- Email: [email protected]
Early life stage rainbow trout (Oncorhynchus mykiss) mortalities due to Flavobacterium columnare in Idaho, USA
Aquaculture 418–419 (2014) 126–131
Contents lists available at ScienceDirect
Aquaculture journal homepage: www.elsevier.com/locate/aqua-online
Early life stage rainbow trout (Oncorhynchus mykiss) mortalities due to Flavobacterium columnare in Idaho, USA Jason P. Evenhuis a,⁎, Scott E. LaPatra b, David Marancik a a b
USDA-ARS, National Center for Cool and Cold Water Aquaculture, 11861 Leetown Rd, Kearneysville, WV 25430, USA Clear Springs Foods, Inc., Research Division, Buhl, ID 83316, USA
a r t i c l e
i n f o
Article history: Received 20 September 2013 Received in revised form 24 September 2013 Accepted 25 September 2013 Available online 2 October 2013 Keywords: Yersinia ruckeri Genomovar 16S rRNA Bacterial challenge
a b s t r a c t Flavobacterium columnare is the etiologic agent of columnaris disease, a pervasive disease of fresh water finfish. During the past 4 years, losses that ranged from 5 to 50% in rainbow trout (Oncorhynchus mykiss) fry being reared at a constant 14.5 °C (mean weight, 0.2 g; ~400°days post-fertilization), have been occurring in Hagerman Valley, Idaho, USA. A total of 70 different F. columnare isolates were obtained from diseased fish and the water they were reared in. All of the isolates were confirmed to be genomovar I by 16S rRNA restriction fragment length polymorphism. Sequencing of the 16S rRNA, 16S–23S rDNA spacer region and the gyrase B subunit genes from these 70 strains revealed no sequence differences among these isolates. Whole-cell protein profiling by SDSPAGE also indicated low variation between isolates. Virulence was assessed for a representative isolate and demonstrated a high degree of pathogenicity against rainbow trout fry at 15 °C. These results suggest the emergence of a highly successful F. columnare strain that can affect very early life stages of fish being reared at a constant 14.5 °C at a commercial rainbow trout farm in Idaho. Published by Elsevier B.V.
1. Introduction Flavobacterium columnare is the etiological agent for columnaris disease and is a Gram-negative, rod-shaped bacterium that forms rhizoid colonies on solid growth medium. Columnaris disease was first described by Davis (1922); the F. columnare bacteria was later isolated in 1944 (Ordal and Rucker, 1944). Columnaris disease is usually associated with external lesions on the skin and gills (Decostere et al., 1999; Noga, 2000; Thune, 1993) of fish being reared at warm water temperatures but can also be isolated from internal tissues (Hawke and Thune, 1992). Genetic variability between F. columnare isolates was demonstrated by Triyanto and Wakabayashi (1999) and three genomovar classifications were established based on the HaeIII restriction fragment length polymorphism (RFLP) of the 16S rRNA gene. Recent studies by LaFrentz et al. (accepted for publication) and Olivares-Fuster et al. (2007a, 2007b) have increased the number of subdivisions to include I-B, II-B and I/II genomovars by improving on the original RFLP assay. Host-specific association between genomovar and fish species was demonstrated in threadfin shad Dorosoma petenense (Olivares-Fuster et al., 2007a, 2007b) and salmonids (LaFrentz et al., 2012). To date, all but one isolate of F. columnare from rainbow trout (Oncorhynchus mykiss) have been classified as genomovar I. The one variation is a genomovar III isolate obtained from fish in Georgia (LaFrentz et al., accepted for publication).
