Dynamics of interferon-specific gene expression in peripheral blood of interferon alfa-naïve patients with genotype 1 chronic hepatitis C infection treated with albumin-interferon alfa

Hepatology Research 35 (2006) 256–262

Dynamics of interferon-specific gene expression in peripheral blood of interferon alfa-na¨ıve patients with genotype 1 chronic hepatitis C infection treated with albumin-interferon alfa Vincent G. Bain a,∗ , Eric M. Yoshida b , Kelly D. Kaita c , Mark G. Swain d , E. Jenny Heathcote e , Andy Garcia f , Paul A. Moore f , Ren Yu f , John G. McHutchison g , G. Mani Subramanian f,∗ a

University of Alberta, Edmonton, Canada University of British Columbia, Vancouver, Canada c University of Manitoba, Winnipeg, Canada d University of Calgary, Calgary, Canada e University of Toronto, Toronto, Canada Human Genome Sciences, Inc., Rockville, MD, United States Duke Clinical Research Institute, Durham, NC, United States b

f g

Received 30 January 2006; received in revised form 14 April 2006; accepted 21 April 2006 Available online 30 May 2006

Abstract Albumin-interferon alfa (alb-IFN) is a novel recombinant protein derived from IFN␣-2b genetically fused to human albumin, which combines in a single polypeptide the antiviral properties of IFN␣ with the long serum half-life of albumin. Interferon alfa (IFN␣) mediated biological responses stem from the engagement of IFN␣ with its target receptor and subsequent modulation of interferon-specific gene (ISG) expression. The dynamics of ISG expression were evaluated in a Phase 2a study conducted in IFN␣ na¨ıve patients with genotype 1 chronic hepatitis C (CHC) treated with alb-IFN. Whole blood was obtained pre-dose and on days 7 and 28 from 47 patients enrolled to receive two subcutaneous injections of alb-IFN 14 days apart in five dose cohorts ranging from 200 to1200 ␮g. Gene expression of nine candidate genes including four ISGs was determined by a TaqMan Real-time PCR assay. There was sustained >5-fold median induction on days 7 and 28 of the ISG’s- OAS1, IRF7, IFI44 and IFI27. While all subjects showed a molecular response to alb-IFN, individual variability in pre-treatment gene expression levels and fold of modulation during treatment was observed. At days 7 and 28, induction of OAS1, IFI44 and IRF7 showed significant pair-wise correlation in individual patients (r > 0.7 and P < 0.001). There was no correlation of baseline expression or induction of gene expression with antiviral response. In conclusion, alb-IFN demonstrated robust induction of ISG that was consistent with the molecular response associated with an IFN␣. © 2006 Elsevier Ireland Ltd. All rights reserved. Keywords: Albumin-interferon alfa; TaqMan PCR; Interferon-specific gene

1. Introduction The type-1 interferons including interferon alfa (IFN␣) mediate their immunomodulatory and antiviral actions by ∗

Corresponding authors. Tel.: +1 301 315 2771; fax: +1 301 279 8799. E-mail addresses: [email protected] (V.G. Bain), mani [email protected] (G.M. Subramanian). 1386-6346/$ – see front matter © 2006 Elsevier Ireland Ltd. All rights reserved. doi:10.1016/j.hepres.2006.04.005

triggering a complex cascade of gene expression. IFN␣ has potent antiviral activity but does not act directly on the virus or replication complex. Instead, it induces IFNspecific genes (ISGs), which establish a non-specific antiviral state within the cell [1,2]. Several recent studies have examined the modulation of ISG expression in peripheral blood in patients being treated with IFN␣ containing regimens [3–5].

