- Email: [email protected]
Dynamic association of topoisomerase II to the mitotic chromosomes in live cells of Aspergillus nidulans
BBRC Biochemical and Biophysical Research Communications 334 (2005) 324–332 www.elsevier.com/locate/ybbrc
Dynamic association of topoisomerase II to the mitotic chromosomes in live cells of Aspergillus nidulans Mika Kawagishi, Tomohiro Akashi, Akihiko Kikuchi * Division of Molecular Mycology and Medicine, Center for Neurological Disease and Cancer, Nagoya University Graduate School of Medicine, Nagoya, Japan Received 16 May 2005 Available online 1 July 2005
Abstract DNA topoisomerase II (Topo II) is an essential enzyme that catalyzes topological changes of DNA and consists of a major member of mitotic chromosomes. To investigate the dynamic localization of Topo II in nuclei, we engineered the strain of Aspergillus nidulans expressing Topo II fused with green fluorescent protein (GFP). Time-lapse microscopy revealed that the distribution of Topo II-GFP in nuclei varied depending on the cell cycle. In interphase, Topo II-GFP distributed evenly in the nucleoplasm and at the onset of G2 phase became concentrated into nucleolus. During mitosis, Topo II-GFP accumulated on chromosomes, when the chromosomes condensed. In the early mitosis, the Topo II also showed a single or two brighter spots among the fluorescence of clumped chromosomes. The spots once divided into several spots and then concentrated again into a spot per nucleus in the dividing nuclei of anaphase. Along with the subsequent decondensation of chromosomes, Topo II diffused back into nucleoplasm. 2005 Elsevier Inc. All rights reserved. Keywords: Topoisomerase II; Aspergillus nidulans; Time-lapse microscopy; GFP; Mitotic chromosomes
DNA topoisomerase II (Topo II) is an ubiquitous enzyme that has the ability to catalyze strand passing of double-stranded DNA in an ATP-dependent fashion [1]. This activity is necessary for replication termination, when intertwined strands of DNA created during replication are decatenated [2]. During cell division, this enzyme has been found to be essential for chromosome condensation and sister chromatid segregation [3–5], although its role in chromosome condensation is still unclear. In chromosomes that have been isolated from cells arrested in mitotic phase, the bulk of Topo II is tightly associated [6–8]. As a result, Topo II is, in addition to its enzymatic functions [9], considered to play a structural role in chromosome organization as a major scaffold. However, the exact role of Topo II in chromosome organization remains controversial because different *
Corresponding author. Fax: +81 52 744 2459. E-mail address: [email protected] (A. Kikuchi).
0006-291X/$ - see front matter 2005 Elsevier Inc. All rights reserved. doi:10.1016/j.bbrc.2005.06.135
approaches failed to detect a stable association of Topo II with mitotic chromosomes [10,11]. In some immunolabeling studies of mammalian cells, it has been established that the enzyme (especially IIa isoform in mammals) binds to condensed chromosomes and accumulates at centromeres in metaphase [12–15]. Moreover, recent studies have shown that the association of Topo II with chromosomes in live cells appears to be more dynamic than presumed before [16,17]. In interphase mammalian cells, various groups report differences in the subnuclear distribution of Topo IIa with some but not all studies noting a concentration in the nucleoli by immunological method [18–20]. In this work, we have used the filamentous fungus Aspergillus nidulans to investigate the dynamics of Topo II in live cells. In comparison with mammals and yeast, Topo II of the filamentous fungus species is poorly studied [21–23]. A. nidulans provides an excellent genetic system to study basic cellular processes, including mitosis
M. Kawagishi et al. / Biochemical and Biophysical Research Communications 334 (2005) 324–332
and nuclear migration [24]. Compared with the budding yeast in which chromosomes do not condense during mitosis, A. nidulans chromosomes apparently condense. We engineered an A. nidulans strain expressing Topo II fused with green fluorescent protein (GFP) from the endogenous top2 promoter. GFP provides a useful in vivo marker to detect protein localization within live cells. We have monitored the distribution of Topo II in live cells by recording an image by time-lapse equipment. Recent studies reported the dynamic aspect of chromosomes during mitosis in A. nidulans by a fluorescent protein fused to a histone H1 [25] or H2A [26]. Using the H2A gene fused with cyan fluorescent protein (CFP) gene [26], we examined the localization of Topo II and chromosomes simultaneously in the same live cells. In addition, we detected particular distribution of Topo II in nucleus when the cells are arrested at metaphase by benomyl.
Materials and methods Construction of Topo II-GFP strain. A 4.2-kb cDNA sequence of the C-terminal region of A. nidulans Topo II was amplified from the plasmid containing the complete A. nidulans top2 cDNA (revised data; in our previous report [22], the first exon of Topo II gene was unnoticed and the G residue at 4927 nt was missing) with oligos AF2 (5 0 -CC TAAGATCACCGCTGCT-3 0 ) and RTG1 (5 0 -TCTCCTTTACTCC CGGGCATGTCCGACAGGTCAAACGAAT-3 0 ). A gfp2-5 gene, a version of GFP that functions well in Aspergillus [27], was amplified from pLO72 (provided from Dr. Oakley) with oligos FTG1 (5 0 -A TTCGTTTGACCTGTCGGACATGCCCGGGAGTAAAGGAGA3 0 ) and RG1 (5 0 -TTATTTGTATAGTTCATCCATGCC-3 0 ). These fragments were mixed and used as templates to amplify a top2-4::gfp fusion gene using oligos AF2 and RG1 as primers. The top2-4::gfp fusion gene was inserted into the SmaI site of pPTRI (TaKaRa), resulting in plasmid pPTRI-STG1. To construct the Topo II-GFP expression strain in which the top24::gfp fusion gene is integrated into the endogenous top2 locus, the plasmid pPTRI-STG was transformed in strain FGSC4 (wild-type: no nutritional markers) as shown in Fig. 1A. The protoplast-PEG method (according to the manufacturers instruction of pPTRI) was applied for each transformation and transformants were selected on CD plate (6 g/ L NaNO3, 0.52 g/L KCl, 1.52 g/L KH2PO4, 0.52 g/L MgSO4Æ7H2O, 10 g/L D-glucose, 20 g/L agar, and 1 ml/L of a trace elements solution [28], adjusted to pH 6.5 with 1 M KOH) containing 0.1 mg/L pyrithiamine. Under this condition, only transformants in which the pPTR-STG1 had been integrated are rescued. Southern blotting analysis. DNA was extracted from frozen mycelia using DNeasy Plant Mini Kit (Qiagen). After EcoRI digestion followed by separation by agarose gel electrophoresis, fragments were Southern blotted to GeneScreen Plus hybridization transfer membrane (Perkin-Elmer) and probed using the PCR amplified and DIG-dUTP labeled fragments of the top2 gene and the gfp2-5 gene. SDS–PAGE and immunoblotting analysis. Proteins in the crude extracts were separated by electrophoresis in a 7.5% SDS–polyacrylamide gel (SDS–PAGE), and then protein bands were electrotransferred to an Immobilon PVDF membrane (Millipore) using a semi-dry blotter (Biocraft). The membrane was incubated with anti-human topo II monoclonal antibody (6H8) and subsequently with the goat antimouse IgG (H + L) conjugated with alkaline phosphatase (Promega), followed by color development using nitro blue tetrazolium and 5bromo-4-chloro-3-indolyl-phosphate as substrates.
