Dual interaction of plant PCNA with geminivirus replication accessory protein (Ren) and viral replication protein (Rep)

Available online at www.sciencedirect.com R

Virology 312 (2003) 381–394

www.elsevier.com/locate/yviro

Dual interaction of plant PCNA with geminivirus replication accessory protein (REn) and viral replication protein (Rep) Araceli G. Castillo,a,1 Dominique Collinet,b,1 Sophia Deret,b Alaa Kashoggi,b and Eduardo R. Bejaranoa,* a

Department of Cellular Biology, Genetics, and Animal Physiology, Ma´laga University, Ma´laga 29071, Spain b Gentech, 55 Allee´ Charles Victor Naudin, Sophia Antipolis, Biot 06410, France

Received 14 November 2002; returned to author for revision 16 December 2002; accepted 25 February 2003

Abstract Geminiviruses replicate their small, single-stranded DNA genomes in plant nuclei using host replication machinery. Similar to most dicotyledonous plant-infecting geminiviruses, Tomato yellow leaf curl Sardinia virus (TYLCSV) encodes a protein, REn, that enhances viral DNA accumulation through an unknown mechanism. Earlier studies showed that REn protein from another geminivirus, Tomato golden mosaic virus (TGMV), forms oligomers and interacts with Rep protein, the only viral protein essential for replication. It has been shown that both proteins from TGMV also interact with a plant homolog of the mammalian tumor suppressor retinoblastoma protein (RBR). By using yeast two-hybrid technology and the TYLCSV REn protein as bait, we have isolated three clones of the proliferating cell nuclear antigen (PCNA) of Arabidopsis thaliana, a ring-shaped protein that encircles DNA and plays an essential role in eukaryotic chromosomal DNA replication. We also demonstrate by the two-hybrid system and a pull-down assay that REn interacts with tomato PCNA (LePCNA). Analysis of truncated proteins has located the REn-binding domain of LePCNA between amino acids 132 and 187, whereas all REn deletions used abolished or decreased dramatically its ability to interact with PCNA. Tomato PCNA also interacts with TYLCSV Rep. We propose that the interaction between PCNA and REn/Rep takes place during virus infection, inducing the assembly of the plant replication complex (replisome) close to the virus origin of replication. © 2003 Elsevier Science (USA). All rights reserved. Keywords: Geminivirus; Tomato; TYLCSV; PCNA; Rep; REn; DNA replication

Introduction Tomato yellow leaf curl Sardinia virus (TYLCSV) is a single-stranded DNA virus that replicates by a rolling circle mechanism in the nuclei of infected plant cells (Laufs et al., 1995a, Hanley-Bowdoin et al., 1999). TYLCSV is a geminivirus that belongs to the genus Begomovirus, which includes many crop pathogens that are transmitted by whiteflies and infect only dicotyledonous plants. TYLCSV is a monopartite begomovirus with a single circular DNA genome of 2.7 kb in size, which codes for six proteins. Two of these proteins, Rep and

* Corresponding author. Fax: ⫹34-952131955. E-mail address: [email protected] (E.R. Bejarano). 1 These authors contributed equally to this work.

REn, are required for efficient viral DNA replication. Rep is essential for replication, whereas REn enhances viral DNA accumulation by an unknown mechanism. Rep (Rep homologues are also designated AL1, AC1, or C1) specifically binds to double-stranded DNA during origin recognition (Fontes et al., 1994; Akbar Behjatnia et al., 1998; Castellano et al., 1999) and acts as an endonuclease and a ligase to initiate and terminate rolling circle replication (Laufs et al., 1995b; Heyraud-Nitschke et al., 1995; Orozco and Hanley-Bowdoin, 1996). Rep can also hydrolyze ATP (Orozco et al., 1997) and interacts with itself and with the viral replication enhancer REn (Settlage et al., 1996). In contrast, little is known about the function of REn (homologues are also designated as AL3, AC3, or C3), which enhances viral infection and symptoms (Morris et al., 1991; Hormuzdi and Bisaro, 1995;

0042-6822/03/$ – see front matter © 2003 Elsevier Science (USA). All rights reserved. doi:10.1016/S0042-6822(03)00234-4

382

A.G. Castillo et al. / Virology 312 (2003) 381–394

Fig. 1. Comparison of the amino acid sequence of PCNA from Arabidopsis thaliana (PCNA1 and PCNA2), Lycopersicon esculentum, and Nicotiana tabacum. Identical amino acids are shown in white letters on a black background.

Sung and Coutts, 1995), possibly through its capacity to increase viral DNA accumulation by as much as 50-fold (Sunter et al., 1990). Geminiviruses recruit the replication machinery from the plant host. However, geminiviruses replicate in differentiated cells which do not contain detectable levels of replicative polymerases, and hence, are not competent for DNA replication. Therefore, an early step in the geminivirus infection process is reprogramming plant cell-cycle controls to induce the synthesis of the host replication machinery (Hanley-Bowdoin et al., 1999; Gutierrez, 2000). This idea is strongly supported by two lines of evidence. First, proliferating cell nuclear antigen (PCNA) is caused to accumulate in differentiated cells of plants infected with the begomovirus Tomato golden mosaic virus (TGMV) (Nagar et al., 1995). Second, both TGMV Rep (Ach et al., 1997; Kong et al., 2000) and mastrevirus RepA proteins (Xie et al., 1996; Horvath et al., 1998; Liu et al., 1999) bind to plant homologues of the cell-cycle regulator, retinoblastoma protein (pRb). By analogy with mammalian DNA viruses (Weinberg, 1995), these interactions may bypass a pRb phosphorylation requirement for cell-cycle entry and G1 progression during geminivirus infection. In mammalian DNA viruses, accessory factors can influence replication, indirectly as host modulators that alter the cellular environment to favor viral DNA replication (Jansen-Durr, 1996) and/or directly as components of the replication apparatus (Li and Botchan, 1994; Liptak et al., 1996). The activity of the replication accessory factors frequently relies on interactions with other viral and host proteins (Frattini and Laimins, 1994). The geminivirus replication accessory factor, REn, has been shown to interact with Rep (Settlage et al., 1996) and pRb (Settlage et al., 2001). In this study, we demonstrate that TYLCSV REn and Rep interact with the essential compo-

nent of the eukaryotic replication machinery, PCNA. PCNA is a ring-like protein that tethers DNA and functions as a moving platform that modulates the interactions of other proteins with DNA. Recent studies have revealed that this sliding clamp interacts with many proteins that are involved in important cellular processes such as replication and repair of DNA, DNA methylation, cell-cycle control, and chromatin assembly (Tsurimoto, 1999; Warbrick, 2000). We propose that the interaction between PCNA and the viral proteins involved in replication takes place during virus infection, inducing the assembly of the plant replication complex (replisome) close to the virus origin of replication.