V.G. Bain et al. / Hepatology Research 35 (2006) 256–262

Albumin-interferon alfa (alb-IFN) is a novel recombinant protein translated from a gene produced from the fusion of the human genes for human serum albumin (HSA) and IFN␣-2b. The resulting 85.7 kDa polypeptide is a single molecule that combines the antiviral properties of IFN␣ with the long serum half-life of albumin. In non human primates, significant increases in the ISG, 2 ,5 -oligoadenylate synthetase (OAS1) mRNA relative to IFN␣ or vehicle-treated animals were maintained for ≥10 days after one subcutaneous dose of alb-IFN [6]. In a sequential, dose ranging Phase 1/2 study of alb-IFN in patients with chronic hepatitis C (CHC) who had failed prior IFN␣ therapy, alb-IFN demonstrated a favorable safety profile at doses of up to 900 ␮g, an extended half-life of approximately 6 days and evidence of dose-dependent antiviral activity in this treatment refractory CHC population [7]. Furthermore, in a Phase 2a dose-ranging study in IFN-alfa-na¨ıve CHC patients with HCV genotype 1, alb-IFN was well tolerated at doses ranging from 200 to 1200 ␮g administered at 14-day intervals [8]. A significant proportion of patients achieved a ≥2log10 IU/mL reduction in HCV RNA at week 4: 69% in the higher dose cohorts (900 and 1200 ␮g cohorts) and 40% in the lower doses (200–670 ␮g cohorts) [8]. Thus, alb-IFN has the potential to reduce dosing frequency and may improve the efficacy and tolerability compared with conventional IFN therapies. Previous cDNA array analysis of gene expression in whole blood obtained from CHC patients receiving pegylated IFN or alb-IFN therapy identified several genes that were characteristically induced or repressed on days 7 and 28 compared to pre-treatment levels [5]. These include genes that are prominently up regulated and include representatives of ISGs, such as OAS1, IFI27, IFI44 and IRF7 [3,4]. Granulysin, TR5 and IL20 receptor (beta sub-unit) are immune response genes that tend towards down regulation by day 28. ALDH6A1 and CDC2 are examples of genes that do not show significant modulation following interferon therapy. Here, we evaluated the dynamics of ISG induction in CHC subjects enrolled to receive alb-IFN (200–1200 ␮g) in the dose ranging Phase 2a study in an IFN na¨ıve population with genotype 1 HCV. The objectives were to assess the modulation of ISG expression at days 7 and 28, the correlation in individual patients of ISG induction, and to determine if any correlation exists between viral load change to alb-IFN and gene expression responses.

2. Methods 2.1. Study design This was a Phase 2, open-label, randomized, parallel design, dose ranging, multicenter study performed at five centers in Canada [8]. Patients with genotype 1 chronic hepatitis C infection and who were na¨ıve to IFN␣ therapy were enrolled in the three dose cohorts (200, 450 and 670 ␮g)

257

to receive two subcutaneous injections of Alb-IFN administered 14 days apart. No ribavirin was administered. At day 42 at study completion, patients were encouraged to transition to standard of care pegylated IFN therapy. Following review of safety and antiviral response, two additional dose cohorts (900 and 1200 ␮g) were evaluated. Study enrollment was stratified based on serum HCV concentration (≤800,000 or >800,000 IU/mL) and BMI (<25 or ≥25 kg/m2 ). Whole blood was collected pre-dose at days 0, 7 and 28 for assessment of gene expression. While a total of 56 patients were enrolled in the study, blood samples from 47 patients were available for assessment of gene expression. The Institutional Review Boards of participating centers approved the protocol and all amendments. All patients provided written informed consent. 2.2. RNA isolation Whole blood (approximately 5 mL) was drawn into a PAXgene Blood RNA tube (Qiagen Cat# 762115) and RNA isolated using the PAXgene blood RNA kit (Qiagen Cat# 762134) and eluted in about 80 ␮L of elution buffer. RNA was quantified using the Beckman DU640 UV spectrophotometer. RNA yields range from 1.5 to 7 ␮g of total RNA. 2.3. Real-time Taqman PCR Quantitative one-step Real-time PCR (RT-PCR) using ABI’s Taqman 7700 machine was performed using the following Taqman probes: OAS1

Primer 1: CTTTGATGCCCTGGGTCAGT Primer 2: TCGGTGCACTCCTCGATGA Probe: TGGCAGCTATAAACCTAACCCCCAAATCTATGTC

IFI27

Primer 1: TGGCCAGGATTGCTACAGTTG Primer 2: GTGAAGCCCATGGCACTGA Probe: ATGGGCACAGCCACAACTCCTCCAAT

TR5

Primer 1: CCAACGCTTCCAACAATGAA Primer 2: CTGGTCATGGTGCAGGAACTT Probe: CTTGCTTCCCATGTACAGTTTGTAAATCAGATCAA

18s

Primer 1: CGGCTACCACATCCAAGGAA Primer 2: GCTGGAATTACCGCGGCT Probe: TGCTGGCACCAGACTTGCCCTC

IRF7, IFI44, Granulysin, IL20Rbeta, ALDH6A1 and CDC2 probes were obtained from ABI’s Assay-on-Demand Catalogue. Data for each gene was normalized to 18s with the normalized value referred to as an “expression ratio”. The expression ratio is the number of copies of the target gene there are for each copy of the normalizing gene, in this case 18s. 2.4. HCV RNA concentrations HCV RNA concentrations were determined by the HCV QuantasureTM Plus kit using TaqMan® technology and