325
Expression of CFP-H2A in A. nidulans strain KTG1. To construct a CFP-histone-H2A expression vector, the alcA::cfp::H2A fusion gene [26] was inserted into the Aor51HI digested plasmid pAUR316 (TaKaRa), containing an aureobasidin A resistant marker and an autonomously replicating sequence (AMA1) of A. nidulans. The resultant plasmid was transformed into KTG1 by the protoplast-PEG method. Transformant was selected on SD-T plate (10 g/L polypepton S, 20 g/L D-glucose, 0.8 M NaCl, and 20 g/L agar) containing 4 lg/ml aureobasidin A (TaKaRa). To induce CFP-H2A protein under the control of alcA promoter, transformant was cultured in minimal medium (7 mM KCl, 2 mM MgCl2, 12 mM KH2PO4, 0.1% trace element solution, and 0.1% D-fructose, adjusted to pH 6.5 with 1 M KOH) containing 100 mM threonine. Fixed-cell imaging by fluorescence microscopy. Cells were fixed with 2.5% formaldehyde for 1 h, washed twice with 0.1 M potassium phosphate (pH 7.5) for 30 min, and then stained with the fluorescent DNA-binding dye 4,6-diamidino-2-phenylindole (DAPI), mixed in the mounting medium. The cells were observed with a fluorescence microscope (Olympus BX-60) using U-MGFPHQ filter set for GFP and U-MWU filter set for DAPI (Olympus), and a 100· Uplan Apo objective (Olympus). A CCD-camera, ORCA-ER (Hamamatsu Photonics), was attached to the microscope with a video camera mount adaptor (U-CMAD-2, Olympus) and controlled with IP Lab software (Scananalytics). Live-cell imaging by fluorescence microscopy. The cells were cultured in glass bottom dish (Matsunami Glass Ind.) in SD medium (6.7 g/L yeast nitrogen base without amino acids, 20 g/L D-glucose) or minimal medium containing 100 mM threonine at room temperature. Picture images were taken with the BX-60 fluorescence microscope as above, except that a 100· LUMPlan FI objective (Olympus) was used. The ORCA-ER CCD-camera was attached with a video camera mount adaptor (U-CMAD-2) for standard magnification and with a 0.5· cmount video camera port (U-TVO. 5XC-2, Olympus) for low magnification. U-MGFPHQ and XF88 (Omega Optical) filter sets were used for observation of GFP and CFP fluorescences, respectively.
Results and discussion Construction and observation of A. nidulans expressing Topo II-GFP fusion To examine the intracellular behavior of topo II, an A. nidulans strain expressing Topo II-GFP fusion protein was constructed. The gfp2-5-fused top2-4 gene of the pPTRI-STG1 was integrated in tandem by homologous recombination with the endogenous top2 gene in such a way that the fusion gene was placed directly to native promoter of top2 gene (Fig. 1A). Transformants were selected on CD plates containing a pyrithiamine and one of the transformants, named KTG1, was analyzed further. KTG1 grew and developed normally; it made similar colony as wild-type strain and extended normal hyphae (data not shown). By Southern blotting analysis, we confirmed the structure of KTG1 that the top2::gfp fusion gene had successfully integrated as expected (Fig. 1B). We also confirmed that KTG1 strain produced only the Topo II-GFP fusion protein as shown by immunoblotting analysis (Fig. 1C), indicating that the GFP-tagged Topo II protein was successfully replaced for the native Topo II protein. Thus, these
326
M. Kawagishi et al. / Biochemical and Biophysical Research Communications 334 (2005) 324–332
Fig. 1. Construction of an A. nidulans strain expressing Topo II-GFP. (A) Strategy for the site-specific integration of the top2::gfp2-5 fusion. The plasmid pPTRI-STG1 contains the top2-4::gfp2-5 fusion gene and the ptrA gene as a selective marker. A single crossover at the top2 gene places the top2::gfp2-5 fusion gene next to top2 promoter. Note that two novel EcoRI sites are created when specific integration occurs. (B) Total genomic DNAs from wild type (FGSC4) and transformant (KTG1) strains were digested with EcoRI and subjected to Southern blot analysis. EFER: probe specific to top2 gene (3333–4463) and GFP: probe specific to gfp2-5 gene. (C) Cell extracts of wild type (FGSC4) and a transformant (KTG1) were separated by 7.5% SDS–PAGE and analyzed by immunoblotting using an anti-human topo II antibody (6H8). The size of Topo II molecule detected by 6H8 antibody is larger than that of FGSC4 cell extract, corresponding to the additional size by GFP (28 kDa) fusion. (D) KTG1 cells were grown in SD medium at 37 on the cover glass and observed with a fluorescence microscopy using a 40· Uplan Apo objective and U-MGFPHQ filter set. Left panels: Topo II-GFP; right panels: phase-contrast. The arrow indicates a dividing nucleus. Bar = 5 lm.
results collectively indicated that the top2::gfp fusion gene had been expressed from endogenous top2 promoter. It should also be noticed that the fusion protein is functional in vivo. Microscopic observation of KTG1 cells revealed that most of the hyphae had round or oval fluorescence (Fig. 1D). These fluorescent structures corresponded to interphase nuclei (see Figs. 4A and B and text for the figures). A small portion of the hyphae showed much more compact fluorescence (arrow in Fig. 1D). These cells were supposed to be in mitotic phase. We further analyzed the behavior of Topo II-GFP in these cells in detail.
Dynamic behavior of Topo II-GFP during mitotic phase To follow the dynamic behavior of Topo II-GFP during mitotic phase in live cells, we took time-lapse image of Topo II-GFP (Fig. 2 and Supplement of Fig. 2) by low magnification and low resolution to minimize the breach of fluorescence and acquire images for longer durations (see Materials and methods). Fig. 2 shows images selected from 71 serial images and depicted from the onset of mitosis until its completion. Before the onset of mitosis, Topo II-GFP appeared to be distributed all over the nuclei with some bright spots (Fig. 2A).
M. Kawagishi et al. / Biochemical and Biophysical Research Communications 334 (2005) 324–332
327
Fig. 2. Time-lapse imaging of A. nidulans Topo II during mitosis. A. nidulans KTG1 strain expressing Topo II-GFP was grown in SD medium at room temperature and a behavior of Topo II before the onset of mitosis to its end was imaged. Serial 71 images were taken in a condition of low magnification and low resolution (see Materials and methods) at 15 s intervals in which exposure time is 2 s. This image series was automatically enhanced contrast for visibility. Each image of Supplement of Fig. 2 was selected from the serial images. Top image (A) and last image (L) of Supplement of Fig. 2 are 26th and 55th of the 71 images, respectively. An animation movie composed from the 71 images is available as an online supplemental material (video 1). Bar = 5 lm.
When the cell cycle entered to the mitotic phase, the Topo II-GFP spots were conformed into a single compact cluster (Figs. 2B–D). They were rapidly divided into two (Figs. 2D–H). Then, each cluster of Topo IIGFP started to disperse to the whole area of nuclei (Figs. 2I–L). Although we cut 75% of GFP excitation, the fluorescence of GFP was breaching with time. By the auto-enhancement of contrast for visibility in IP Lab software, week green fluorescent noise was detected with time in the cytoplasm, devoid of Topo II. The chromosomal morphology of fixed cells during mitosis in wild type A. nidulans has been described previously in detail [29]. Recent studies reported the direct observations of chromosomes during mitosis in live cells by a fluorescent protein fused to histone H1 [25] or H2A [26]. The dynamic changes of Topo II-GFP in mitosis follow those of the mitotic chromosomes through its condensation, segregation, and decondensation. To determine whether the distribution of Topo IIGFP during mitosis corresponds to the whole of chro-
mosomes or their part, we examined the dynamic behavior of CFP-H2A, which is used as a chromosome marker of A. nidulans [26], in cells simultaneously expressing Topo II-GFP. We inserted the alcA::cfp::H2A fusion gene [26] into the plasmid pAUR316 (TaKaRa) containing AMA1, an autonomously replicating sequence of A. nidulans. The resultant plasmid was transformed into KTG1. Since mitotic phase of A. nidulans is very short and a movement of chromosomes is so rapid, we found that it was difficult to obtain simultaneously dual-color images of Topo II-GFP and CFPH2A. We took an advantage of time-lapse method, taking images of the Topo II and H2A, alternately, at 15 s intervals in which exposure time is 2 s (selected frames from time-lapse images are shown in Fig. 3). Our observations in mitotic chromosomes were completely consistent with previous reports [25,26,29]. The A. nidulans chromosomes initially condensed into a single mass, through prophase to metaphase (Figs. 3A and B of CFP-H2A). They then moved rapidly to the spindle
328
M. Kawagishi et al. / Biochemical and Biophysical Research Communications 334 (2005) 324–332
Fig. 3. Dual fluorescence images of Topo II-GFP and CFP-H2A in the live cells. KTG1 strain carrying CFP-H2A fusion gene was grown in minimal medium including threonine at room temperature and imaged at subsequent time points as indicated from prophase to telophase. Time-lapse images of Topo II-GFP and CFP-H2A were taken by standard condition (see Materials and methods) and by using two filters alternately, for GFP and CFP fluorescence. Topo II-GFP and CFP-H2A were shown as green and cyan, respectively. Chromosomes condensed from A to B (0–45 s), segregated from C to D (1 to 2 min 15 s), and decondensed, and ultimately interphase nuclei formed (E). An arrow indicates nucleolus in an interphase nucleus (E). Bar = 5 lm.