Results Isolation of Arabidopsis thaliana cDNAs encoding REn interacting proteins To identify cellular proteins that interact with TYLCSV REn protein, we have used yeast two-hybrid technology (Fields and Song, 1989) to screen a cDNA library from A. thaliana leaves using TYLCSV REn fused to the GAL4 DNA-binding domain as bait. Yeast cells, harboring the bait plasmid, were transformed with the A. thaliana cDNA library and plated on histidine selection media. Among transformants that appeared 5 to 10 days after transformation, we selected those for which the three yeast reporter genes were activated. DNA sequence analysis and databases searches identified three different partial cDNA clones coding for PCNA. The A. thaliana genome contains two highly homologous PCNA genes located on chromosomes 1 and 2 (Fig. 1). Sequence comparison showed that all isolated cDNAs were partial C-terminus clones. Two of these clones

A.G. Castillo et al. / Virology 312 (2003) 381–394

correspond to the PCNA gene located on chromosome 1, and the third clone corresponds to the PCNA gene located on chromosome 2. The largest isolated cDNA clone contains 149 amino acids of the PCNA C-terminus. Cloning partial and complete tobacco and tomato PCNA cDNAs As TYLCSV does not infect A. thaliana, we decided to determine whether PCNA from plant species infected by this virus also interacted with REn. To achieve this, we cloned partial and/or complete PCNA cDNAs from tobacco and tomato and tested their interaction by a two-hybrid assay. For tobacco, specific primers were designed from the PCNA nucleotide sequence in the databases (AC: AB025029). RT-PCR using these primers on total RNA extracted from Nicotiana tabacum allowed us to clone, into the two-hybrid vector pACT2, complete and partial cDNAs corresponding to amino acids 36 to 255 of tobacco PCNA (NtPCNA). For tomato, degenerate primers were designed from the conserved regions of plant PCNAs. The amino acid sequences of PCNA from A. thaliana (AC: AAC95182), Daucus carota (AC: Q00265), Glycine max (AC: P22177), N. tabacum (AC: BAA76349), Oryza sativa (AC: X54046), and Zea mays (AC: X79065) were used. Two regions with a high percentage of identity were selected: SLQAMD (amino acids 36 to 41) and YLAPKI (amino acids 250 to 255). Two degenerate primers were designed: PCNA1 and PCNA4, respectively. RT-PCR using these primers on total RNA extracted from proliferating plant tissues of Lycopersicon esculentum allowed us to amplify and clone a partial tomato PCNA gene (LePCNA), corresponding to amino acids 36 to 255 (LePCNA36-255). The complete tomato PCNA sequence was then cloned from a tomato cDNA library by hybridization with the partial LePCNA cDNA as a probe. Sequence analysis identified two cDNA clones containing the complete open reading frame (ORF) of LePCNA, differing in the size of the 5⬘ untranslated region. Two partial clones corresponding to amino acids 55 to 255 (LePCNA55-255) and 132 to 255 (LePCNA132-255) were also isolated. The complete amino acid sequence of the LePCNA ORF is shown in Fig. 1. Specific primers were designed and PCR was performed to clone the complete and partial ORFs (LePCNA55-255 and LePCNA132-255) from LePCNA in pACT2. ⌬pcn1 from fission yeast is complemented by tobacco and tomato PCNA (NtPCNA and LePCNA) The isolation of a gene with sequence homology to another well-characterized gene does not necessarily demonstrate that these genes are functional homologues. To investigate whether NtPCNA and LePCNA are really functionally equivalent to PCNA, we determined the ability of both plant PCNAs to complement a Schizosaccharomyces pombe PCNA mutant containing a disrupted gene (⌬pcn1: the pcn1 gene has been disrupted by introducing the ura4

383

gene). Because the deletion of PCNA is lethal, we used a diploid strain heterozygous for ⌬pcn1 (Waseem et al., 1992). The S. pombe diploid strain was transformed with either NtPCNA or LePCNA cloned into the plasmid pREP3x. This vector contains the nmt1⫹ promoter (Maundrell, 1993), which is repressed by thiamine and activated in its absence with a maximum induction after 16 h at 30°C. Cells were sporulated and the spores spread on media lacking uracil, so that only ⌬pcn1 spores could germinate. The experiment was performed with the plasmid promoter either induced or repressed. Both plant PCNAs were able to complement the mutant, but only with the promoter induced (data not shown). We were also able to isolate haploid cells containing the functional allele of pcn1 that also overproduce plant PCNA. To characterize cellular size, nuclear morphology, and DNA content of the complemented cells, we monitored exponentially dividing liquid cultures of ⌬pcn1 and pcn1 cells containing either LePCNA or NtPCNA. No significant differences in growth rate were detected between wild-type cells and ⌬pcn1 cultures. DAPI-stained ⌬pcn1 and pcn1 cells containing either LePCNA or NtPCNA were wild-type in appearance, although a small increase in cell size was observed in complemented ⌬pcn1 cells compared to wild-type cells (Fig. 2C). Flow cytometry analysis confirmed this microscopic observation as the majority of exponentially growing cells had a 2C DNA content and an increase in the average cellular size (Figs. 2A and B). The fraction of cells with 1C DNA content was higher in yeast that was coexpressing both yeast and plant PCNA (pcn1⫹LePCNA or pcn1⫹NtPCNA). This increase was not observed in complemented ⌬pcn1 cells, suggesting that this effect required the presence of both PCNAs in the same cell. The size of these cells was similar to the wild-type, although they were more heterogeneous. Interaction between plant PCNAs and TYLCSV REn Using the two-hybrid system, we showed that REn was able to interact with two LePCNA partial clones (LePCNA55-255 and LePCNA132-255) isolated from the tomato cDNA library and cloned into pACT2. There was also activation of the yeast reporter genes when full-length tomato PCNA (AD-LePCNA) was coexpressed with REn (BD-REn). These cells did not grow as well as cells coexpressing the REn protein and either of the truncated forms of LePCNA in media without histidine and/or adenine (Fig. 3A), and the ␤-galactosidase activity was considerably lower (data not shown). To investigate if the difference in the interaction of REn with the complete and truncated forms of LePCNA was due to differences in the expression levels of the prey proteins, we performed a Western blot. Total protein extracts from cotransformants grown in nonselective conditions were resolved by SDS–PAGE and the immunoblots were probed with a monoclonal antibody against AD-Gal4 (Fig. 3B). Protein accumulation was much

384

A.G. Castillo et al. / Virology 312 (2003) 381–394

Fig. 2. Tomato and tobacco PCNA complementation of a S. pombe pcn1 mutant. Flow cytometry analyses of wild-type (pcn1) and ⌬pcn1 haploid yeast strains expressing NtPCNA or LePCNA. DNA content per cell (A) and cell size (B) were measured. The positions of 1C and 2C controls are indicated with arrows. (C) Examples of untransformed wild-type (pcn1), ⌬pcn1 complemented with tobacco PCNA (⌬pcn1 NtPCNA), or tomato PCNA (⌬pcn1 LePCNA) and wild-type cells expressing either tobacco (pcn1 NtPCNA) or tomato PCNA (pcn1 LePCNA), stained with the DNA binding dye DAPI. Yeast cells have been incubated at 30°C for 16 h in media lacking thiamine.

higher for truncated LePCNA than for the complete protein, although they are expressed from the same strong promoter present in pACT2. Thus, the faint growth displayed by cells expressing the complete LePCNA and REn could be due to the low levels of LePCNA in the yeast cells. Similar results were obtained with complete and partial clones of tobacco PCNA (data not shown). LePCNA binds to REn in vitro As tomato is the most important host of TYLCSV, we decided to focus our work in LePCNA rather than NtPCNA.