⁎ Corresponding author. Tel.: +1 304 724 8340x2135; fax: +1 304 725 0351. E-mail address: [email protected] (J.P. Evenhuis). 0044-8486/$ – see front matter. Published by Elsevier B.V. http://dx.doi.org/10.1016/j.aquaculture.2013.09.044
Columnaris disease is a major problem for the U.S. channel catfish aquaculture industry with losses up to $30 million annually (Declercq et al., 2013; Shoemaker et al., 2008) where water temperatures are typically N 25 °C. Worldwide salmon and rainbow trout aquaculture industries have also experienced outbreaks of columnaris disease in former Czechoslovakia (Rehulka and Mraz, 1982), Turkey (Kubilay et al., 2008) and Finland (Suomalainen et al., 2005). The outbreak in Turkey reported up to 30% losses in a single day for trout ranging from 5 to 10 g, while the outbreak in former Czechoslovakia reported 24% losses. Both outbreaks occurred during the summer months where water temperatures ranged from 9.8 °C to 16.2 °C. Recently, LaFrentz et al. (2012) have suggested that F. columnare may be an emerging problem for the U.S. Idaho rainbow trout aquaculture industry. The outbreak described herein has persisted over the past 4 years in a rainbow trout early life stage rearing facility in the Hagerman Valley, Idaho, USA, in small fish being reared at a constant 14.5 °C. We report the proteomic, genomic and virulence characteristics of the F. columnare isolates associated with this outbreak.
2. Method and materials 2.1. Facility and histology The early life stage rearing facility is an enclosed and covered facility on natural photoperiod with single use, flow-through spring water at a constant temperature of 14.5 °C. Groups were maintained at approximately 200,000 fish per raceway from alevins to a final weight of ~4 g
J.P. Evenhuis et al. / Aquaculture 418–419 (2014) 126–131
(~1200°days). Fish were hand fed a standard rainbow trout fry feed (Clear Springs Foods, Inc.), 3–5% of body weight, daily. Histopathology was performed on six 1–2 g commercial rainbow trout associated with a natural outbreak of F. columnaris. Fish were euthanized with 250 mg/ml MS-222 and placed in 10% neutral buffered formalin (Fisher-Scientific) for 72 h prior to being placed in decalcification solution (Cal-Rite, Thermo-Scientific) for 8 h. Fish were serially sectioned and tissues were processed routinely, embedded in paraffin, sectioned at 5 μm, and stained with hematoxylin and eosin (H&E).
127
40% methanol and 10% acetic acid wash buffer to remove unbound stain. An additional spleen isolate (FC-CSF-24) was used for this comparison. 2.5. Sequencing of the 16S, 16S–23S spacer region and the Gyrase B genes
A total of 70 F. columnare isolates were obtained from several tissues of moribund fish, as small as 0.2 g, including kidney (18), gill (7), skin (7), spleen (15) and brain (9) and water (14) the fish were being reared in. Tissues were sampled aseptically and plated on Shieh medium (Decostere et al., 1997), tryptone yeast extract salts (TYES) agar (Holt et al., 1994) with and without 1 μg ml−1 of tobramycin and incubated overnight at 30 °C. Four isolates, from water (FC-CSF-1), kidney tissue (FC-CSF-9), and two from gill tissue (FC-CSF-58 and CSF298-10) as well as genomovar controls were used for comparisons.
The 16S rRNA gene was sequenced from the PCR product used to determine genomovar classification. Primers for the 16S–23S rDNA spacer, ColF3a and ColR3a (Table 1) were taken from Darwish and Ismaiel (2005), while primers for the Gyrase B subunit (GyrB_F and GyrB_R), were generated against the published ATCC23463 genome (Tekedar et al., 2012). The thermocycle program was the same as previously described. Confirmation of the PCR products, including control genomovar I, II, and III products, was determined by electrophoresis using 5 μl of PCR product added to a 1% TAE (w/v) agarose gel and visualized as previously described. Sequencing was performed using the Big Dye® Terminator v3.1 labeling kit (Applied Bioscience) and an ABI3100 DNA Analyzer (Applied Biosystems). Sequence alignments and analysis were performed on Sequencer 4.2 software and verified by manually visualizing sequence chromatographs.