poles (anaphase A) forming two masses (Figs. 3C and D of CFP-H2A). The two masses moved further apart (anaphase B) (Fig. 3E of CFP-H2A). Each mass then decondensed and changed into interphase nuclei with regions that correspond to the nucleolus (Fig. 3F of CFPH2A). The fluorescent signal of Topo II-GFP appeared as a shape of chromosomes during mitotic phase (Figs. 3A–E of Topo II-GFP). Briefly, Topo II-GFP started to concentrate on chromosomes in prophase (Fig. 3A of Topo II-GFP). In early anaphase A (Fig. 3C of Topo II-GFP), the fluorescent signal of Topo II-GFP appeared fluorescent as intense dots. In anaphase A–B, when chromosomes moved to poles, Topo II-GFP concentration as dots diminished and Topo II-GFP on chromosomes remained (Figs. 3C and D of Topo IIGFP). After the nuclear division (Fig. 3F of Topo II-
GFP), Topo II-GFP was present diffusely in the nucleoplasm unassociated with chromosomes. Previous studies on Drosophila and mammalian cells reported that cytoplasmic levels of Topo II (Topo IIa) increased in the late anaphase and telophase [11,17]. We never observed Topo II-GFP in cytoplasm throughout cell cycle. As mitosis of A. nidulans is intranuclear [30] and the nuclear envelope remains intact throughout mitosis, it is plausible that Topo II-GFP does not diffuse into cytoplasm. In dual-color image of interphase nuclei, we found that Topo II-GFP concentrated to the so-called nucleolus area judging from the absence of CFP-H2A signals (data not shown), although this nucleolar distribution of Topo II was not always evident during interphase. It is difficult to assess the particular role of Topo II in nucleolus. Further studies are necessary to determine if
M. Kawagishi et al. / Biochemical and Biophysical Research Communications 334 (2005) 324–332
329
Fig. 4. Distribution of Topo II-GFP through the cell cycle corresponding to DNA stained with DAPI. KTG1 strain was grown in SD medium at 37 on the cover glass, fixed with formaldehyde, and stained with DAPI. Images of cells in interphase (A,B) and mitotic cells (C–E) are taken by standard condition (see Materials and methods). Topo II-GFP, DNA (DAPI), and a merge of two (merged) are, respectively, shown in green, red, and orange. An illustration of Topo II distribution is shown in each right panel. (A,B) Nucleolus is recognized as a sub-area in nucleus not stained by DAPI. Arrows in (C) indicate the nuclei in prometaphase. Arrowheads in (D) indicate the nuclei in early anaphase. (E) Nuclei in anaphase A–B. The inset (C,D) shows Topo II-GFP images of selected nuclei. Bar = 5 lm.
this localization is for functional purpose, such as temporarily, to sequestrate or to degrade Topo II. Nucleolar distribution of Topo II in interphase is also reported in the mammalian cells [13,16,17], indicating that Topo II localization in nucleolus in interphase can be a general phenomenon. Localization of Topo II-GFP in the formaldehyde-fixed mycelia Although Topo II-GFP in mitotic hyphae showed condensation and decondensation cycle similar to that of chromosome, exact coincidence of distribution between Topo II and chromosome was difficult because of their highly dynamic movement. We are also concerned with the overlapping of CFP- and GFP-fluorescent signals. Therefore, we observed Topo II-GFP distribution in formaldehyde-fixed hyphae in comparison with chromosomal DNA visualized with the fluorescent DNA-binding dye 4,6-diamidino-2-phenylindole (DAPI).
Most of the interphase cells showed Topo II-GFP signal distributed evenly in the nuclei (Fig. 4A). In a small portion of cells, Topo II-GFP was observed particularly in the DNA free area in nucleus and formed several aggregates within that area (Fig. 4B). This aggregation is similar to the distribution of Topo II-GFP observed before mitotic phase in live cells (Fig. 2A). In prophase and/or metaphase, Topo II-GFP distributed unevenly over the condensed chromosome clump defined by the DAPI staining, and often showed an intense signal as a dot (Fig. 4C). This intense signal of Topo II-GFP was located adjacent to the DAPI-stained area. In early anaphase, Topo II-GFP was observed as many dots on the chromosome and then became one or two intense signals located adjacent to chromosomes (Fig. 4D). This distribution of Topo II-GFP corresponds to that shown in Fig. 3C. In late anaphase, Topo II-GFP distribution coincided to chromosomes area (Fig. 4E). Comparing with live cells, the Topo II-GFP localization was shown as an intense spot. However, the dim area of Topo IIGFP was difficult to detect.
330
M. Kawagishi et al. / Biochemical and Biophysical Research Communications 334 (2005) 324–332
The distribution of Topo II-GFP in the presence of benomyl To investigate further the characteristics of Topo IIGFP in mitotic phase, we treated KTG1 with benomyl, which disrupts mitotic spindle and causes cell cycle arrest at the metaphase with condensed mitotic chromosomes. After the addition of benomyl, Topo II-GFP was concentrated as a single or two spots surrounded by dim fluorescence in live cells (Figs. 5A–C). Images in fixed cells showed that the DAPI-stained chromosome formed compact clump and that the intense spots of Topo II-GFP detached from the chromosomal clump (Figs. 5D–F). It seemed that chromosomal clump coincided with the faintly fluorescent area of Topo II-GFP observed in live cells. These observations indicate that Topo II-GFP in benomyl treated cells localizes predominantly to a single or two spots. Mammalian Topo II (particularly IIa) accumulates at kinetochore region in prometaphase and remains there until early anaphase [12–14,16,31]. Therefore, it is plausible that the intense spots observed in mitotic KTG1
cells coincide with kinetochore location. In lower eukaryote, including Saccharomyces cerevisiae, Schizosaccharomyces pombe, and A. nidulans, all centromeres are located adjacent to the spindle pole body (SPB) during interphase [32–34]. In this study, we hypothesize that A. nidulans Topo II is present diffusely in nucleus during interphase and begins to be directed towards kinetochore region when the cell cycle enters into mitosis. In benomyl treated cells, kinetochores remain accumulated to SPB, since there is not effective spindle tension for separating kinetochores from SPBs. Therefore, Topo II-GFP stays as a single or two intense spots as A. nidulans Topo II accumulated to kinetochores located on SPBs. In this report, we have demonstrated the behavior of endogenous Topo II in A. nidulans live cells using GFP. Fig. 6 illustrates the behavior of A. nidulans Topo II in the cell cycle. We found that Topo II localized on the condensed chromosomes in live cells of lower eukaryotes for the first time. We also found that Topo II appears as dots in mitosis, suggesting that the dots correspond to the location of kinetochores. Colocaliza-
Fig. 5. Effect of benomyl on the distribution of Topo II-GFP. KTG1 strain was grown in SD medium at room temperature and treated with benomyl (final concentration of 10 lg/ml) for 2 h. Distribution of Topo II-GFP in unfixed-cells was shown in (A–C). To define the DNA region, benomyltreated cells were fixed with formaldehyde and stained with DAPI (D–F). Topo II-GFP, DNA (DAPI), and a merge of two (Merged) were, respectively, shown in green, red, and orange. All images were taken by standard condition (see Materials and methods). Bar = 5 lm.
M. Kawagishi et al. / Biochemical and Biophysical Research Communications 334 (2005) 324–332
Fig. 6. Model for the localization of A. nidulans Topo II in the cell cylce. Topo II is shown in black color and its darkness indicates the degree of accumulation of Topo II. The length of arrows in center circle indicates the allotted time to each phase in the cell cycle. In interphase, A. nidulans Topo II is diffusely present in the nucleoplasm and often concentrates on the DNA free area (nucleolus?) before mitotic phase. Topo II accumulates on condensed chromosomes through mitotic phase. In the early mitotic phase, a part of Topo II concentrates to a single or double spots (although Topo II is still sitting on the entire chromosomes). This localization of Topo II is a reminiscent of the localization of Topo IIa at kinetochores in mitotic phase. In the start of chromosomal segregation, early anaphase, the spots of Topo II move to the poles. When chromosomal segregation completes and new nuclei are formed, Topo II disperses to the whole area of nuclei.
tion study of the Topo II with A. nidulans kinetochore proteins is necessary to answer it. Acknowledgments We are grateful to Dr. Tetsuya Horio for suggestion in time-lapse imaging of topo II-GFP, to Dr. Berl R. Oakley and Ms. Elizabeth C. Oakley for providing the GFP gene and for supporting to start our works, and to Dr. Xin Xiang for providing the plasmid carrying the alcA-CFP-H2A gene.