258

V.G. Bain et al. / Hepatology Research 35 (2006) 256–262

Table 1 Baseline characteristics by treatment group 200 ␮g (N = 10)

450 ␮g (N = 10)

670 ␮g (N = 10)

900 ␮g (a N = 8)

1200 ␮g (a N = 9)

Sex Male Female

8 (80.0%) 2 (20.0%)

7 (70.0%) 3 (30.0%)

7 (70.0%) 3 (30.0%)

3 (37.5%) 5 (62.5%)

7 (77.8%) 2 (22.2%)

Age (years) Mean ± S.D. Median (min, max)

49.3 ± 5.7 48.5 (43, 64)

47.5 ± 8.4 49.0 (31, 59)

45.7 ± 4.4 46.5 (38, 51)

49.4 ± 4.0 49.0 (43, 56)

47.4 ± 6.7 45.0 (40, 58)

BMI (kg/m2 ) Mean ± S.D. Median (min, max) <25 ≥25

29.7 ± 6.6 28.7 (23.4, 43.7) 2 (20.0%) 8 (80.0%)

27.8 ± 4.3 27.6 (20.8, 33.8) 2 (20.0%) 8 (80.0%)

27.3 ± 4.2 28.1 (20.1, 34.5) 3 (30.0%) 7 (70.0%)

27.5 ± 6.3 27.7 (17.9, 36.6) 4 (50.0%) 4 (50.0%)

29.1 ± 6.4 29.3 (19.9, 38.8) 3 (33.3%) 6 (66.7%)

HCV RNA (log10 IU/mL) Mean ± S.D. Median

6.5 ± 1.0 6.7 (3.8, 7.5)

6.7 ± 1.0 6.8 (4.4, 7.7)

6.8 ± 0.6 6.8 (6.1, 7.8)

7.1 ± 0.7 6.7 (6.4, 8.0)

6.8 ± 0.7 7.0 (5.9, 7.6)

a

Samples for ISG expression were obtained from 8 and 9 patients only, though 12 and 14 patients were enrolled and dosed, respectively in the 900 and 1200 ␮g cohorts.

Labcorp, Inc. (Research Triangle Park, NJ) performed the assays. 2.5. Statistical analysis Patient baseline characteristics and gene expression profiles were summarized using descriptive statistics. Correlation analysis was performed to assess the association between ISG expression induction and HCV RNA reduction at day 28. Linear regression model was used to reveal the effect of baseline gene expression on HCV RNA reduction. All statistical tests were two-sided and performed at a significance level of 0.05. All statistical analyses were performed using SAS (SAS Institute), and the R statistical package (The R Foundation for Statistical Computing).

3. Results Patient demographics were comparable for the subjects enrolled in the five treatment groups as shown in Table 1. These are representative of the genotype 1 CHC population in Canada, with 70% male, mean BMI of 28 kg/m2 , and 93% had high baseline HCV RNA of >800,000 IU/mL. The 900 ␮g treatment group had a higher proportion of females compared to other groups. There were no significant differences in baseline demographics across the five treatment groups. Real-time PCR was performed on RNA extracted from peripheral blood to assess pre-treatment levels and the induction of gene expression over baseline at days 7 and 28 as shown in Table 2 and Fig. 1. A greater than five-fold (median) up regulation over baseline levels was observed on days 7

Fig. 1. Gene expression in whole blood on days 7 and 28 relative to baseline. Median fold change in expression of 4 ISGs (OAS1, IFI27, IFI44 and IRF7) and TR5, granulysin, IL20b, CDC2 and ALDH6A1 are shown.