To test if LePCNA also interacts with REn in vitro, we performed a pull-down assay using a metal affinity resin. The proteins were coexpressed from plasmids carrying the nmt1 inducible promoter in S. pombe, as tagged proteins HIS-LePCNA and REn-HA. Both proteins were expressed in S. pombe and were soluble (Fig. 4A, input). The protein extract was incubated with the metal affinity resin, and after extensive washing, the HIS-tagged protein was eluted with EB buffer containing 100 mM imidazole. By Western blot analysis, both HIS-LePCNA and REn-HA were detected in the eluted fraction (Fig. 4A, bound), indicating that these proteins interact in vitro. Also, REn and the truncated LeP-

A.G. Castillo et al. / Virology 312 (2003) 381–394

Fig. 3. Interaction between REn and complete (LePCNA) and truncated (LePCNA55-255; LePCNA132-255) forms of tomato PCNA. (A) Growth of yeast cells cotransformed with BD-REn and one of the AD-LePCNA fusion proteins (partial or complete LePCNA clones) in media lacking histidine and containing 2 mM 3-AT. Cells were incubated at 30°C for 8 days. (B) Immunoblot analysis of protein extracts from yeast cells coexpressing BD-REn and either AD-LePCNA, AD-LePCNA55-255, or ADLePCNA132-255, using anti-ADGal4 monoclonal antibody. The expected positions of LePCNA, LePCNA55-255, and LePCNA132-255 fusion proteins with ADGal4 are marked on the right.

385

teraction with TYLCSV REn, we constructed a set of deletions based on the assigned secondary structure for LePCNA. Truncated LePCNAs were fused to AD of the Gal4 protein and their ability to bind REn was assayed by the two-hybrid system. The deleted constructs were cotransformed into yeast with plasmid pGBREn, and ␤-galactosidase activity was measured (Fig. 5A). None of the truncated LePCNA derivatives seemed to have a toxic effect on cell growth. Results showed that a truncated LePCNA fragment encompassing amino acids 132 to 187 (LePCNA132-187) is able to activate the ␤-galactosidase reporter gene at least with the same efficiency as the larger LePCNA used in this assay (LePCNA55-255). This minimal interacting region of LePCNA corresponds on the 3D model (Fig. 5C) to a conserved structural ␤␣␤␤␤ motif found in all sliding clamp proteins. The interaction is lost when a few additional amino acids from this region are removed from the Nterminus (LePCNA140-187) or C-terminus (LePCNA132-174). Similar results were obtained when the interaction was tested using the other two marker genes present in the yeast (HIS3 and ADE2). Although we observed some differences in the levels of protein accumulation among the truncated LePCNA derivatives, these differences do not correlate with their relative ␤-galactosidase activity (Fig. 5B). LePCNA also binds the replication-associated protein Rep

CNA132-255 interact in vitro (Fig. 4B). Three control experiments were performed to verify that the HIS-LePCNA (full-length and truncated) and REn-HA interactions were specific. First, REn-HA protein alone was apparent in the input fraction but not in the bound fraction (Fig. 4C), indicating that it does not interact directly with the resin. Second, when extracts from S. pombe cells containing plasmids with REn-HA and HIS-Gip1 (a fission yeast mannose-1 phosphate guanyltransferase) expression cassettes that coexpressed both proteins, only HIS-Gip1 was found in the bound fraction (Fig. 4D). Third, in similar experiments using extracts from cells coexpressing HIS-LePCNA and CP-HA (TYLCSV coat protein), HIS-LePCNA was found in the bound fraction (Fig. 4E1), while CP-HA was not (Fig. 4E2). Together these results demonstrate that HIS-LePCNA and HIS-LePCNA132-255 interact with REn-HA in vitro and that this interaction is specific. Identification of LePCNA domains involved in complex formation Using the ProMod method from Swiss Model and the homology with yeast (PDB codes 1PLQ and 1PLR; Krishna et al., 1994) and human (1AXC; Gulbis et al., 1996) structures as support, we have constructed 3D models for PCNA from A. thaliana, L. esculentum, and N. tabacum. Percentage of identities between A. thaliana, L. esculentum, and N. tabacum PCNA and templates varied from 40 to 68%. To identify the region of LePCNA required for the in-

TGMV REn has been shown to interact with its replication-associated protein Rep (Settlage et al., 1996). As both proteins are involved in viral replication, we asked whether TYLCSV Rep was also able to bind to LePCNA using the same in vitro binding assay that was used to confirm the interaction between REn and LePCNA. Proteins were coexpressed from plasmids carrying the nmt1-inducible promoter in S. pombe as tagged proteins (HIS-LePCNA and Rep-HA). Although both were expressed as soluble proteins in S. pombe, we noticed that Rep-HA binds by itself to the metal affinity resin. Consequently, we decided to test the interaction by coimmunoprecipitation. Protein extracts from yeast cells coexpressing HIS-LePCNA and Rep-HA (Fig. 6, lane 1) were incubated overnight with monoclonal anti-HA antibody and incubated with the protein A-Sepharose. After extensive washing, we detected Rep-HA and HIS-LePCNA by Western blot analysis (Fig. 6, lane 2). Two negative controls were performed to confirm the specificity of the interaction. First, Rep-HA was unable to coimmunoprecipitate HIS-CP (Fig. 6, lane 4) and, second, HIS-LePCNA alone was not immunoprecipitated (Fig. 6, lane 6), indicating the requirement for Rep-HA.

Discussion The small genomes of geminiviruses do not have sufficient capacity to encode their own DNA polymerases and accessory factors required for DNA replication. Instead,

386

A.G. Castillo et al. / Virology 312 (2003) 381–394

Fig. 4. REn binding to the complete and truncated tomato PCNA. Total protein extracts from S. pombe cells coexpressing HIS-tagged and HA-tagged proteins were incubated with the metal affinity resin, washed, and eluted. The coexpressed proteins were (A) HIS-LePCNA/REn-HA, (B) HIS-LePCNA132-255/REnHA, (C) REn-HA, (D) HIS-Gip1/REn-HA, and (E) HIS-LePCNA/CP-HA. Total yeast cell extracts (input) and the fraction that bound to resin (bound) were resolved by 12% SDS–PAGE and analyzed by immunoblotting with anti-HIS monoclonal antibody (A, B, D, and E1) and anti-HA monoclonal antibody. (A, B, C, D, and E2).

they must recruit the replication machinery from their host. However the participation in geminivirus replication of host factors such as DNA-primase, or ␣-like and ␦-like DNA polymerase, has not yet been demonstrated. Only two geminivirus proteins, Rep and REn, are required for high levels of viral DNA accumulation. Rep plays a key role in geminivirus DNA replication, but it is not a DNA polymerase. REn is a highly hydrophobic small protein of only 134

amino acids, which is very well conserved among all begomoviruses. Notwithstanding its small size, it has already been reported that TGMV REn interacts with itself and Rep (Settlage et al., 1996) as well as cellular proteins (plant retinoblastoma protein; Settlage et al., 2001). In this work, we have shown that REn from the begomovirus TYLCSV interacts with PCNA, one of the main components of eukaryotic chromosomal DNA metabolism. Although we iso-

A.G. Castillo et al. / Virology 312 (2003) 381–394

387

388

A.G. Castillo et al. / Virology 312 (2003) 381–394

Fig. 6. Interaction between Rep and LePCNA. Total protein extracts from S. pombe cells coexpressing HIS-LePCNA and C1-HA tagged proteins (Lanes 1 and 2), HIS-CP and C1-HA (Lanes 3 and 4), or only HIS-LePCNA (Lanes 5 and 6) were incubated first with anti-HA monoclonal antibody and afterward with the protein A-Sepharose. After extensive washing, the samples were eluted and total (Input) and coimmunoprecipitated (CoIP) fractions were resolved by SDS–PAGE and analyzed by immunoblotting with anti-HIS monoclonal antibody (A) and anti-HA monoclonal antibody (B). The large subunit of mouse immunoglobulin G detected in all CoIP samples is marked by an asterisk.