Appendix A. Supplementary data Supplementary data associated with this article can be found, in the online version, at doi:10.1016/ j.bbrc.2005.06.135.
References [1] J.C. Wang, DNA topoisomerase, Annu. Rev. Biochem. 54 (1985) 665–697. [2] O. Sundin, A. Varshavsky, Terminal stages of SV40 DNA replication proceed via multiply intertwined catenated dimmers, Cell 21 (1980) 103–114.
331
[3] S. DiNardo, K. Voelkel, R. Sternglanz, DNA topoisomerase II mutant of Saccharomyces cerevisiae: topoisomerase II is required for segregation of daughter molecules at the termination of DNA replication, Proc. Natl. Acad. Sci. USA 81 (1984) 2616–2620. [4] C. Holm, T. Stearns, D. Botstein, DNA topoisomerase II must act at mitosis to prevent nondisjunction and chromosome breakage, Mol. Cell. Biol. 9 (1989) 159–168. [5] T. Uemura, H. Ohkura, Y. Adachi, K. Morino, K. Shiozaki, M. Yanagida, DNA topoisomerase II is required for condensation and separation of mitotic chromosomes in S. pombe, Cell 50 (1987) 917–925. [6] W.C. Earnshaw, M.M.S. Heck, Localization of topoisomerase II in mitotic chromosomes, J. Cell Biol. 100 (1985) 1716–1725. [7] W.C. Earnshaw, B. Halligan, C.A. Cooke, M.M.S. Heck, L. Liu, Topoisomerase II is a structural component of mitotic chromosome scaffolds, J. Cell Biol. 100 (1985) 1706–1715. [8] S.M. Gasser, T. Laroche, J. Falquet, E. Boy de la Tour, U.K. Laemmli, Metaphase chromosome structure: involvement of topoisomerase II, J. Mol. Biol. 188 (1986) 613–629. [9] Y. Adachi, M. Luka, U.K. Laemmli, Chromosome assembly in vitro: topoisomerase II is required for condensation, Cell 64 (1991) 137–148. [10] J.R. Swedlow, J.W. Sedat, D.A. Agard, Multiple chromosomal population of topoisomerase II detected in vivo by time-lapse, three dimensional wide-field microscopy, Cell 73 (1993) 97–108. [11] T. Hirano, T.J. Mitchison, Topoisomerase II does not play a scaffolding role in the organization of mitotic chromosomes assembled in Xenopus egg extract, J. Cell Biol. 120 (1993) 601–612. [12] H.U. Barthelmes, P. Grue, S. Feineis, T. Straub, F. Boege, Active DNA topoisomerase IIa is a component of the salt-stable centrosome core, J. Biol. Chem. 275 (2000) 38823–38830. [13] J.B. Rattner, M.J. Hendzel, C.S. Furbee, M.T. Muller, D.P. Bazett-Jones, Topoisomerase IIa is associated with the mammalian centromere in a cell cycle- and species-specific manner and is required for proper centromere/kinetochore structure, J. Cell Biol. 134 (1996) 1097–1107. [14] A.T. Sumner, The distribution of topoisomerase II on mammalian chromosomes, Chromosome Res. 4 (1996) 5–14. [15] C.L. Andersen, A. Wandall, E. Kjeldsen, C. Mielke, J. Koch, Active, but not inactive, human centromeres display topoisomerase II activity in vivo, Chromosome Res. 10 (4) (2002) 305–312. [16] M.O. Christensen, M.K. Larsen, H.U. Barthelmes, R. Hock, C.L. Andersen, E. Kjeldsen, B.R. Knudsen, O. Westergaard, C. Mielke, Dynamics of human DNA topoisomerase IIa and IIb in living cells, J. Cell Biol. 157 (2002) 31–44. [17] P.A. Tavormina, M.G. Coˆme, J.R. Hudson, Y.Y. Mo, W.T. Beck, G.J. Gorbsky, Rapid exchange of mammalian topoisomerase II alpha at kinetochores and chromosome arms in mitosis, J. Cell Biol. 158 (2002) 23–29. [18] T. Khelifa, W.T. Beck, Merbarone, a catalytic inhibitor of DNA topoisomerase II, induces apoptosis in CEM cells through activation of ICE/CED-3-like protease, Mol. Pharmacol. 55 (1999) 548–556. [19] K.N. Meyer, E. Kjeldsen, T. Straub, B.R. Knudsen, I.D. Hickson, A. Kikuchi, H. Kreipe, F. Boege, Cell cycle-coupled relocation of types I and II topoisomerases and modulation of catalytic enzyme activities, J. Cell Biol. 136 (1997) 775–788. [20] Y.Y. Mo, W.T. Beck, Association of human DNA topoisomerase IIa with mitotic chromosomes in mammalian cells in independent of its catalytic activity, Exp. Cell Res. 252 (1999) 50–62. [21] T. Kanbe, K. Yamaki, A. Kikuchi, Identification of the pathogenic Aspergillus species by nested PCR using a mixture of specific primers to DNA topoisomerase II gene, Microbiol. Immunol. 46 (2002) 841–848. [22] K.H. Kim, T. Akashi, I. Mizuguchi, A. Kikuchi, Cloning and characterization of the gene encoding Aspergillus nidulans DNA topoisomerase II, Gene. 236 (1999) 293–301.
332
M. Kawagishi et al. / Biochemical and Biophysical Research Communications 334 (2005) 324–332
[23] K.H. Kim, T. Kanbe, T. Akashi, I. Mizuguchi, A. Kikuchi, Identification of a single nuclear localization signal in the Cterminal domain of an Aspergillus DNA topoisomerase II, Mol. Gen. Genet. 268 (2002) 287–297. [24] J.R. Aist, N.R. Morris, Mitosis in filamentous fungi: how we got where we are, Fungal Genet. Biol. 27 (1999) 1–25. [25] N.L. Prigozhina, C.E. Oakley, A.M. Lewis, T. Nayak, S.A. Osmani, B.R. Oakler, c-Tubulin plays an essential role in the coordination of mitotic events, Mol. Biol. Cell 15 (2004) 1374– 1386. [26] W. Su, S. Li, B.R. Oakley, X. Xiang, Dual-color imaging of nuclear division and mitotic spindle elongation in live cells of Aspergillus nidulans, Eukaryot. Cell 3 (2004) 553– 556. [27] C.F. Robinow, C.E. Caten, Mitosis in Aspergillus nidulans, J. Cell Sci. 5 (1969) 403–431. ´ balos, H. Fox, C. Pitt, B. Wells, J.H. Doonan, [28] J.M. Ferna´ndez-A Plant-adapted green fluorescent protein is a versatile vital reporter for gene expression, protein localization and mitosis in the filamentous fungus, Aspergillus nidulans, Mol. Microbiol. 27 (1998) 121–130.
[29] D.J. Cove, The induction and repression of nitrate reductase in the fungus Aspergillus nidulans, Biochim. Biophys. Acta 113 (1966) 51–56. [30] M.K. Jung, G.S. May, B.R. Oakley, Mitosis in wild-type and btubulin mutant strains of Aspergillus nidulans, Fungal Genet. Biol. 24 (1998) 146–160. [31] A.P. Null, J. Hudson, G.J. Gorbsky, Both alpha and beta isoforms of mammalian DNA topoisomerase II associate with chromosomes in mitosis, Cell Growth Differ. 13 (2002) 325–333. [32] H. Tatebe, G. Goshima, K. Takeda, T. Nakagawa, K. Kinoshita, M. Yanagida, Fission yeast living mitosis visualized by GFPtagged gene products, Micron 32 (2001) 67–74. [33] P.A. Wigge, J.V. Kilmartin, The Ndc80p complex from Saccharomyces cerevisiae contains conserved centromere components and has a function in chromosome segregation, J. Cell Biol. 152 (2001) 349–360. [34] L. Yang, L. Ukil, A. Osmani, F. Nahm, J. Davies, C.P.C.D. Souza, X. Dou, A. Perez-Balaguer, S.A. Osmani, Rapid production of gene replacement constructs and generation of a green fluorescent protein-tagged centromeric marker in Aspergillus nidulans, Eukaryot. Cell 3 (2004) 1359–1362.