V.G. Bain et al. / Hepatology Research 35 (2006) 256–262

259

Table 2 Summary of gene expression at baseline and modulation on days 7 and 28 relative to baseline Gene

a Baseline

IFI27 Mean ± S.D. Median (min, max)

(×10−6 )

Day 7 fold induction over baseline

Day 28 fold induction over baseline

2.829 ± 7.8 0.6 (0.0, 50.6)

921.6 ± 1837.0 122.8 (1.5, 6517.0)

2050 ± 6003.4 198.7 (2.0, 35858)

OAS1 Mean ± S.D. Median (min, max)

838.3 ± 1212.2 370.0 (46.6, 4742.9)

12.55 ± 9.3 10.8 (1.4, 43.4)

13.50 ± 19.3 10.5 (1.0, 129.8)

IFI44 Mean ± S.D. Median (min, max)

569.9 ± 1016.1 192.9 (20.0, 5373.2)

21.28 ± 19.8 14.5 (2.5, 77.2)

26.20 ± 30.2 16.6 (1.3, 160.9)

IRF7 Mean ± S.D. Median (min, max)

163.9 ± 148.9 93.8 (10.8, 662.4)

7.210 ± 3.7 7.1 (1.9, 20.5)

8.939 ± 7.9 6.6 (1.6, 42.8)

TR5 Mean ± S.D. Median (min, max)

8153 ± 5922.2 7139 (1362.1, 37163)

1.063 ± 0.7 0.8 (0.1, 4.0)

1.155 ± 0.9 0.9 (0.2, 4.3)

Granulysin Mean ± S.D. Median (min, max)

5189 ± 6767.0 2705 (105.5, 31250)

3.298 ± 3.1 2.3 (0.4, 17.1)

3.210 ± 4.6 1.7 (0.3, 29.2)

IL20Rb Mean ± S.D. Median (min, max)

1.399 ± 1.3 1.0 (0.0, 6.6)

3.453 ± 7.5 2.2 (0.2, 50.2)

6.018 ± 17.7 1.5 (0.2, 117.0)

ALDH6A1 Mean ± S.D. Median (min, max)

36.12 ± 31.1 25.5 (0.0, 161.1)

13.25 ± 75.2 1.3 (0.1, 494.6)

5.783 ± 28.2 1.3 (0.3, 192.7)

CDC2 Mean ± S.D. Median (min, max)

13.33 ± 22.3 7.9 (1.0, 142.2)

2.580 ± 2.8 1.6 (0.2, 13.7)

4.905 ± 10.1 2.6 (0.3, 67.2)

a

Data for each gene was normalized to 18s RNA and depicted as the number of copies of the target for each copy of the 18s gene.

Fig. 2. ISG (OAS1, IFI27, IFI44, IRF7) median fold change in expression on days 7 and 28 relative to baseline in each of the 5 alb-IFN treatment groups.

260

V.G. Bain et al. / Hepatology Research 35 (2006) 256–262

Table 3 Pair-wise correlation of ISG induction on days 7 and 28 ISG pair-wise comparisons

Day 7 induction Spearman’s r (P-value)

Day 28 induction Spearman’s r (P-value)

OAS1-IFI44 OAS1-IFI27 OAS1-IRF7 IFI44-IFI27 IFI44-IRF7 IFI27-IRF7

0.8143 (<0.001)* 0.5449 (<0.001) 0.8034 (<0.001)* 0.5065 (<0.001) 0.7307(<0.001)* 0.4690 (0.0017)

0.8261 (<0.001)* 0.6412 (<0.001) 0.7779 (<0.001)* 0.5536 (<0.001) 0.7016 (<0.001)* 0.4252 (<0.001)

*

Individual patient data shown in Fig. 3.

and 28 for all the ISGs (OAS1, IFI44, IFI27 and IRF7). In particular, IFI27 showed >100-fold induction with a continued increase in gene expression levels between days 7 and 28. The baseline levels of expression vary significantly for each of the ISGs with IFI27 having the lowest levels of pretreatment expression as shown in Table 2. The magnitude of ISG induction on days 7 and 28 in each of the five treatment groups was similar as shown in Fig. 2. No dose-response was observed for any of the ISGs evaluated. Moreover, there was no correlation of baseline expression or fold induction with gender or BMI (data not shown). Gene expressions for the non-ISGs are also shown in Table 2 and Fig. 1. TR5 expression showed high levels of expression at baseline and showed some down regulation on days 7 and 28. Both granulysin and IL20b expression showed modest up regulation (approximately two-fold over baseline) on days 7 and 28. To further explore if ISG induction was correlated in individual patients, pair-wise analysis of ISG induction on days 7 and 28 was performed, as summarized in Table 3. This approach is helpful in identifying components of molecular pathways, wherein the coordinated induction of genes is often suggestive of involvement in a common molecular pathway of signal transduction. All the ISG pairs showed significant (P < 0.01) pair-wise correlation of induction on days 7 and 28, respectively. The correlation of ISG induction in individual patients was most robust for the ISG pairs OAS1-IFI44, OAS1-IRF7 and IRF7-IFI44 (P < 0.001, r > 0.7) on both days 7 and 28 as shown in Fig. 3. As shown in Table 4, robust antiviral response was observed with a mean HCV RNA reduction of 2.38 log10 IU/mL at day 28 and 49% of patients achieved a ≥2log10 IU/mL reduction in HCV RNA at day 28. Correlation analysis was performed in subjects between the levels of gene induction on day 7 or 28 and the HCV RNA reduction in response to alb-IFN treatment. Also, a linear regression model was used to explore the relationship of baseline gene expression with HCV RNA reduction on day 7 or 28. There was a lack of correlation of ISG induction on day 28 with