2.3. Genomovar characterization
2.6. Bacterial immersion challenges
Genomovar classification was determined using the protocol established by Darwish and Ismaiel (2005). Briefly, the 16S rDNA gene was amplified from total genomic DNA using primer mix (UN-20 and R1438) (Table 1) at a final concentration of 200 μM, 45 μl of Platinum PCR SuperMix High Fidelity (Invitrogen) and 100 ng of DNA on a DNA engine thermocycler (Bio-Rad), with the thermocycle program including a 10 m initial 94 °C denaturing step, followed by 30 cycles at 94 °C, 55 °C annealing and 72 °C elongation: each step was 1 m in length. The RFLP profile was generated by digestion of the 16S rDNA product with the HaeIII restriction enzyme and by running the product on a tris–acetate–EDTA (TAE) + 1% (w/v) agarose gel cast with 1× SYBR Safe DNA gel stain (Invitrogen) and visualization by ultraviolet transillumination. Control genomic DNA for genomovars I (ATCC 23464), II (ALG-00-530) and III (ALM-05-53) (LaFrentz et al., accepted for publication; Shoemaker et al., 2008) were generously provided by Dr. Ben LaFrentz, USDA, Auburn, AL. Sequence alignments were determined by CLUSTALW (Thompson et al., 1997) analysis and phylogenetic trees were generated by neighbor-joining test using the MEGA v5.2 (Tamura et al., 2011).
Rainbow trout were acquired from Troutlodge, Inc., Sumner, Washington, USA, as specific-pathogen-free eyed eggs, and no apparent health problems were observed prior to being used in immersion challenges with F. columnare. All fish were challenged in 4 l tanks with ~ 15.8 °C water flowing at 0.5 l m− 1 and were allowed to acclimate for 7 days prior to challenge. The F. columnare strain, CSF289-10, a 2010 isolate from the head kidney of a diseased fish from the same facility, was used as the challenge strain. The immersion challenge protocol used was from LaFrentz et al. (2012). Challenge 1 included 0.3 g (~ 375°days post-hatch) fish that were immersion challenged at bacterial concentrations of ~ 5.6 × 105, 2.6 × 106 and 1.1 × 107 CFU ml− 1, and challenge 2 included 1.1 g (~ 650°days post-hatch) fish that were challenged at concentrations of ~ 2.3 × 106, 1.0 × 107 and 2.1 × 107 CFU ml− 1. Bacterial concentrations were estimated by direct plate counting of 10-fold serial dilutions of the challenge to determine total CFU. Mortalities were removed and recorded daily for 21 days. Survival graphs were produced using GraphPad 5 software.
2.2. Bacterial isolation and culture
3. Results 2.4. SDS-PAGE Differences in protein profiles were determined by SDS-PAGE on a Bio-Rad mini-gel system utilizing a 10% polyacrylimide gel. Briefly, 700 μl of suspended bacteria was taken from an overnight TYES culture and centrifuged at 8000 ×g for 20 m. Pellets were suspended in 100 μl of Lamelli sample buffer + β-2ME and heated for 10 m at 100 °C. A total of 10 μl of each sample were loaded in individual wells and gels were run for approximately 1 h at 100 V, followed by staining with a 0.1% w/v Coomassie Brilliant Blue R-250 for 1 h and de-stained with a
F. columnare was isolated from gill, brain, spleen and/or head kidney tissues of naturally infected diseased fish and the water the fish were being reared in. Mortality ranged between 5 and 50% in rainbow trout fry as small as 0.2 g. Signs of disease in moribund fish included rapid gill movement, dorsal (saddleback) erosive and ulcerative lesions (Supplemental Fig. 1), and changes in gill pigmentation. Histopathologic examination of six fish revealed multifocal and locally extensive loss of epithelium of the dorsal and lateral integument and/or mucosa of the oral cavity (Supplemental Fig. 1). In one fish, there was additional