Dynamic association of topoisomerase II to the mitotic chromosomes in live cells of Aspergillus nidulans Mika Kawagishi, Tomohiro Akashi, Akihiko Kikuchi * Division of Molecular Mycology and Medicine, Center for Neurological Disease and Cancer, Nagoya University Graduate School of Medicine, Nagoya, Japan Received 16 May 2005 Available online 1 July 2005
Abstract DNA topoisomerase II (Topo II) is an essential enzyme that catalyzes topological changes of DNA and consists of a major member of mitotic chromosomes. To investigate the dynamic localization of Topo II in nuclei, we engineered the strain of Aspergillus nidulans expressing Topo II fused with green fluorescent protein (GFP). Time-lapse microscopy revealed that the distribution of Topo II-GFP in nuclei varied depending on the cell cycle. In interphase, Topo II-GFP distributed evenly in the nucleoplasm and at the onset of G2 phase became concentrated into nucleolus. During mitosis, Topo II-GFP accumulated on chromosomes, when the chromosomes condensed. In the early mitosis, the Topo II also showed a single or two brighter spots among the fluorescence of clumped chromosomes. The spots once divided into several spots and then concentrated again into a spot per nucleus in the dividing nuclei of anaphase. Along with the subsequent decondensation of chromosomes, Topo II diffused back into nucleoplasm. 2005 Elsevier Inc. All rights reserved. Keywords: Topoisomerase II; Aspergillus nidulans; Time-lapse microscopy; GFP; Mitotic chromosomes
DNA topoisomerase II (Topo II) is an ubiquitous enzyme that has the ability to catalyze strand passing of double-stranded DNA in an ATP-dependent fashion [1]. This activity is necessary for replication termination, when intertwined strands of DNA created during replication are decatenated [2]. During cell division, this enzyme has been found to be essential for chromosome condensation and sister chromatid segregation [3–5], although its role in chromosome condensation is still unclear. In chromosomes that have been isolated from cells arrested in mitotic phase, the bulk of Topo II is tightly associated [6–8]. As a result, Topo II is, in addition to its enzymatic functions [9], considered to play a structural role in chromosome organization as a major scaffold. However, the exact role of Topo II in chromosome organization remains controversial because different *
Corresponding author. Fax: +81 52 744 2459. E-mail address: [email protected] (A. Kikuchi).
0006-291X/$ - see front matter 2005 Elsevier Inc. All rights reserved. doi:10.1016/j.bbrc.2005.06.135
approaches failed to detect a stable association of Topo II with mitotic chromosomes [10,11]. In some immunolabeling studies of mammalian cells, it has been established that the enzyme (especially IIa isoform in mammals) binds to condensed chromosomes and accumulates at centromeres in metaphase [12–15]. Moreover, recent studies have shown that the association of Topo II with chromosomes in live cells appears to be more dynamic than presumed before [16,17]. In interphase mammalian cells, various groups report differences in the subnuclear distribution of Topo IIa with some but not all studies noting a concentration in the nucleoli by immunological method [18–20]. In this work, we have used the filamentous fungus Aspergillus nidulans to investigate the dynamics of Topo II in live cells. In comparison with mammals and yeast, Topo II of the filamentous fungus species is poorly studied [21–23]. A. nidulans provides an excellent genetic system to study basic cellular processes, including mitosis
M. Kawagishi et al. / Biochemical and Biophysical Research Communications 334 (2005) 324–332
and nuclear migration [24]. Compared with the budding yeast in which chromosomes do not condense during mitosis, A. nidulans chromosomes apparently condense. We engineered an A. nidulans strain expressing Topo II fused with green fluorescent protein (GFP) from the endogenous top2 promoter. GFP provides a useful in vivo marker to detect protein localization within live cells. We have monitored the distribution of Topo II in live cells by recording an image by time-lapse equipment. Recent studies reported the dynamic aspect of chromosomes during mitosis in A. nidulans by a fluorescent protein fused to a histone H1 [25] or H2A [26]. Using the H2A gene fused with cyan fluorescent protein (CFP) gene [26], we examined the localization of Topo II and chromosomes simultaneously in the same live cells. In addition, we detected particular distribution of Topo II in nucleus when the cells are arrested at metaphase by benomyl.
Materials and methods Construction of Topo II-GFP strain. A 4.2-kb cDNA sequence of the C-terminal region of A. nidulans Topo II was amplified from the plasmid containing the complete A. nidulans top2 cDNA (revised data; in our previous report [22], the first exon of Topo II gene was unnoticed and the G residue at 4927 nt was missing) with oligos AF2 (5 0 -CC TAAGATCACCGCTGCT-3 0 ) and RTG1 (5 0 -TCTCCTTTACTCC CGGGCATGTCCGACAGGTCAAACGAAT-3 0 ). A gfp2-5 gene, a version of GFP that functions well in Aspergillus [27], was amplified from pLO72 (provided from Dr. Oakley) with oligos FTG1 (5 0 -A TTCGTTTGACCTGTCGGACATGCCCGGGAGTAAAGGAGA3 0 ) and RG1 (5 0 -TTATTTGTATAGTTCATCCATGCC-3 0 ). These fragments were mixed and used as templates to amplify a top2-4::gfp fusion gene using oligos AF2 and RG1 as primers. The top2-4::gfp fusion gene was inserted into the SmaI site of pPTRI (TaKaRa), resulting in plasmid pPTRI-STG1. To construct the Topo II-GFP expression strain in which the top24::gfp fusion gene is integrated into the endogenous top2 locus, the plasmid pPTRI-STG was transformed in strain FGSC4 (wild-type: no nutritional markers) as shown in Fig. 1A. The protoplast-PEG method (according to the manufacturers instruction of pPTRI) was applied for each transformation and transformants were selected on CD plate (6 g/ L NaNO3, 0.52 g/L KCl, 1.52 g/L KH2PO4, 0.52 g/L MgSO4Æ7H2O, 10 g/L D-glucose, 20 g/L agar, and 1 ml/L of a trace elements solution [28], adjusted to pH 6.5 with 1 M KOH) containing 0.1 mg/L pyrithiamine. Under this condition, only transformants in which the pPTR-STG1 had been integrated are rescued. Southern blotting analysis. DNA was extracted from frozen mycelia using DNeasy Plant Mini Kit (Qiagen). After EcoRI digestion followed by separation by agarose gel electrophoresis, fragments were Southern blotted to GeneScreen Plus hybridization transfer membrane (Perkin-Elmer) and probed using the PCR amplified and DIG-dUTP labeled fragments of the top2 gene and the gfp2-5 gene. SDS–PAGE and immunoblotting analysis. Proteins in the crude extracts were separated by electrophoresis in a 7.5% SDS–polyacrylamide gel (SDS–PAGE), and then protein bands were electrotransferred to an Immobilon PVDF membrane (Millipore) using a semi-dry blotter (Biocraft). The membrane was incubated with anti-human topo II monoclonal antibody (6H8) and subsequently with the goat antimouse IgG (H + L) conjugated with alkaline phosphatase (Promega), followed by color development using nitro blue tetrazolium and 5bromo-4-chloro-3-indolyl-phosphate as substrates.