lated this protein during the screening of a two-hybrid cDNA library of A. thaliana (a plant that is not a host for TYLCSV), we have demonstrated that this interaction also takes place with PCNAs from plant species (L. esculentum and N. tabacum) that are infected by this begomovirus. PCNA is an essential, ubiquitous, and highly conserved protein in eukaryotes that functions as a DNA sliding clamp. Human PCNA (Waseem et al., 1992) and plant PCNAs from tobacco and tomato can complement the fission yeast PCNA (pcn1) mutant, demonstrating that these genes are functional homologues and suggesting close similarities between replication machineries of all eukaryotic organisms. Curiously, we have noticed that the overproduction of plant PCNAs in wild-type yeast increases the population of cells with a 1C DNA content. This result could suggest that the presence of yeast and plant PCNAs in the same cell produce a delay, or an arrest, in G1 phase that is not produced when only the plant PCNA is expressed. PCNA is a homotrimer that encircles dsDNA. This ring is formed by three PCNA monomers joined head-to-tail. It is possible that in wildtype yeast expressing plant PCNA, heterotrimers containing

plant and yeast monomers could be formed. These heterotrimers may be less efficient than the homotrimers, producing a delay in G1 phase. This deleterious effect is not the same as that observed in fission yeast when its own PCNA (pcn1) is overproduced, where extrachromosomal expression of pcn1 caused an increase in cell size (Waseem et al., 1992) and a cell-cycle delay in G2. REn–LePCNA interaction was demonstrated by twohybrid assays, using complete and partial clones of LePCNA. During those experiments, we noticed that Saccharomyces cerevisae expressing complete LePCNA grew slower than untransformed cells, suggesting that, as in fission yeast, the overproduction of complete plant and yeast PCNA could also be deleterious for budding yeast. This deleterious effect is lost when amino acids from either the N-terminal or the C-terminal region of LePCNA are removed. As LePCNA derivatives used in the two-hybrid assay were expressed as proteins fused to AD Gal4, we do not know if the native LePCNA can oligomerize to a trimeric structure. If it can, deletion of the N-terminal and C-terminal regions of the protein could prevent oligomer-

Fig. 5. Two-hybrid interactions between truncated forms of LePCNA and REn. (A) A diagram of LePCNA showing the position of the regions homologous to human PCNA where most of the interactions with other proteins are located: center loop (hatched box), interdomain connection loop (gray box), C-terminal tail (black box). Position of the N- and C-terminal amino acids of the REn-binding domain described in this work are indicated. Boxes below the diagram indicate the sizes of truncated LePCNA proteins and are designated by their N- and C-terminal amino acids. Interactions were assayed by measuring ␤-galactosidase activity in total protein extracts. Interactions are expressed as a percentage of the interaction between REn protein and LePCNA132-193. Negative control corresponds to yeast coexpressing DB-Gal4 (from pGBT9) and AD-LePCNA55-255. The bars correspond to an average of three independent experiments, each of which was assayed for four independent transformants. The error bars correspond to two standard errors. (B) Immunoblot analysis of protein extracts from yeast cells coexpressing BD-REn and truncated AD-LePCNA using anti-ADGal4 monoclonal antibody. (C) 3D model of the L. esculentum PCNA monomer. The minimal interacting domain of L. esculentum PCNA (amino acids 132 to 187) is indicated in blue. The DNA face and Cand N-termini of the LePCNA monomer are indicated.

A.G. Castillo et al. / Virology 312 (2003) 381–394

ization and therefore abolish its deleterious effect. It also is possible that overexpression of LePCNA could function as a dominant-negative mutant, interfering in the interaction between yeast PCNA and its cellular protein partners. Two of the three identified PCNA regions (the center loop and the C-terminal tail, see below) involved in such interactions have been removed in all LePCNA truncations. Therefore, these LePCNA truncations should not be able to interact with the cellular partners and will not interfere in the essential cell processes in which PCNA is involved. PCNA-binding proteins can be divided into two groups: enzymatic proteins that participate in DNA metabolism (replication, DNA methylation, DNA repair, chromatin assembly) and regulatory proteins that are involved in cellcycle progression, check point control, and cellular differentiation. Over the past several years, extensive efforts have been made to map these interactions using yeast and human PCNA mutants. Most of the interactions occur in three loop structures protruding from the face of the monomer containing the C-terminus (C-side) that are well conserved in all eukaryotic PCNAs (Tsurimoto, 1999). In tomato PCNA these structures correspond to residues Asp41 to His44 (central loop), Leu118 to Glu124 (long loop), and Lys254 to Glu256 (C-terminal tail) of LePCNA (Fig. 5A). Using a truncated LePCNA, we have mapped the REn-binding domain of LePCNA to a region between Lys132 and Thr187, where no other interactions have previously been described. This region is located at the end of the PCNA monomer with amino acids located at both faces of the PCNA ring (Fig. 5C). Little is known about the function of REn. Its nuclear localization (Pedersen et al., 1994; Nagar et al., 1995) and its capacity to interact with Rep (Settlage et al., 1996) suggest that it might interact with this protein during the initiation of viral DNA replication. The mechanism by which REn enhances viral DNA accumulation may reside in its ability to interact with Rep. The REn protein sequence shows no homology to any known enzymatic motifs. Thus, it is more likely that the structure of the REn/Rep complex is important for replication rather than a catalytic activity of REn that could affect Rep. Several explanations for the effect of REn on virus replication have been proposed (Hanley-Bowdoin et al., 1999). There were some experimental observations to suggest that REn might increase the affinity of Rep for the origin. Another possibility is that REn directs Rep from the Rep/DNA-binding domain to its cleavage site in the origin during the initiation of replication. In the present work we have demonstrated that REn and Rep interact with LePCNA. By encircling DNA and interacting with polymerases, PCNA forms a sliding clamp that keeps the polymerases associated with the DNA template during processive DNA synthesis. By interacting with PCNA and Rep, REn could help Rep to recruit the replication machinery necessary to replicate the viral DNA. In the absence of REn, Rep can still bind PCNA, although the efficiency of DNA replication decreases. Placing the DNA replication

389

machinery in the viral origin of replication could also involve interactions of Rep and/or REn with cellular proteins other than PCNA. In fact, it has recently been demonstrated that Rep from the geminivirus wheat dwarf virus interacts with RFC-1, the large subunit of PCNA clamp loader (Luque et al., 2002). It is also possible that REn or Rep binding to PCNA prevents the interaction of PCNA with cell-cycle regulators, such as p21, cyclin D, and p57 that inhibit chromosomal replication by interfering with PCNA function during cell-cycle progression (Kelman and Hurwitz, 1998). Future experiments to determine the biological consequences of Rep/REn-PCNA interactions will address this hypothesis.

Materials and methods Microorganisms, general methods Manipulations of nucleic acids, proteins, bacteria, and S. cerevisae were made by standard methods (Ausubel et al., 1998; Sambrook and Russell, 2001). Escherichia coli strain DH5-␣ and JA226 were used for subcloning. S. cerevisae strain PJ696 (MATa, trp1-901, leu2-3112, ura3-52, his3200, gal4⌬, gal80⌬, GAL2-ADE2, LYS2::GAL1-HIS3, MET2::GAL7-lacZ), a derivative of PJ69-4A (James et al., 1996), was used for the two-hybrid experiments. The standard media and genetic procedures with S. pombe used in this work have been previously described (Moreno et al., 1991). For tagged protein expression, haploid wild-type S. pombe strain h⫺ leu1.32 ura4.d18 was used. Diploid h⫺ pcn1 leu1.32 ura4.d18 ade6. M210/h⫹ pcna1⌬::ura4 ura4.d18 ade6.M216 strain, previously described by Waseem et al., (1992), was used for genetic complementation experiments. Fission yeast transformation was achieved using electroporation. All amplified fragments cloned in this work were fully sequenced to confirm the absence of mutations. Amplification and cloning of tobacco and tomato PCNA cDNAs Tobacco and tomato PCNA cDNAs were amplified from total RNA isolated from N. tabacum and L. esculentum leaves following the single-step RNA isolation method (Chomczynski and Sacchi, 1987), using TriPure Isolation Reagent (Roche Molecular Biochemicals). Single-stranded cDNA synthesis was performed using the First-Strand cDNA Synthesis Kit for RT-PCR (AMV) (Roche Molecular Biochemicals). Complete tomato PCNA cDNA was isolated by amplification from a recombinant ␭gt10 tomato cDNA library (Botella et al., 1994). Amplification of partial tobacco PCNA was performed with primers PCNATOB3 and PCNATOB4; complete tobacco PCNA cDNA was performed with primers PCNATOB1 and PCNATOB2. Partial tomato PCNA cDNA was performed with degenerate prim-