Table 1 Primers, approximate nucleotide length, percent identity and origin of the primers used for gene sequencing. Genes include the 16S rRNA, 16S–23S rDNA spacer region and the Gyrase B subunit. Gene
Length (bp)
% identity (between isolates)
FWD primer (5′–3′)
REV primer (5′–3′)
Origin
16S rRNA 16S–23S rDNA spacer Gyrase B subunit
1450 647 798
100 100 100
UN-20 AGAGTTTGATC(AC)TGGCTCAG ColF3a GGCTGGATCACCTCCTTTCTA GryB_F GTACGTATGCGTCCGTCCAT
R1438 GCCCTAGTTACCAGTTTTAC ColF3a CTAGGCATCCCCCATACGC GryB_R GTGTTCCTCCTTCGTGCGTA
Darwish and Ismaiel (2005) Darwish and Ismaiel (2005) This paper
128
J.P. Evenhuis et al. / Aquaculture 418–419 (2014) 126–131
and neutrophils but inflammatory infiltrates were largely absent. There were signs of systemic infection in three fish including splenic necrosis, granulomatous splenitis and mild to moderate granulomatous nephritis, suggesting septicemia 3.1. Isolate characterization
Fig. 1. The RFLP profile generated by 16S rRNA, HaeIII restriction-enzyme digested and resolved on a 1% TAE agarose gel. Five individual isolates (G = gill tissue, K = kidney tissue, W = water sample and C = CSF298-10) are a representation of all the isolates collected from this disease outbreak. M = 100 bp marker and the relative (bp) length, (*) = the stain that had an alternative protein banding pattern. All isolates from this facility are genomovar I based on this analysis.
multifocal loss of gill architecture and necrosis of gill filaments. Affected epithelium of the skin and oral mucosa were covered by mats of long, filamentous bacteria that infiltrated into the underlying tissue eliciting localized necrosis and degeneration of skeletal muscle (Supplemental Fig. 1). Bacteria were associated with scattered epithelial macrophages
A total of 70 individual isolates, 56 from tissues and 14 from water samples, were obtained from the early life stage rearing facility where the outbreaks were occurring. F. columnare was isolated from all fish tested and was the only bacteria isolated from internal organs, including the brain, kidney and spleen. Several individual trout accounted for multiple isolates that were obtained from different tissues. Isolates from water were only found on TYES and TYES + tobramycin agar. All samples were classified as genomovar I by the RFLP banding pattern regardless of the isolates origin (Fig. 1). Every isolate's protein banding pattern was characterized by SDSPAGE, though one isolate taken from gill tissue (the only isolate recovered from this fish) had a single banding pattern difference (Fig. 2). No other variations in protein banding patterns were observed among the isolates obtained from this rainbow trout early life stage rearing facility. 3.2. Sequencing of the 16S, Gyrase B subunit and the 16S–23S rDNA spacer The PCR products for the 16S rRNA, Gyrase B subunit and the 16S– 23S rDNA spacer region were generated using the proofreading Taq to increase sequence accuracy. Primers for the 16S and 16S–23S rDNA
Fig. 2. CLUSTALW alignments and neighbor-joining phylogenetic trees generated, by MegAlign v.4 software, to (A) 16S rRNA, (B) 16S–23S spacer region and (C) gyrase B. Idaho isolates are illustrated by brackets. The only differences found by sequencing and CLUSTALW analysis were between control genomovar I, II and III strains.