HCV RNA reduction as shown in Table 4. Also, no correlation was observed with pre-treatment levels of expression with HCV RNA reduction at day 7 or 28 (data not shown).

4. Discussion Interferons exert their biological activities by binding to a heterodimeric receptor. The binding of the receptor by type I interferons activates the JAK-STAT signaling pathway which initiates a transcription complex to induce the expression of the downstream target genes, referred to as interferon-specific genes (ISG) [1,2]. ISGs are the genetic effectors of the host response to virus infection, and the human genome encodes hundreds of ISGs [8]. Previous reports have examined induction of gene expression by IFN␣ [3–5] and the effects of IFN␣-induced target genes on anti-HCV activity [2,10,11]. Alb-IFN is a novel recombinant protein produced by a genetic fusion of HSA and IFN␣-2b. The extended half-life of alb-IFN supports dosing once every 2 or 4 weeks, and the longer therapeutic activity might potentially improve the agent’s efficacy and tolerability compared to conventional IFN therapies [7,8]. The pharmacodynamics of alb-IFN has been explored in two studies conducted in IFN␣ experienced and na¨ıve patient populations, respectively. The Phase 1/2 study conducted in patients who had failed prior IFN␣ regimens showed that alb-IFN induces ISG expression and that induction is maintained for up to 28 days following a single injection [5,7]. In this study conducted in an IFN␣ na¨ıve, genotype 1 CHC patient population we have demonstrated robust induction of ISG following the administration of two injections of alb-IFN. The lack of dose-response observed in this study comparing the six-fold dose range of 200 to 1200 ␮g is not surprising. It is likely that maximal activation of the transcriptional pathway as assessed by the candidate ISGs chosen is achieved at the lowest dose evaluated. Moreover, the correlation of specific ISG expression in individual subjects for OAS1, IFI44 and IRF7 is indicative of coordinated regulation and suggests their involvement in a common interferon regulatory pathway in vivo. The candidate ISGs chosen for evaluation included genes, such as OAS1 which have been postulated to show direct antiviral activity, and IRF7, that promotes IFN subtype expression and diversification of the ISG response, establishing a positive-feedback loop that amplifies IFN production and antiviral action [9,12]. IFN␣ modulates the expression of a number of genes with antiviral activities and several studies have explored correlations of expression and genetic polymorphisms with antiviral activity [2,3,13]. Of note, a recent study explored

Table 4 HCV RNA reduction at day 28 and induction in ISGs at day 28 HCV RNA reduction at day 28 (log10 IU/mL) Mean ± S.D. (2.38 ± 1.89)

Correlation with day 28 induction in ISGs Spearman’ r (P-value) IFI27

IFI44

OAS1

IRF7

0.1151 (0.4446)

−0.0636 (0.6737)

0.0405 (0.7884)

0.0194 (0.8976)

V.G. Bain et al. / Hepatology Research 35 (2006) 256–262

261

Fig. 3. Representative examples of significant pair-wise correlation of ISG induction at days 7 and 28. The following ISG pairs: OAS1-IRF7, OAS1-IFI44, IRF7-IFI44 showed a significant (r > 0.7 and P < 0.001) correlation on both days 7 and 28.

