharma, A., Smith, M.L., Turner, J., Weakley, A.M., Zhao, Z., Akbari, O.S., Black, W.C., Cao, H., Darby, A.C., Hill, C.A., Johnston, J.S., Murphy, T.D., Raikhel, A.S., Sattelle, D.B., Sharakhov, I.V., White, B.J., Zhao, L., Aiden, E.L., Mann, R.S., Lambrechts, L., Powell, J.R., Sharakhova, M.V., Tu, Z., Robertson, H.M., McBride, C.S., Hastie, A.R., Korlach, J., Neafsey, D.E., Phillippy, A.M., Vosshall, L.B., 2018. Improved reference genome of Aedes aegypti informs arbovirus vector control. Nature 563, 501–507.
6