J.P. Evenhuis et al. / Aquaculture 418–419 (2014) 126–131
129
3.3. Challenges with CSF298-10 A single isolate, CSF298-10, was designated for virulence determination and used in all immersion challenges. Several bacterial concentrations were tested in rainbow trout with a mean body weight of approximately 0.3 g and 1.1 g to characterize the relative virulence of this bacterial strain and determine potential changes that occur in virulence due to the increase in fish size. Challenge 1 used trout that were 0.3 g in size with approximate bacterial concentrations of 5 × 105, 2.6 × 106 and 1.1 × 107 CFU ml−1. Survival for the 3 bacterial concentrations was ~65, 38 and 10%, respectively (Fig. 4A). Challenge 2 compared the virulence of this isolate in rainbow trout that were 1.1 g in size with approximate bacterial concentrations of 2.3 × 106, 1 × 107 and 2.1 × 107 CFU ml−1. Survivals for this challenge were ~77, 32 and 12%, respectively (Fig. 4B). Approximately 10% of the mortalities were sampled for spleen and head kidney tissues, and all samples were positive for the same strain of F. columnare. The strain was confirmed by colony morphology and sequencing of the 16S rRNA gene. 4. Discussion
Fig. 3. A 1 dimension 10% SDS-PAGE resolution of the total protein profile from 5 different isolates. A single band from a gill isolate, marked by (→), was the only banding pattern variation found out of 70 different isolates tested. The challenge strain CSF298-10 in included in the final lane.
spacer region give products of 1450 and 647 bp, respectively (Table 1). The Gyrase B subunit primers generated for this work resulted in a product 798 bp in length. All 70 isolates, including the challenge strain, were 100% identical for all three DNA segments tested which was confirmed by CLUSTALW alignments and illustrated by a neighbor-joining phylogenetic tree (Fig. 3). The only differences found by sequencing and CLUSTALW analysis were between control genomovar I, II and III strains. Thorough genetic comparisons between isolates from the early life stage rearing facility and those of other genomovars will be undertaken in future studies.
F. columnare is a significant disease problem for warm water aquaculture and has been known to cause mortalities in cool or cold water fish including salmonids. To our knowledge, no columnaris-specific disease has previously been reported in young stages of rainbow trout from Idaho, USA. Previous reports of F. columnare outbreaks in rainbow trout from Turkey (Kubilay et al., 2008) and Czechoslovakia (Rehulka and Mraz, 1982) occurred during months when the water increased in temperature. LaFrentz et al. (2012) describe F. columnare as a potential emerging rainbow trout disease. Herein we describe a persistent columnaris disease outbreak in early life stages of rainbow trout from the Hagerman Valley, Idaho, which has caused mortalities over several years regardless of the season. This may be due to the unique nature of this area as the water is at a constant temperature of ~14.5 °C. 4.1. Highly related genetic background The research presented here, including the sequencing of several genes and the protein banding pattern, indicated that the outbreak occurring at this facility is due to a highly related population of F. columnare. However, our current testing methods may not be sensitive enough to determine genetic variation between individual isolates of a highly related population. These results are interesting because previous work (Olivares-Fuster et al., 2007a, 2007b) has indicated variation between genomovar I isolates in the RFLP and SSCP banding patterns
Fig. 4. Survival curve graphs generated on GraphPad v.5 software. Challenge 1 was performed on fish that averaged 0.3 g/fish and challenge 2 was performed on fish that averaged 1.1 g/fish.
130
J.P. Evenhuis et al. / Aquaculture 418–419 (2014) 126–131
of the 16S rRNA and 16S–23S spacer region. Darwish and Ismaiel (2005) also showed variation between genomovar I isolates from similar geographic regions by 16S–23S rRNA RFLP. Phylogenetic analysis illustrates the lack of variation between the isolates taken from this facility and that they cluster separately from the control genomovar strains (Fig. 3). The lack of genetic variation for the three DNA sequences suggests that the outbreaks occurring in fish at this early life stage rearing facility are the result of the expansion of a highly related virulent strain of F. columnare. The single protein banding pattern variation supports the close relationship of all the isolates tested. Prior to this report, F. columnare was not a disease concern for all life stages at this facility. That this strain is highly related but not an obviously unique strain (genomovar I) suggests that this outbreak may be due to an environmental difference that has occurred either within the facility or to the water supply. An increase in water temperature would be the easiest explanation for the expansion of a bacterium that is associated with warm water disease but the unique nature of the Hagerman Valley, and a constant water temperature of ~ 14.5 °C, does not suggest that an increase in water temperature is responsible for this outbreak. An in depth investigation at the facility and the incoming water supply is needed to determine the source of F. columnare.