hepatic gene expression profiling to investigate the molecular basis for treatment failure and identified a specific set of IFN-responsive genes that predicted nonresponse to standard therapy with pegylated interferon [14]. In this study that examined gene expression in peripheral blood, we did not observe significant correlation of pre-treatment levels or induction of ISG expression with antiviral response at day 28. This could be reflective of differences in the predictive value of gene expression when assessed in liver tissue versus the

peripheral blood compartment. In this study, different ISGs were evaluated, and though they provide robust evidence of the pharmacodynamic effects of alb-IFN, they do not appear to be good predictors of early antiviral response. The main objective of this Phase 2a study was to establish the in vivo effects of alb-IFN and hence ISG expression was studied in whole blood that comprises a heterogeneous cell population containing polymorphonuclear cells, lymphocytes and monocytes. It is therefore likely that the changes

262

V.G. Bain et al. / Hepatology Research 35 (2006) 256–262

in gene expression observed in this study are reflective of the changes in some or all of these subpopulations. Further studies are needed to define expression patterns of these genes in these subpopulations of cells. Finally, while the time points of days 7 and 28 are reflective of the early events during therapy, it would be important to extend these correlations with clinical endpoints of sustained virologic response (24 weeks after completion of treatment) in a larger patient population and in the context of ongoing Phase 2 studies with alb-IFN. In conclusion, this study demonstrated that treatment with alb-IFN induces significant increase in expression of all ISGs studied on days 7 and 28, all the ISG pairs exhibited significant pair-wise correlation, and that there was a lack of correlation of expression of ISG with reduction in HCV RNA level in an IFN na¨ıve genotype 1 infected chronic HCV population.

References [1] Tilg H. New insights into the mechanisms of interferon alfa: an immunoregulatory and anti-inflammatory cytokine. Gastroenterology 1997;112:1017–21. [2] Feld JJ, Hoofnagle JH. Mechanism of action of interferon and ribavirin in treatment of hepatitis C. Nature 2005;436:967–72. [3] Ji X, Cheung R, Cooper S, et al. Interferon alfa regulated gene expression in patients initiating interferon treatment for chronic hepatitis C. Hepatology 2003;37:610–21. [4] Taylor MW, Grosse WM, Schaley JE, et al. Global effect of PEGIFN-␣ and ribavirin on gene expression in PBMC in vitro. J Interferon Cytokine Res 2004;24:107–18.

[5] Balan V, Nelson D, Sulkowski M, et al. Molecular profiles of drug response in HCV infected patients during the first 4 weeks of therapy for chronic hepatitis C virus with pegylated interferon containing regimens or Albuferon. Hepatology 2003;38(Suppl. 1:630A) [Abstract 984]. [6] Osborn BL, Olsen HS, Nardelli B, et al. Pharmacokinetic and pharmacodynamic studies of a human serum albumin-interferon␣ fusion protein in cynomolgus monkeys. J Pharmacol Exp Ther 2002;303(2):540–8. [7] Balan V, Sulkowski M, Nelson D, et al. A Phase I/II study evaluating escalating doses of recombinant human albumin-interferon-alpha fusion protein in chronic hepatitis C patients who have failed previous interferon-alpha-based therapy. Antivir Ther 2006;11(1):35–45. [8] Bain VG, Kaita KD, Yoshida EM, et al. A phase 2 study to evaluate the antiviral activity, safety, and pharmacokinetics of recombinant human albumin-interferon alfa fusion protein in genotype 1 chronic hepatitis C patients. J Hepatol 2006;44(4):671–8. [9] Der SD, Zhou A, Williams BRG, et al. Identification of genes differentially regulated by interferon or using oligonucleotide arrays. Proc Natl Acad Sci USA 1998;95:15623–8. [10] Hayashi J, Stoyanova R, Seeger C. The transcriptome of HCV replicon expressing cell lines in the presence of alpha interferon. Virology 2005;335(2):264–75. [11] Zhu H, Zhao H, Collins CD, et al. Gene expression associated with interferon alfa antiviral activity in an HCV replicon cell line. Hepatology 2003;37(5):1180–8. [12] Honda K, Yanai H, Negishi H, et al. IRF-7 is the master regulator of type-I interferon-dependent immune responses. Nature 2005;435:772–7. [13] Knapp S, Yee LJ, Frodsham AJ, et al. Polymorphisms in interferoninduced genes and the outcome of hepatitis C virus infection: roles of MxA, OAS-1 and PKR. Genes Immun 2003;4(6):411–9. [14] Chen L, Borozan I, Feld J, et al. Hepatic gene expression discriminates responders and nonresponders in treatment of chronic hepatitis C viral infection. Gastroenterology 2005;128(5):1437–44.