325
Expression of CFP-H2A in A. nidulans strain KTG1. To construct a CFP-histone-H2A expression vector, the alcA::cfp::H2A fusion gene [26] was inserted into the Aor51HI digested plasmid pAUR316 (TaKaRa), containing an aureobasidin A resistant marker and an autonomously replicating sequence (AMA1) of A. nidulans. The resultant plasmid was transformed into KTG1 by the protoplast-PEG method. Transformant was selected on SD-T plate (10 g/L polypepton S, 20 g/L D-glucose, 0.8 M NaCl, and 20 g/L agar) containing 4 lg/ml aureobasidin A (TaKaRa). To induce CFP-H2A protein under the control of alcA promoter, transformant was cultured in minimal medium (7 mM KCl, 2 mM MgCl2, 12 mM KH2PO4, 0.1% trace element solution, and 0.1% D-fructose, adjusted to pH 6.5 with 1 M KOH) containing 100 mM threonine. Fixed-cell imaging by fluorescence microscopy. Cells were fixed with 2.5% formaldehyde for 1 h, washed twice with 0.1 M potassium phosphate (pH 7.5) for 30 min, and then stained with the fluorescent DNA-binding dye 4,6-diamidino-2-phenylindole (DAPI), mixed in the mounting medium. The cells were observed with a fluorescence microscope (Olympus BX-60) using U-MGFPHQ filter set for GFP and U-MWU filter set for DAPI (Olympus), and a 100· Uplan Apo objective (Olympus). A CCD-camera, ORCA-ER (Hamamatsu Photonics), was attached to the microscope with a video camera mount adaptor (U-CMAD-2, Olympus) and controlled with IP Lab software (Scananalytics). Live-cell imaging by fluorescence microscopy. The cells were cultured in glass bottom dish (Matsunami Glass Ind.) in SD medium (6.7 g/L yeast nitrogen base without amino acids, 20 g/L D-glucose) or minimal medium containing 100 mM threonine at room temperature. Picture images were taken with the BX-60 fluorescence microscope as above, except that a 100· LUMPlan FI objective (Olympus) was used. The ORCA-ER CCD-camera was attached with a video camera mount adaptor (U-CMAD-2) for standard magnification and with a 0.5· cmount video camera port (U-TVO. 5XC-2, Olympus) for low magnification. U-MGFPHQ and XF88 (Omega Optical) filter sets were used for observation of GFP and CFP fluorescences, respectively.
Results and discussion Construction and observation of A. nidulans expressing Topo II-GFP fusion To examine the intracellular behavior of topo II, an A. nidulans strain expressing Topo II-GFP fusion protein was constructed. The gfp2-5-fused top2-4 gene of the pPTRI-STG1 was integrated in tandem by homologous recombination with the endogenous top2 gene in such a way that the fusion gene was placed directly to native promoter of top2 gene (Fig. 1A). Transformants were selected on CD plates containing a pyrithiamine and one of the transformants, named KTG1, was analyzed further. KTG1 grew and developed normally; it made similar colony as wild-type strain and extended normal hyphae (data not shown). By Southern blotting analysis, we confirmed the structure of KTG1 that the top2::gfp fusion gene had successfully integrated as expected (Fig. 1B). We also confirmed that KTG1 strain produced only the Topo II-GFP fusion protein as shown by immunoblotting analysis (Fig. 1C), indicating that the GFP-tagged Topo II protein was successfully replaced for the native Topo II protein. Thus, these
326
M. Kawagishi et al. / Biochemical and Biophysical Research Communications 334 (2005) 324–332
Fig. 1. Construction of an A. nidulans strain expressing Topo II-GFP. (A) Strategy for the site-specific integration of the top2::gfp2-5 fusion. The plasmid pPTRI-STG1 contains the top2-4::gfp2-5 fusion gene and the ptrA gene as a selective marker. A single crossover at the top2 gene places the top2::gfp2-5 fusion gene next to top2 promoter. Note that two novel EcoRI sites are created when specific integration occurs. (B) Total genomic DNAs from wild type (FGSC4) and transformant (KTG1) strains were digested with EcoRI and subjected to Southern blot analysis. EFER: probe specific to top2 gene (3333–4463) and GFP: probe specific to gfp2-5 gene. (C) Cell extracts of wild type (FGSC4) and a transformant (KTG1) were separated by 7.5% SDS–PAGE and analyzed by immunoblotting using an anti-human topo II antibody (6H8). The size of Topo II molecule detected by 6H8 antibody is larger than that of FGSC4 cell extract, corresponding to the additional size by GFP (28 kDa) fusion. (D) KTG1 cells were grown in SD medium at 37 on the cover glass and observed with a fluorescence microscopy using a 40· Uplan Apo objective and U-MGFPHQ filter set. Left panels: Topo II-GFP; right panels: phase-contrast. The arrow indicates a dividing nucleus. Bar = 5 lm.
results collectively indicated that the top2::gfp fusion gene had been expressed from endogenous top2 promoter. It should also be noticed that the fusion protein is functional in vivo. Microscopic observation of KTG1 cells revealed that most of the hyphae had round or oval fluorescence (Fig. 1D). These fluorescent structures corresponded to interphase nuclei (see Figs. 4A and B and text for the figures). A small portion of the hyphae showed much more compact fluorescence (arrow in Fig. 1D). These cells were supposed to be in mitotic phase. We further analyzed the behavior of Topo II-GFP in these cells in detail.
Dynamic behavior of Topo II-GFP during mitotic phase To follow the dynamic behavior of Topo II-GFP during mitotic phase in live cells, we took time-lapse image of Topo II-GFP (Fig. 2 and Supplement of Fig. 2) by low magnification and low resolution to minimize the breach of fluorescence and acquire images for longer durations (see Materials and methods). Fig. 2 shows images selected from 71 serial images and depicted from the onset of mitosis until its completion. Before the onset of mitosis, Topo II-GFP appeared to be distributed all over the nuclei with some bright spots (Fig. 2A).
M. Kawagishi et al. / Biochemical and Biophysical Research Communications 334 (2005) 324–332
327
Fig. 2. Time-lapse imaging of A. nidulans Topo II during mitosis. A. nidulans KTG1 strain expressing Topo II-GFP was grown in SD medium at room temperature and a behavior of Topo II before the onset of mitosis to its end was imaged. Serial 71 images were taken in a condition of low magnification and low resolution (see Materials and methods) at 15 s intervals in which exposure time is 2 s. This image series was automatically enhanced contrast for visibility. Each image of Supplement of Fig. 2 was selected from the serial images. Top image (A) and last image (L) of Supplement of Fig. 2 are 26th and 55th of the 71 images, respectively. An animation movie composed from the 71 images is available as an online supplemental material (video 1). Bar = 5 lm.
When the cell cycle entered to the mitotic phase, the Topo II-GFP spots were conformed into a single compact cluster (Figs. 2B–D). They were rapidly divided into two (Figs. 2D–H). Then, each cluster of Topo IIGFP started to disperse to the whole area of nuclei (Figs. 2I–L). Although we cut 75% of GFP excitation, the fluorescence of GFP was breaching with time. By the auto-enhancement of contrast for visibility in IP Lab software, week green fluorescent noise was detected with time in the cytoplasm, devoid of Topo II. The chromosomal morphology of fixed cells during mitosis in wild type A. nidulans has been described previously in detail [29]. Recent studies reported the direct observations of chromosomes during mitosis in live cells by a fluorescent protein fused to histone H1 [25] or H2A [26]. The dynamic changes of Topo II-GFP in mitosis follow those of the mitotic chromosomes through its condensation, segregation, and decondensation. To determine whether the distribution of Topo IIGFP during mitosis corresponds to the whole of chro-
mosomes or their part, we examined the dynamic behavior of CFP-H2A, which is used as a chromosome marker of A. nidulans [26], in cells simultaneously expressing Topo II-GFP. We inserted the alcA::cfp::H2A fusion gene [26] into the plasmid pAUR316 (TaKaRa) containing AMA1, an autonomously replicating sequence of A. nidulans. The resultant plasmid was transformed into KTG1. Since mitotic phase of A. nidulans is very short and a movement of chromosomes is so rapid, we found that it was difficult to obtain simultaneously dual-color images of Topo II-GFP and CFPH2A. We took an advantage of time-lapse method, taking images of the Topo II and H2A, alternately, at 15 s intervals in which exposure time is 2 s (selected frames from time-lapse images are shown in Fig. 3). Our observations in mitotic chromosomes were completely consistent with previous reports [25,26,29]. The A. nidulans chromosomes initially condensed into a single mass, through prophase to metaphase (Figs. 3A and B of CFP-H2A). They then moved rapidly to the spindle
328
M. Kawagishi et al. / Biochemical and Biophysical Research Communications 334 (2005) 324–332
Fig. 3. Dual fluorescence images of Topo II-GFP and CFP-H2A in the live cells. KTG1 strain carrying CFP-H2A fusion gene was grown in minimal medium including threonine at room temperature and imaged at subsequent time points as indicated from prophase to telophase. Time-lapse images of Topo II-GFP and CFP-H2A were taken by standard condition (see Materials and methods) and by using two filters alternately, for GFP and CFP fluorescence. Topo II-GFP and CFP-H2A were shown as green and cyan, respectively. Chromosomes condensed from A to B (0–45 s), segregated from C to D (1 to 2 min 15 s), and decondensed, and ultimately interphase nuclei formed (E). An arrow indicates nucleolus in an interphase nucleus (E). Bar = 5 lm.