population of F. columnare. Further study is required to determine if all of the isolates are the expansion of a single clone. An isolate taken from the facility was shown to be, in a laboratory setting, highly virulent to small (0. 3 and 1.1 g) rainbow trout. The variation in fish size/age affected the susceptibility of rainbow trout in an immersion challenge. Whether this population of F. columnare has emerged from the water supply prior to entering the early life stage rearing facility, from a reservoir within the facility itself or from the mutation of a non-virulent to a virulent form of F. columnare, has yet to be determined. Supplementary data to this article can be found online at http://dx. doi.org/10.1016/j.aquaculture.2013.09.044.
Acknowledgments The authors thank Ryan Lipscomb and Travis Moreland for the expert technical assistance, and Mark L. Richardson and Tim Welch for the critical comments on the manuscript. Mention of trade names or commercial products in this publication is solely for the purpose of providing specific information and does not imply recommendation or endorsement by the United States Department of Agriculture. USDA is an equal opportunity provider and employer.
4.2. F. columnare challenge The CSF298-10 strain, which was isolated in 2010 from fish at this same facility, illustrates the persistence of this strain over several years. Achieving 35% mortality in 0.3 g rainbow trout at a concentration of only 5 × 105 CFU ml− 1 supports that this is a virulent strain in rainbow trout. This bacterial dose is less than a tenth of the concentration used by LaFrentz et al. (2012) to get a cumulative percent mortality (CPM) of approximately 50% for rainbow trout that had a mean weight of 0.7 g. When the dose was increased to 2.6 × 106 CFU ml− 1 the CSF298-10 strain mortality reached 62% in 0.3 g fish (Fig. 4A). When we challenged fish at 1.1 g in size at a concentration of 2.3 × 106 CFU ml− 1 only 25% cumulative mortality was observed. Greater than 4 times that bacterial concentration was needed to reach N 60% mortality in the 1.1 g (Fig. 4B) fish as compared to the 0.3 g fish. The F. columnare concentrations used here are comparable to other established immersion challenge protocols for various pathogens of rainbow trout including Yersinia ruckeri (Evenhuis and Cleveland, 2012; Raida and Buchmann, 2007; Wiens et al., 2006), Vibrio anguillarum (Rasch et al., 2004) which both used immersion concentrations between 107 and 108 CFU ml−1, or Aeromonas salmonicida (Mulder et al., 2007) which used a bacterial concentration of 105 but with a longer 24 h exposure. In these studies F. columnare challenge organism was grown at 30 °C because high bacterial concentrations could be reached in a relatively short amount of time. This is in sharp contrast to the water temperatures (below 16 °C) associated with the disease outbreaks or temperatures used for experimental challenges reported in this study. It should be noted that while the effect of this elevated pre-challenge growth temperature on F. columnare virulence is unknown it clearly does not prevent F. columnare from causing disease and mortalities in rainbow trout being held at much lower temperatures. Our work here confirms that an immersion challenge will deliver reproducible results as suggested by LaFrentz et al. (2012). As fish grew in size the challenge concentration had to be increased to achieve similar results. These results suggest that size/age is an important factor for determining susceptibility of rainbow trout to immersion challenges with F. columnare. 5. Conclusion These results demonstrate that mortalities in rainbow trout as small as 0.2 g were the result of an outbreak and expansion of a highly related