390

A.G. Castillo et al. / Virology 312 (2003) 381–394

Table 1 Primers used in this work Primer

Oligonucleotide sequence

FC3ES1 FC3ES43 FC3ES96 GAL4AD1 GAL4AD2 O5PCNATOM O3PCNATOM O-C3-Xhol O-C3-Notl O5CPXhol O3CPNotl PCNA1 PCNA4 PCNATOB1 PCNATOB2 PCNATOB3 PCNATOB4 PCNATOM12 PCNATOM13 PCNATOM55 PCNATOM83 PCNATOM132 PCNATOM140 PCNATOM155 PCNATOM162 PCNATOM174 PCNATOM187 PCNATOM187B PCNATOM193 PCNATOM255 RC3ES43 RC3ES96 RC3ES134

ACATTTACCCGGGACAAACCATGG CCATTCAACCCGGGATACAATTTAC TAAGTACCCGGGTAATATAGGTG TACCACTACAATGGATGATGTA GAGATGGTGCACGATGCACAG CGGGGGATCCTATGTTGGAACTACGTCTTGTTCAG ATACGATTTACCCGGGCTCCCTCAAGGCTTGGTTTC GGGTAGATCTCGAGTGTGGCTG ATGATGCTGTGCGGCCGCAATAAAGATTGTATTTTATTTCATGTTGTTC TCATTCGTGCTCGAGACTATGCCGAAGCG TACAAGCGGCCGCAATTTGTTACAGCATC TCAGGATCCGATCBYTSCARGCYATGGA ACTGGCTCGAGATYTTDGGVGCCARRTA CATGGATCCGAATGTTGGAATTACGGCTTGTTCAGGG GCTCTCGAGCTCAAAAGAACGCAGAAACATAAAATTA TCAGGATCCGATCTCTGCAGGCCATGGA ACTGGCTCGAGAATCTTAGGCGCCAGGTA CTAGGATCCATATGTTGGAACTACGTCTTGTT AGCCTCGAGTCAAGGCTTGGTTTCCTCTTCATC CTCGGATCCGAGGGTTTTGAGCAC CATGGATCCGAGGAAATGATGACATCATCACCATC CATGGATCCCAGAGTACCATGCTATTGTTA TGGCCATGGAGGCCCCGGGGATCCGAATTCGACCTTCTGCTGAGTTTGGTAG CATGGATCCGAGGAGATACAGTTGTTATTTCGGTG GGACTCGAGTCACACCGAAATAACAACTGTATC CTGGCTCGAGGTCACCTCTGGTTGAGAATTTC CTGGCTCGAGAGTTGTATTTTGCCTGCAAAC CAGTATCTACGATTCATAGATCTCTCGAGCTCAAGTTGTATTTTGCCTGCAAAC CTGGCTCGAGTTCTTCAGGCTTGTCAACAG CTGGCTCGAGATTTTAGGGGCCAG CGTATGGATCCTTATGATGCTG ACACGGATCCTATTCAAATAC TGTTAGGATCCTGTATTTGCTG

ers PCNA1 and PCNA4, and complete tomato PCNA cDNA was performed with PCNATOM12 and PCNATOM13. Primers are described in Table 1. Amplified fragments were digested with BamHI and XhoI and ligated with similarly restricted pACT2 to yield pCNAT2 (complete tomato PCNA cDNA), pCNATOB, and pCNATOB34 (complete and partial N. tabacum PCNA cDNA). Functional analysis of plant PCNAs in S. pombe pcn1 mutant Complete N. tabacum PCNA cDNA was PCR-amplified from pCNATOB with primers PCNATOB1 and PCNATOB2, digested with BamHI and SmaI, and cloned into the BamHI-SmaI sites of pREP3x (Maundrell, 1993) to yield pREP3xNtPCNA. Complete tomato PCNA cDNA was PCR-amplified from pCNAT2 using primers O5PCNATOM and O3PCNATOM. The fragment was digested with BamHI and SmaI and cloned into the BamHI-SmaI sites of pREP3x to yield pREP3xLePCNA. Flow cytometry analysis was performed as described by Munoz and Jimenez (1999).

Yeast two-hybrid assay The two-hybrid plasmid pGBT9 was used to express the bait protein for the screenings. The REn coding region of TYLCSV-ES was amplified from pTYA50 (EcoRI clone of full-length TYLCSV-ES[2] (AC: L27708) cloned into pBluescript IIKS⫹) by PCR using the forward and reverse primers. The amplified fragment was digested with EcoRI and PstI and cloned into the EcoRI-PstI sites of pGBT9 to yield pGBC3. An A. thaliana cDNA library was constructed in ␭ACT using mRNA from 3-day-old etiolated A. thaliana seedlings (Kim et al., 1997). The conversion of the ␭ACT cDNA library into a plasmid yeast two-hybrid system library (pACT) was done according to Elledge et al. (1991). For the yeast two-hybrid screening, cells were first transformed with pGBC3 as described (Gietz and Schiestl, 1995). Then, they were transformed with the pACT (ADGal4; LEU2) A. thaliana cDNA library. For medium stringency selection, the transformation mixture was plated on yeast selection media SD/-Leu-Trp-His supplemented with 2 mM 3-amino-1,2,4-triazole (3-AT) to reduce the appearance of false positive colonies, according to the Yeast Pro-