poles (anaphase A) forming two masses (Figs. 3C and D of CFP-H2A). The two masses moved further apart (anaphase B) (Fig. 3E of CFP-H2A). Each mass then decondensed and changed into interphase nuclei with regions that correspond to the nucleolus (Fig. 3F of CFPH2A). The fluorescent signal of Topo II-GFP appeared as a shape of chromosomes during mitotic phase (Figs. 3A–E of Topo II-GFP). Briefly, Topo II-GFP started to concentrate on chromosomes in prophase (Fig. 3A of Topo II-GFP). In early anaphase A (Fig. 3C of Topo II-GFP), the fluorescent signal of Topo II-GFP appeared fluorescent as intense dots. In anaphase A–B, when chromosomes moved to poles, Topo II-GFP concentration as dots diminished and Topo II-GFP on chromosomes remained (Figs. 3C and D of Topo IIGFP). After the nuclear division (Fig. 3F of Topo II-
GFP), Topo II-GFP was present diffusely in the nucleoplasm unassociated with chromosomes. Previous studies on Drosophila and mammalian cells reported that cytoplasmic levels of Topo II (Topo IIa) increased in the late anaphase and telophase [11,17]. We never observed Topo II-GFP in cytoplasm throughout cell cycle. As mitosis of A. nidulans is intranuclear [30] and the nuclear envelope remains intact throughout mitosis, it is plausible that Topo II-GFP does not diffuse into cytoplasm. In dual-color image of interphase nuclei, we found that Topo II-GFP concentrated to the so-called nucleolus area judging from the absence of CFP-H2A signals (data not shown), although this nucleolar distribution of Topo II was not always evident during interphase. It is difficult to assess the particular role of Topo II in nucleolus. Further studies are necessary to determine if
M. Kawagishi et al. / Biochemical and Biophysical Research Communications 334 (2005) 324–332
329
Fig. 4. Distribution of Topo II-GFP through the cell cycle corresponding to DNA stained with DAPI. KTG1 strain was grown in SD medium at 37 on the cover glass, fixed with formaldehyde, and stained with DAPI. Images of cells in interphase (A,B) and mitotic cells (C–E) are taken by standard condition (see Materials and methods). Topo II-GFP, DNA (DAPI), and a merge of two (merged) are, respectively, shown in green, red, and orange. An illustration of Topo II distribution is shown in each right panel. (A,B) Nucleolus is recognized as a sub-area in nucleus not stained by DAPI. Arrows in (C) indicate the nuclei in prometaphase. Arrowheads in (D) indicate the nuclei in early anaphase. (E) Nuclei in anaphase A–B. The inset (C,D) shows Topo II-GFP images of selected nuclei. Bar = 5 lm.
this localization is for functional purpose, such as temporarily, to sequestrate or to degrade Topo II. Nucleolar distribution of Topo II in interphase is also reported in the mammalian cells [13,16,17], indicating that Topo II localization in nucleolus in interphase can be a general phenomenon. Localization of Topo II-GFP in the formaldehyde-fixed mycelia Although Topo II-GFP in mitotic hyphae showed condensation and decondensation cycle similar to that of chromosome, exact coincidence of distribution between Topo II and chromosome was difficult because of their highly dynamic movement. We are also concerned with the overlapping of CFP- and GFP-fluorescent signals. Therefore, we observed Topo II-GFP distribution in formaldehyde-fixed hyphae in comparison with chromosomal DNA visualized with the fluorescent DNA-binding dye 4,6-diamidino-2-phenylindole (DAPI).
Most of the interphase cells showed Topo II-GFP signal distributed evenly in the nuclei (Fig. 4A). In a small portion of cells, Topo II-GFP was observed particularly in the DNA free area in nucleus and formed several aggregates within that area (Fig. 4B). This aggregation is similar to the distribution of Topo II-GFP observed before mitotic phase in live cells (Fig. 2A). In prophase and/or metaphase, Topo II-GFP distributed unevenly over the condensed chromosome clump defined by the DAPI staining, and often showed an intense signal as a dot (Fig. 4C). This intense signal of Topo II-GFP was located adjacent to the DAPI-stained area. In early anaphase, Topo II-GFP was observed as many dots on the chromosome and then became one or two intense signals located adjacent to chromosomes (Fig. 4D). This distribution of Topo II-GFP corresponds to that shown in Fig. 3C. In late anaphase, Topo II-GFP distribution coincided to chromosomes area (Fig. 4E). Comparing with live cells, the Topo II-GFP localization was shown as an intense spot. However, the dim area of Topo IIGFP was difficult to detect.
330
M. Kawagishi et al. / Biochemical and Biophysical Research Communications 334 (2005) 324–332
The distribution of Topo II-GFP in the presence of benomyl To investigate further the characteristics of Topo IIGFP in mitotic phase, we treated KTG1 with benomyl, which disrupts mitotic spindle and causes cell cycle arrest at the metaphase with condensed mitotic chromosomes. After the addition of benomyl, Topo II-GFP was concentrated as a single or two spots surrounded by dim fluorescence in live cells (Figs. 5A–C). Images in fixed cells showed that the DAPI-stained chromosome formed compact clump and that the intense spots of Topo II-GFP detached from the chromosomal clump (Figs. 5D–F). It seemed that chromosomal clump coincided with the faintly fluorescent area of Topo II-GFP observed in live cells. These observations indicate that Topo II-GFP in benomyl treated cells localizes predominantly to a single or two spots. Mammalian Topo II (particularly IIa) accumulates at kinetochore region in prometaphase and remains there until early anaphase [12–14,16,31]. Therefore, it is plausible that the intense spots observed in mitotic KTG1
cells coincide with kinetochore location. In lower eukaryote, including Saccharomyces cerevisiae, Schizosaccharomyces pombe, and A. nidulans, all centromeres are located adjacent to the spindle pole body (SPB) during interphase [32–34]. In this study, we hypothesize that A. nidulans Topo II is present diffusely in nucleus during interphase and begins to be directed towards kinetochore region when the cell cycle enters into mitosis. In benomyl treated cells, kinetochores remain accumulated to SPB, since there is not effective spindle tension for separating kinetochores from SPBs. Therefore, Topo II-GFP stays as a single or two intense spots as A. nidulans Topo II accumulated to kinetochores located on SPBs. In this report, we have demonstrated the behavior of endogenous Topo II in A. nidulans live cells using GFP. Fig. 6 illustrates the behavior of A. nidulans Topo II in the cell cycle. We found that Topo II localized on the condensed chromosomes in live cells of lower eukaryotes for the first time. We also found that Topo II appears as dots in mitosis, suggesting that the dots correspond to the location of kinetochores. Colocaliza-
Fig. 5. Effect of benomyl on the distribution of Topo II-GFP. KTG1 strain was grown in SD medium at room temperature and treated with benomyl (final concentration of 10 lg/ml) for 2 h. Distribution of Topo II-GFP in unfixed-cells was shown in (A–C). To define the DNA region, benomyltreated cells were fixed with formaldehyde and stained with DAPI (D–F). Topo II-GFP, DNA (DAPI), and a merge of two (Merged) were, respectively, shown in green, red, and orange. All images were taken by standard condition (see Materials and methods). Bar = 5 lm.
M. Kawagishi et al. / Biochemical and Biophysical Research Communications 334 (2005) 324–332
Fig. 6. Model for the localization of A. nidulans Topo II in the cell cylce. Topo II is shown in black color and its darkness indicates the degree of accumulation of Topo II. The length of arrows in center circle indicates the allotted time to each phase in the cell cycle. In interphase, A. nidulans Topo II is diffusely present in the nucleoplasm and often concentrates on the DNA free area (nucleolus?) before mitotic phase. Topo II accumulates on condensed chromosomes through mitotic phase. In the early mitotic phase, a part of Topo II concentrates to a single or double spots (although Topo II is still sitting on the entire chromosomes). This localization of Topo II is a reminiscent of the localization of Topo IIa at kinetochores in mitotic phase. In the start of chromosomal segregation, early anaphase, the spots of Topo II move to the poles. When chromosomal segregation completes and new nuclei are formed, Topo II disperses to the whole area of nuclei.
tion study of the Topo II with A. nidulans kinetochore proteins is necessary to answer it. Acknowledgments We are grateful to Dr. Tetsuya Horio for suggestion in time-lapse imaging of topo II-GFP, to Dr. Berl R. Oakley and Ms. Elizabeth C. Oakley for providing the GFP gene and for supporting to start our works, and to Dr. Xin Xiang for providing the plasmid carrying the alcA-CFP-H2A gene.