References Darwish, A.M., Ismaiel, A.A., 2005. Genetic diversity of Flavobacterium columnare examined by restriction fragment length polymorphism and sequencing of the 16S ribosomal RNA gene and the 16S–23S rDNA spacer. Mol. Cell. Probes 19, 267–274. Davis, H.S., 1922. A new bacterial disease in freshwater fishes. U. S. Bur. Fish. Bull. 38, 37–63. Declercq, A.M., Haesebrouck, F., Van den Broeck, W., Bossier, P., Decostere, A., 2013. Columnaris disease in fish: a review with emphasis on bacterium-hot interactions. Vet. Res. 44, 1–27. Decostere, A., Haesebrouck, F., Devriese, L.A., 1997. Shieh medium supplemented with tobramycin for selective isolation of Flavobacterium columnare (Flexibacter columnaris) from diseased fish. J. Clin. Microbiol. 35, 322–324. Decostere, A., Haesebrouck, F., Van Driessche, E., Charlier, G., Ducatelle, R., 1999. Characterization of the adhesion of Flavobacterium columnare (Flexibacter columnaris) to gill tissue. J. Fish Dis. 22, 465–474. Evenhuis, J.P., Cleveland, B.M., 2012. Modulation of rainbow trout (Oncorhynchus mykiss) intestinal immune gene expression following bacterial challenge. Vet. Immunol. Immunopathol. 146 (1), 8–17. Hawke, J.P., Thune, R.L., 1992. Systemic isolation and antimicrobial susceptibility of Cytophaga columnaris from commercially reared channel catfish. J. Aquat. Anim. Health 4, 109–113. Holt, J.G., Krieg, N.R., Sneath, P.H.A., Staley, J.T., Williams, S.T., 1994. Bergey's Manual of Determinative Bacteriology. Williams & Wilkins, Baltimore 787. Kubilay, A., Altun, S., Diler, O., Ekici, S., 2008. Isolation of Flavobacterium columnare from cultured rainbow trout (Oncorhynchus mykiss) fry in Turkey. Turk. J. Fish. Aquat. Sci. 8, 165–169. LaFrentz, B.R., LaPatra, S.E., Shoemaker, C.A., Klesius, P.H., 2012. Reproducible challenge model to investigate the virulence of Flavobacterium columnare genomovars in rainbow trout Oncorhynchus mykiss. Dis. Aquat. Org. 101, 115–122. LaFrentz, B.R., Waldbieser, G.C., Welch, T.J., Shoemaker, C.A., 2013. Intragenomic heterogeneity in the 16S rRNA genes of Flavobacterium columnare and standard protocol for genomovar assignment. J. Fish Dis. http://dx.doi.org/10.1111/jfd.12166. Mulder, I.E., Wadsworth, S., Secombes, C.J., 2007. Cytokine expression in the intestine of rainbow trout (Oncorhynchus mykiss) during infection with Aeromonas salmonicida. Fish Shellfish Immunol. 23, 747–759. Noga, E.J., 2000. Fish Disease Diagnosis and Treatment. Iowa State University Press, South State Avenue, Ames, Iowa 367. Olivares-Fuster, O., Shoemaker, C.A., Klesius, P.H., Arias, C.R., 2007a. Molecular typing of isolates of the fish pathogen, Flavobacterium columnare, by single-strand conformation polymorphism analysis. FEMS Microbiol. Lett. 269, 63–69. Olivares-Fuster, O., Baker, J.L., Terhune, J.S., Shoemaker, C.A., Klesius, P.H., Arias, C.R., 2007b. Host-specific association between Flavobacterium columnare genomovars and fish species. Syst. Appl. Microbiol. 30, 624–633. Ordal, E.J., Rucker, R.R., 1944. Pathogenic myxobacteria. PSEBM 56, 15–18. Raida, M.K., Buchmann, K., 2007. Bath vaccination of rainbow trout (Oncorhynchus mykiss Walbaum) against Yersinia ruckeri: effects of temperature on protection and gene expression. Vaccine 26, 1050–1062. Rasch, M., Buch, C., Austin, B., Slierendrecht, W.J., Ekmann, K.S., Larsen, J.L., Johansen, C., Riedel, K., Eberl, L., Givskov, M., Gram, L., 2004. An inhibitor of bacterial quorum sensing reduces mortalities caused by vibriosis in Rainbow trout (Oncorhynchus mykiss, Walbaum). Syst. Appl. Microbiol. 27, 350–359. Rehulka, J., Mraz, O., 1982. Columnarosis in rainbow trout (Salmo gairdneri R.) in Czechoslovakia. Acta Vet. Brno 125–137.