A.G. Castillo et al. / Virology 312 (2003) 381–394

tocols Handbook 2001 (Clontech Laboratories Inc.; www. clontech.com). Transformants were routinely recovered during a period of 5 to 10 days and checked for growth on alternative higher stringency selection medium (SD/-LeuTrp-Ade). To corroborate the interaction between the two fusion proteins, ␤-galactosidase activity was assayed as described by Fromont-Racine et al. (1997). Library plasmid DNA was recovered from positive colonies by transforming into E. coli JA226, as this strain is leuB and its defect can be complemented by the LEU2 gene present in the pACT plasmid. Quantitative ␤-galactosidase assays from liquid cultures were performed according to the Yeast Protocols Handbook 2001 (Clontech Laboratories Inc.) with some variations. Transformant yeasts were grown to an OD600 of 0.5-0.8 in 5 ml of media SD/-Leu-Trp. Yeast cells were pelleted at 12,000 g for 1 min, rinsed with Z buffer (0.1 M NaPO4 pH 7, 10 mM KCl, 1 mM MgSO4), and resuspended in 300 ␮l of Z buffer. The cells were subjected to three freeze/thaw cycles in liquid nitrogen. Aliquots (100 ␮l) were then assayed for ␤-galactosidase activity by adding 700 ␮l of Z buffer containing 40 ␤-mercaptoethanol and 160 ␮l of substrate o-nitrophenyl-␤-D-galactopyranoside (4 mg/ml). When yellow color developed, 400 ␮l of 1 M Na2CO3 was added and the mixture was centrifuged at 12,000 g for 10 min. Accumulation of the o-nitrophenol product was measured at 420 nm using a Microplate Reader 2001 (Whittaker Bioproducts). Protein concentration was measured by the Bradford assay (Bio-Rad). The enzyme-specific activity was calculated as described (Guarente, 1983). The relative activities were normalized against the maximum value obtained, which was set to 100%. The different constructs were tested in a minimum of three experiments, each of which assayed four independent transformants for each construct. For immunoblot analysis, individual yeast transformants were grown in 50 ml of SD/-Leu-Trp to an OD600 of 0.7-1. Protein extraction was done according to the Clontech Yeast Protocols Handbook 1997. Total protein (50 ␮g) was resolved on 12% polyacrylamide–SDS gels and analyzed by immunoblotting using a GAL4AD monoclonal antibody at 0.4 ␮g/␮l (Clontech). Molecular modeling of tomato PCNA The BLAST server from the National Center for Biotechnology Information was used to search for similarities between tomato PCNA protein and sequences deposited in the Brookhaven Protein Databank (PDB) (Bernstein et al., 1977). Based on the 3D structures of homologues genes, tomato PCNA protein was modeled using the ProMod method from Swiss Model, an automated protein modeling Server (Peitsch, 1995). An average framework (Blundell et al., 1987) was built from templates available in the PDB; the backbone to be studied was fitted onto this framework using a primary sequence alignment optimized for 3D similarity,

391

and loop regions were built by structural homology searches in the PDB. Missing side chains were built using a library of allowed rotamers (Ponder and Richards, 1987), and bond geometries and relief of unfavorable nonbonded contacts were optimized by energy minimization using the CHARMM program (Brooks et al., 1983) to relax major steric strains. The resulting model was analyzed using the 3D profile matching procedure described by Luthy et al. (1992). The PROCHECK software (Laskowski, 1993) was then used to validate the model by testing all basic geometrical parameters. PCNA deletion constructs For LePCNA deletions, the P-SEA program (Labesse et al., 1997) was used to predict secondary structures from the 3D model constructed for tomato PCNA. The assigned secondary structures were then used to propose deletion sites in tomato PCNA. Deletions of PCNA were constructed using PCR with specific primers (see Table 1). Forward primers PCNATOM55, PCNATOM83, PCNATOM132, PCNATOM140, and PCNATOM155 were designed to amplify a region of tomato PCNA starting at amino acids 55, 83, 132, 140, and 155, respectively. Reverse primers PCNATOM162, PCNATOM174, PCNATOM187, PCNATOM187B, PCNATOM193, and PCNATOM255 were designed to amplify a region of tomato PCNA ending at amino acids 162, 174, 187, 187, 193, and 255, respectively. Fragments amplified with these primers were digested with BamHI and XhoI and cloned into BamHI-XhoI sites of pACT2 to yield pCNATOM-17, pCNATOM-57, pCNATOM-87, pCNATOM-67, pCNATOM-59, pCNATOM-89, pCNATOM-8187, and pCNATOM-8193 (Table 2). Fragments amplified with PCNATOM140 and PCNATOM187B primers were cloned into pACT2 to yield pCNATOM-FR using homologous recombination in yeast (Petermann et al., 1998). In vitro assays Plasmids used for the expression of tagged protein in S. pombe have been described by Craven et al. (1998). The expression of the fused proteins are driven by the nmt1inducible promoter (Maundrell, 1993). A BamHI-SmaI fragment from pREP3xLePCNA containing the complete ORF of tomato PCNA was cloned into BamHI-SmaI sites of pREP42HMN, to generate p42HMLePCNA. A partial PCNA ORF (amino acids 132 to 255) was cloned in pREP42HMN using GAL4AD1 and GAL4AD2 primers. The fragment was cut with NdeI and cloned into NdeI and SmaI sites of pREP42HMN to generate p42HM-LePCNA132-255. The p42HM-Gip1 plasmid (I. Donoso, M. Mun˜ oz-Centeno, and E.R. Bejarano, unpublished results) contains an in-frame fusion of his6-myc2-Gip1 coding sequences (a fission yeast mannose-1 phosphate guanyltransferase gene, AC:SPCRep906.01). Plasmid p42HM-CP (S. Ohnesorge and E.R. Bejarano, in preparation) contains a

392

A.G. Castillo et al. / Virology 312 (2003) 381–394

Table 2 Constructs used to map the interaction between LePCNA and REn Forward primer

Reverse primer

Producta

PCNATOM55 PCNATOM83 PCNATOM83 PCNATOM132 PCNATOM132 PCNATOM132 PCNATOM132 PCNATOM140 PCNATOM155

PCNATOM255 PCNATOM255 PCNATOM162 PCNATOM255 PCNATOM174 PCNATOM187 PCNATOM193 PCNATOM187B PCNATOM255

AD-LePCNA55–255 (pCNATOM-17) AD-LePCNA83–255 (pCNATOM-57) AD-LePCNA83–162 (pCNATOM-59) AD-LePCNA132–255 (pCNATOM-87) AD-LePCNA132–174 (pCNATOM-89) AD-LePCNA132–187 (pCNATOM-187) AD-LePCNA132–193 (pCNATOM-193) AD-LePCNA140–187 (pCNATOM-FR) AD-LePCNA155–255 (pCNATOM67)

a

Fragments amplified with forward and reverse primers. All fragments were cloned in pACT2 (pCNATOM plasmids). The name of the resulting plasmid is shown in parentheses.

fusion of his6-myc2 to the CP coding sequence from TYLCSV-ES. For TYLCSV-ES REn, a 473-bp PCR product (TYLCSV-ES DNA positions 1063-1536) obtained with the specific primers O-C3-XhoI and O-C3-NotI was digested with XhoI and NotI and cloned in similarly restricted pRIP4x-swo1HA (kindly provided by Dr. M. Mun˜ oz, Universidad Pablo de Olavide, Sevilla, Spain) to generate pRIPC3HA that contains an in-frame fusion of REn and two copies of the hemagglutinin epitope (HA2) at the C-terminus. A PstI-SacI fragment obtained from pRIPC3HA was subcloned into PstI-SacI sites of pREP3x to generate pREP3xC3HA. For expression of fusion proteins CP-HA and Rep-HA, two plasmids were generated: pREP3xCPHA and pREP81xC1HA. pREP3xCPHA was constructed by replacing the REn-coding sequence with that of the TYLCSV-ES CP in pREP3xC3HA. After digestion of pREP3xC3HA with XhoI and NotI, the fragment containing the vector sequence was purified and ligated to a 775-bp PCR fragment encompassing the complete CP ORF (TYLCSV-ES DNA positions 309-1082) obtained with the specific primers O5CPXhoI and O3CPNotI also digested with XhoI and NotI. pREP81xC1HA was obtained by cloning the SmaI-XhoI fragment from pREP3xC1HA into pREP81x digested with the same enzymes. pREP3xC1HA was constructed by replacing REn with the Rep ORF from TYLCSV-ES in pREP3xC3HA. The Rep XhoI-NotI fragment was obtained from pBSRepXN (Rep ORF in the EcoRV site of pBSSK⫹) and cloned into pREP3xC3HA digested with XhoI-NotI. pREP3x and pREP81x differ in a few nucleotides in the promoter (the expression levels of the lacZ gene in pREP81x is 1000-fold less than in pREP3x), so analysis by Western blot was made to check the integrity of RepHA. To perform the in vitro assays for His6-fused protein and HA2-fused protein, fission yeast was transformed with both plasmids and grown to mid-log phase at 30°C in EMM2 minimal liquid media containing 4 ␮M thiamine. Cells were washed three times with thiamine-free medium and reinoculated into EMM2 medium and grown for a further 19 h to mid-log phase before preparing protein extracts.