Appendix A. Supplementary data Supplementary data associated with this article can be found, in the online version, at doi:10.1016/ j.bbrc.2005.06.135.
References [1] J.C. Wang, DNA topoisomerase, Annu. Rev. Biochem. 54 (1985) 665–697. [2] O. Sundin, A. Varshavsky, Terminal stages of SV40 DNA replication proceed via multiply intertwined catenated dimmers, Cell 21 (1980) 103–114.
331
[3] S. DiNardo, K. Voelkel, R. Sternglanz, DNA topoisomerase II mutant of Saccharomyces cerevisiae: topoisomerase II is required for segregation of daughter molecules at the termination of DNA replication, Proc. Natl. Acad. Sci. USA 81 (1984) 2616–2620. [4] C. Holm, T. Stearns, D. Botstein, DNA topoisomerase II must act at mitosis to prevent nondisjunction and chromosome breakage, Mol. Cell. Biol. 9 (1989) 159–168. [5] T. Uemura, H. Ohkura, Y. Adachi, K. Morino, K. Shiozaki, M. Yanagida, DNA topoisomerase II is required for condensation and separation of mitotic chromosomes in S. pombe, Cell 50 (1987) 917–925. [6] W.C. Earnshaw, M.M.S. Heck, Localization of topoisomerase II in mitotic chromosomes, J. Cell Biol. 100 (1985) 1716–1725. [7] W.C. Earnshaw, B. Halligan, C.A. Cooke, M.M.S. Heck, L. Liu, Topoisomerase II is a structural component of mitotic chromosome scaffolds, J. Cell Biol. 100 (1985) 1706–1715. [8] S.M. Gasser, T. Laroche, J. Falquet, E. Boy de la Tour, U.K. Laemmli, Metaphase chromosome structure: involvement of topoisomerase II, J. Mol. Biol. 188 (1986) 613–629. [9] Y. Adachi, M. Luka, U.K. Laemmli, Chromosome assembly in vitro: topoisomerase II is required for condensation, Cell 64 (1991) 137–148. [10] J.R. Swedlow, J.W. Sedat, D.A. Agard, Multiple chromosomal population of topoisomerase II detected in vivo by time-lapse, three dimensional wide-field microscopy, Cell 73 (1993) 97–108. [11] T. Hirano, T.J. Mitchison, Topoisomerase II does not play a scaffolding role in the organization of mitotic chromosomes assembled in Xenopus egg extract, J. Cell Biol. 120 (1993) 601–612. [12] H.U. Barthelmes, P. Grue, S. Feineis, T. Straub, F. Boege, Active DNA topoisomerase IIa is a component of the salt-stable centrosome core, J. Biol. Chem. 275 (2000) 38823–38830. [13] J.B. Rattner, M.J. Hendzel, C.S. Furbee, M.T. Muller, D.P. Bazett-Jones, Topoisomerase IIa is associated with the mammalian centromere in a cell cycle- and species-specific manner and is required for proper centromere/kinetochore structure, J. Cell Biol. 134 (1996) 1097–1107. [14] A.T. Sumner, The distribution of topoisomerase II on mammalian chromosomes, Chromosome Res. 4 (1996) 5–14. [15] C.L. Andersen, A. Wandall, E. Kjeldsen, C. Mielke, J. Koch, Active, but not inactive, human centromeres display topoisomerase II activity in vivo, Chromosome Res. 10 (4) (2002) 305–312. [16] M.O. Christensen, M.K. Larsen, H.U. Barthelmes, R. Hock, C.L. Andersen, E. Kjeldsen, B.R. Knudsen, O. Westergaard, C. Mielke, Dynamics of human DNA topoisomerase IIa and IIb in living cells, J. Cell Biol. 157 (2002) 31–44. [17] P.A. Tavormina, M.G. Coˆme, J.R. Hudson, Y.Y. Mo, W.T. Beck, G.J. Gorbsky, Rapid exchange of mammalian topoisomerase II alpha at kinetochores and chromosome arms in mitosis, J. Cell Biol. 158 (2002) 23–29. [18] T. Khelifa, W.T. Beck, Merbarone, a catalytic inhibitor of DNA topoisomerase II, induces apoptosis in CEM cells through activation of ICE/CED-3-like protease, Mol. Pharmacol. 55 (1999) 548–556. [19] K.N. Meyer, E. Kjeldsen, T. Straub, B.R. Knudsen, I.D. Hickson, A. Kikuchi, H. Kreipe, F. Boege, Cell cycle-coupled relocation of types I and II topoisomerases and modulation of catalytic enzyme activities, J. Cell Biol. 136 (1997) 775–788. [20] Y.Y. Mo, W.T. Beck, Association of human DNA topoisomerase IIa with mitotic chromosomes in mammalian cells in independent of its catalytic activity, Exp. Cell Res. 252 (1999) 50–62. [21] T. Kanbe, K. Yamaki, A. Kikuchi, Identification of the pathogenic Aspergillus species by nested PCR using a mixture of specific primers to DNA topoisomerase II gene, Microbiol. Immunol. 46 (2002) 841–848. [22] K.H. Kim, T. Akashi, I. Mizuguchi, A. Kikuchi, Cloning and characterization of the gene encoding Aspergillus nidulans DNA topoisomerase II, Gene. 236 (1999) 293–301.
332
M. Kawagishi et al. / Biochemical and Biophysical Research Communications 334 (2005) 324–332
[23] K.H. Kim, T. Kanbe, T. Akashi, I. Mizuguchi, A. Kikuchi, Identification of a single nuclear localization signal in the Cterminal domain of an Aspergillus DNA topoisomerase II, Mol. Gen. Genet. 268 (2002) 287–297. [24] J.R. Aist, N.R. Morris, Mitosis in filamentous fungi: how we got where we are, Fungal Genet. Biol. 27 (1999) 1–25. [25] N.L. Prigozhina, C.E. Oakley, A.M. Lewis, T. Nayak, S.A. Osmani, B.R. Oakler, c-Tubulin plays an essential role in the coordination of mitotic events, Mol. Biol. Cell 15 (2004) 1374– 1386. [26] W. Su, S. Li, B.R. Oakley, X. Xiang, Dual-color imaging of nuclear division and mitotic spindle elongation in live cells of Aspergillus nidulans, Eukaryot. Cell 3 (2004) 553– 556. [27] C.F. Robinow, C.E. Caten, Mitosis in Aspergillus nidulans, J. Cell Sci. 5 (1969) 403–431. ´ balos, H. Fox, C. Pitt, B. Wells, J.H. Doonan, [28] J.M. Ferna´ndez-A Plant-adapted green fluorescent protein is a versatile vital reporter for gene expression, protein localization and mitosis in the filamentous fungus, Aspergillus nidulans, Mol. Microbiol. 27 (1998) 121–130.
[29] D.J. Cove, The induction and repression of nitrate reductase in the fungus Aspergillus nidulans, Biochim. Biophys. Acta 113 (1966) 51–56. [30] M.K. Jung, G.S. May, B.R. Oakley, Mitosis in wild-type and btubulin mutant strains of Aspergillus nidulans, Fungal Genet. Biol. 24 (1998) 146–160. [31] A.P. Null, J. Hudson, G.J. Gorbsky, Both alpha and beta isoforms of mammalian DNA topoisomerase II associate with chromosomes in mitosis, Cell Growth Differ. 13 (2002) 325–333. [32] H. Tatebe, G. Goshima, K. Takeda, T. Nakagawa, K. Kinoshita, M. Yanagida, Fission yeast living mitosis visualized by GFPtagged gene products, Micron 32 (2001) 67–74. [33] P.A. Wigge, J.V. Kilmartin, The Ndc80p complex from Saccharomyces cerevisiae contains conserved centromere components and has a function in chromosome segregation, J. Cell Biol. 152 (2001) 349–360. [34] L. Yang, L. Ukil, A. Osmani, F. Nahm, J. Davies, C.P.C.D. Souza, X. Dou, A. Perez-Balaguer, S.A. Osmani, Rapid production of gene replacement constructs and generation of a green fluorescent protein-tagged centromeric marker in Aspergillus nidulans, Eukaryot. Cell 3 (2004) 1359–1362.