For the pull-down assay, cells from a 50-ml culture were collected and resuspended in 200 ␮l of extraction buffer (EB) (30 mM NaF, 100 mM NaCl, 20 mM Tris–HCl pH 8.0, 10% glycerol, 0.5% Triton X-100) containing 5 ␮g/ml aprotinin, 5 ␮g/ml pepstatin A, 5 ␮g/ml leupeptin, and 1 mM PMSF. The cells were then disrupted with 500 ␮l of acid-washed glass beads (425-600 ␮m, Sigma) by agitation in a FastPrep FP120 at power setting 5.5 for two 15-s intervals separated by 1-min intervals on ice. Then, 300 ␮l of EB with protease inhibitors was added and the sample was vortexed. Lysates were subjected to centrifugation at 12,000 g at 4°C for 30 min to remove insoluble proteins; the supernatant was recovered and the protein concentration was determined using Bradford assays (Bio-Rad). HIS-fusion proteins were purified by incubation with metal affinity resin (TALON Metal Affinity Resin, Clontech) equilibrated in EB according to manufacturer’s instructions. Coimmunoprecipitation assays were done according to Settlage et al. (1996). Proteins were fractionated by SDS–PAGE and analyzed by immunoblotting. Western blot detection was carried out after equal amounts of protein samples were run on an SDS–PAGE gel, transferred to nitrocellulose membrane (Hybond ECL), and analyzed by immunoblotting with the ECL chemiluminescence detection system (Amersham Pharmacia). Primary antibodies were monoclonal anti-HIS antibody (Penta-HIS Antibody, Mouse IgG1, Mab. Qiagen) or monoclonal anti-HA antibody (Mab HA.11, IgG1/k, BABCO).

Acknowledgments This research was partially supported by a grant from the Spanish Ministerio de Ciencia y Tecnologı´a (AGF98-0439C05-05). A.G.C. was awarded a Predoctoral Fellowship from the Spanish Ministerio de Eduacio´ n y Cultura. We thank Dr. John Stanley, Dr. Crisanto Gutierrez, and Dr. Carmen Beuzo´ n for critical reading of the manuscript and many helpful suggestions, Dr. S. Moreno for providing the

A.G. Castillo et al. / Virology 312 (2003) 381–394

Schizosaccharomyces pombe PCNA mutant (⌬pcn1), and Lucia Cruzado for excellent technical assistance

References Ach, R.A., Durfee, T., Miller, A.B., Taranto, P., Hanley-Bowdoin, L., Zambryski, P.C., Gruissem, W., 1997. RRB1 and RRb2 encode Maize retinoblastoma-related proteins that interact with a plant D-type cyclin and Geminivirus replication protein. Mol. Cell. Biol. 17, 5077–5086. Akbar Behjatnia, S.A., Dry, I., Rezaian, M., 1998. Identification of the replication-associated protein binding domain within the intergenic region of tomato leaf curl geminivirus. Nucleic Acids Res. 26, 925– 931. Ausubel, F., Brent, R., Kingston, R., Moore, D., Seidman, J., Smith, J., Struhl, K., 1998. Current Protocols in Molecular Biology. Wiley & Sons, New York. Bernstein, F., Koetzle, T., Williams, G., Meyer, E.J., Brice, M., Rodgers, J., Kennard, O., Shimanouchi, T., Tasumi, M., 1977. The protein data bank. A computer-based archival file for macromolecular structures. Eur. J. Biochem. 80, 319 –324. Blundell, T., Sibanda, B., Sternberg, M., Thornton, J., 1987. Knowledgebased prediction of protein structures and the design of novel molecules. Nature 326, 347–352. Botella, M., Quesada, M., Kononowicz, A., Bressan, R., Hasegawa, P., Valpuesta, V., 1994. Characterization and in situ localization of a salt induced tomato peroxidase gene. Plant Mol. Biol. 25, 105–114. Brooks, B., Bruccoleri, R., Olafson, B., States, D., Swaminathann, S., Karplus, M., 1983. CHARMM: a program for macromolecular energy, minimization and dynamics calculations. J. Comput. Chem. 4, 187– 217. Castellano, M.M., Sanz.Burgos, A.P., Gutierrez, C., 1999. Initiation of DNA replication in eukaryotic rolling replicon: identification of multiple DNA-protein complexes at the geminivirus origin. J. Mol. Biol. 290, 639 – 652. Chomczynski, P., Sacchi, N., 1987. Single-step method of RNA isolation by acid guanidinium thiocyanate-phenol-chloroform extraction. Anal. Biochem. 162, 156 –159. Craven, R.A., Griffiths, D.J., Sheldrick, K.S., Randall, R.E., Hagan, I.M., Carr, A.M., 1998. Vectors for the expression of tagged proteins in Schizosaccharomyces pombe. Gene 221, 59 – 68. Elledge, S.J., Mulligan, J.T., Ramer, S.W., Spottswood, M., Davis, R.W., 1991. Lambda YES: a multifunctional cDNA expression vector for the isolation of genes by complementation of yeast and Escherichia coli mutations. Proc. Natl. Acad. Sci. USA. 88, 1731–1735. Fields, S., Song, O., 1989. A novel genetic system to detect protein-protein interactions. Nature 340, 245–246. Fontes, E.P.B., Eagle, P.A., Sipe, P.S., Luckow, V.A., Hanley-Bowdoin, L., 1994. Interaction between a geminivirus replication protein and origin DNA is essential for viral replication. J. Biol. Chem. 269, 8459 – 8465. Frattini, M.G., Laimins, L.A., 1994. Binding of the human papillomavirus E1 origin-recognition protein is regulated through complex formation with the E2 enhancer-binding protein. Proc. Natl. Acad. Sci. USA 91, 12398 –12402. Fromont-Racine, M., Rain, J.C., Legrain, P., 1997. Toward a functional analysis of the yeast genome through exhaustive two-hybrid screens. Nat. Genet. 16, 277–282. Gietz, R.D., Schiestl, R.H., 1995. Transforming yeast with DNA. Methods Mol. Cell. Biol. 5, 255–269. Guarente, L., 1983. Yeast promoters and lacZ fusions designed to study expression of cloned genes in yeast. Methods Enzymol. 101, 181–191. Gulbis, J.M., Kelman, Z., Hurwitz, J., O’donnell, M., Kuriyan, J., 1996. Structure of the C-terminal region of p21(WAF1/CIP1) complexed with human PCNA. Cell 87, 297–306.

393

Gutierrez, C., 2000. DNA replication and cell cycle in plants: learning from geminiviruses. EMBO J. 19, 792–799. Hanley-Bowdoin, L., Settlage, S.B., Orozco, B.M., Nagar, S., Robertson, D., 1999. Geminiviruses: models for plant DNA replication, transcription, and cell cycle regulation. Crit. Rev. Biochem. Mol. Biol. 35, 105–140. Heyraud-Nitschke, F., Schumacher, S., Laufs, J., Schaefer, S., Schell, J., Gronenborn, B., 1995. Determination of the origin cleavage and joining domain of geminivirus Rep proteins. Nucleic Acids Res. 23, 910 –916. Hormuzdi, S.G., Bisaro, D.M., 1995. Genetic analysis of beet curly top virus: examination of the roles of L2 and L3 genes in viral pathogenesis. Virology 206, 1044 –1054. Horvath, G.V., Pettko-Szandtner, A., Nikovics, K., Bilgin, M., Boulton, M., Davies, J.W., Gutierrez, C., Dudits, D., 1998. Prediction of functional regions of the maize streak virus replication-associated proteins by protein-protein interaction analysis. Plant Mol. Biol. 38, 699 –712. James, P., Halladay, J., Craig, E., 1996. Genomic libraries and a host strain designed for highly efficient two-hybrid selection in yeast. Genetics 144, 1425–1436. Jansen-Durr, P., 1996. How viral oncogenes make the cell cycle. Trends Genet. 12, 270 –275. Kelman, Z., Hurwitz, J., 1998. Protein-PCNA interactions: a DNA-scanning mechanism? Trends Biochem. Sci. 23, 236 –238. Kim, J., Harter, K., Theologis, A., 1997. Protein-protein interactions among the Aux/IAA proteins. Proc. Natl. Acad. Sci. USA 94, 11786 – 11791. Kong, L.J., Orozco, B.M., Roe, J.L., Nagar, S., Ou, S., Feiler, H.S., Durfee, T., Miller, A.B., Gruissem, W., Robertson, D., Hanley-Bowdoin, L., 2000. A geminivirus replication protein interacts with the retinoblastoma protein through a novel domain to determine symptoms and tissue specificity of infection in plants. EMBO J. 19, 3485–3495. Krishna, T., Fenyo, D., Kong, X., Gary, S., Chait, B., Burgers, P., Kuriyan, J., 1994. Crystallization of proliferating cell nuclear antigen (PCNA) from Saccharomyces cerevisiae. J. Mol. Biol. 241, 265–268. Labesse, G., Colloc’h, N., Pothier, J., Mornon, J.P., 1997. P-SEA: a new efficient assignment of secondary structure from C alpha trace of proteins. Comput. Appl. Biosci. 13, 291–295. Laskowski, R.A., 1993. PROCHECK: a program to check the stereochemical quality of protein structures. J. Appl. Cryst. 26, 283–291. Laufs, J., Jupin, I., David, C., Schumacher, S., Heyraud-Nitschke, F., Gronenborn, B., 1995a. Geminivirus replication-genetic and biochemical characterization of Rep protein function, a review. Biochimie 77, 765–773. Laufs, J., Traut, W., Heyraud, F., Matzeit, V., Rogers, S.G., Schell, J., Gronenborn, B., 1995b. In vitro cleavage and joining at the viral origin of replication by the replication initiator protein of tomato yellow leaf curl virus. Proc. Natl. Acad. Sci. USA 92, 3879 –3883. Li, R., Botchan, M.R., 1994. Acidic transcription factors alleviate nucleosome-mediated repression of DNA replication of bovine papillomavirus type 1. Proc. Natl. Acad. Sci. USA. 91, 7051–7055. Liptak, L.M., Uprichard, S.L., Knipe, D.M., 1996. Functional order of assembly of herpes simplex virus DNA replication proteins into prereplicative site structures. J. Virol. 70, 1759 –1767. Liu, L., Saunders, K., Thomas, C.L., Davies, J.W., Stanley, J., 1999. Bean yellow dwarf virus RepA, but not rep, binds to maize retinoblastoma protein, and the virus tolerates mutations in the consensus binding motif. Virology 256, 270 –279. Luque, A., Sanz-Burgos, A.P., Ramirez-Parra, M., Castellano, M.M., Gutierrez, C., 2002. Interaction of geminivirus Rep protein with replication factor C and its potential role during geminivirus DNA replication. Virology 302, 83–94. Luthy, R., Bowie, J.U., Eisenberg, D., 1992. Assessment of protein models with three-dimensional profiles. Nature. 356, 83– 85. Maundrell, K., 1993. Thiamine-repressible expression vectors pREP and pRIP for fission yeast. Gene 123, 127–130. Moreno, S., Klar, A., Nurse, P., 1991. Molecular genetic analysis of fission yeast Schizosaccharomyces pombe. Methods Enzymol. 194, 795– 823.

394

A.G. Castillo et al. / Virology 312 (2003) 381–394

Morris, B., Richardson, K., Eddy, P., Zhan, X.C., Haley, A., Gardner, R., 1991. Mutagenesis of the AC3 open reading frame of African cassava mosaic virus DNA A reduces DNA B replication and ameliorates disease symptoms. J. Gen. Virol. 72, 1205–1213. Munoz, M.J., Jimenez, J., 1999. Genetic interactions between Hsp90 and the Cdc2 mitotic machinery in the fission yeast Schizosaccharomyces pombe. Mol. Gen. Genet. 261, 242–250. Nagar, S., Pedersen, T., Carrick, K., Hanley-Bowdoin, L., Robertson, D., 1995. A geminivirus induces expression of a host DNA synthesis protein in terminally differentiated plant cells. Plant Cell 7, 705–719. Orozco, B.M., Hanley-Bowdoin, L., 1996. A DNA structure is required for geminivirus replication origin function. J. Virol. 70, 148 –158. Orozco, B.M., Miller, A.B., Settlage, S.B., Hanley-Bowdoin, L., 1997. Functional domains of a geminivirus replication protein. J. Biol. Chem. 272, 9840 –9846. Pedersen, T.J., Hanley-Bowdoin, L., 1994. Molecular characterization of the AL3 protein encoded by a bipartite geminivirus. Virology 202, 1070 –1075. Peitsch, M., 1995. Protein modeling by e-mail. Biotechnology 13, 658 – 660. Petermann, P., Mossier, B., Aryee, D., Kovar, H., 1998. A recombination based method to rapidly assess specificity of two-hybrid clones in yeast. Nucleic Acids Res. 26, 2252–2253. Ponder, J., Richards, F., 1987. Tertiary templates for proteins. Use of packing criteria in the enumeration of allowed sequences for different structural classes. J. Mol. Biol. 193, 775–791.

Sambrook, J., Russell, D., 2001. Molecular Cloning. A Laboratory Manual, third ed., 1, 2, 3. 3 vols. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, New York. Settlage, S., Miller, A., Hanley-Bowdoin, L., 1996. Interactions between geminivirus replication proteins. J. Virol. 70, 6790 – 6795. Settlage, S.B., Miller, A.B., Gruissem, W., Hanley-Bowdoin, L., 2001. Dual interaction of a geminivirus replication accessory factor with a viral replication protein and a plant cell cycle regulator. Virology 279, 570 –576. Sung, Y.K., Coutts, R.H., 1995. Mutational analysis of potato yellow mosaic geminivirus. J. Gen. Virol. 76, 1773–1780. Sunter, G., Hartitz, M.D., Hormuzdi, S.G., Brough, C.L., Bisaro, D.M., 1990. Genetic analysis of tomato golden mosaic virus—ORF-AL2 is required for coat protein accumulation while ORF-AL3 is necessary for efficient DNA replication. Virology 179, 69 –77. Tsurimoto, T., 1999. PCNA binding proteins. Front Biosci. 4, 849 – 858. Warbrick, E., 2000. The puzzle of PCNA’s many partners. Bioessays 22, 997–1006. Waseem, N.H., Labib, K., Nurse, P., Lane, D.P., 1992. Isolation and analysis of the fission yeast gene encoding polymerase delta accessory protein PCNA. EMBO J. 11, 5111–5120. Weinberg, R.A., 1995. The retinoblastoma protein and cell cycle control. Cell 81, 323–330. Xie, Q., Sanz-Burgos, A.P., Hannon, G.J., Gutierrez, C., 1996. Plant cells contain a novel member of the retinoblastoma family of growth regulatory proteins. EMBO J. 15, 4900 – 4908.