J.P. Evenhuis et al. / Aquaculture 418–419 (2014) 126–131 Shoemaker, C.A., Olivares-Fuster, O., Arias, C.R., Klesius, P.H., 2008. Flavobacterium columnare genomovar influences mortality in channel catfish (Ictaluraus punctatus). Vet. Microbiol. 127, 353–359. Suomalainen, L.R., Tiirola, M.A., Valtonen, E.T., 2005. Influence of rearing conditions on Flavobacterium columnare infection of rainbow trout, Oncorhynchus mykiss (Walbaum). J. Fish Dis. 28, 271–277. Tekedar, H.C., Karsi, A., Gillaspy, A.F., Dyer, D.W., Benton, N.R., Zaitshik, J., Vamenta, S., Banes, M.M., Gulsoy, N., Aboko-Cole, M., Waldbieser, G.C., Lawrence, M.L., 2012. Genome sequence of the fish pathogen Flavobacterium columnare ATCC 49512. J. Bacteriol. 2763–2764.
131
Thompson, J.D., Gibson, T.J., Plewniak, F., Jeanmougin, F., Higgins, D.J., 1997. The CLUSTAL_X windows interface: flexible strategies for multiple sequence alignment aided by quality analysis tools. Nucleic Acids Res. 24, 4876–4882. Thune, R., 1993. Bacterial diseases of catfish. In: Stoskopf, M.W.B. (Ed.), Fish Med. Sounders Company, London, pp. 524–526. Triyanto, Wakabayashi, H., 1999. Genotypic diversity of strains of Flavoacterium columnare from diseased fishes. Fish Pathol. 27, 65–71. Wiens, G.D., Glenney, G.W., LaPatra, S.E., Welch, T.J., 2006. Identification of novel rainbow trout (Onchorynchus mykiss) chemokines, CXCd1 and CXCd2: mRNA expression after Yersinia ruckeri vaccination and challenge. Immunogenetics 58, 308–323.
Contents lists available at ScienceDirect
Aquaculture journal homepage: www.elsevier.com/locate/aqua-online
Early life stage rainbow trout (Oncorhynchus mykiss) mortalities due to Flavobacterium columnare in Idaho, USA Jason P. Evenhuis a,⁎, Scott E. LaPatra b, David Marancik a a b
USDA-ARS, National Center for Cool and Cold Water Aquaculture, 11861 Leetown Rd, Kearneysville, WV 25430, USA Clear Springs Foods, Inc., Research Division, Buhl, ID 83316, USA
a r t i c l e
i n f o
Article history: Received 20 September 2013 Received in revised form 24 September 2013 Accepted 25 September 2013 Available online 2 October 2013 Keywords: Yersinia ruckeri Genomovar 16S rRNA Bacterial challenge
a b s t r a c t Flavobacterium columnare is the etiologic agent of columnaris disease, a pervasive disease of fresh water finfish. During the past 4 years, losses that ranged from 5 to 50% in rainbow trout (Oncorhynchus mykiss) fry being reared at a constant 14.5 °C (mean weight, 0.2 g; ~400°days post-fertilization), have been occurring in Hagerman Valley, Idaho, USA. A total of 70 different F. columnare isolates were obtained from diseased fish and the water they were reared in. All of the isolates were confirmed to be genomovar I by 16S rRNA restriction fragment length polymorphism. Sequencing of the 16S rRNA, 16S–23S rDNA spacer region and the gyrase B subunit genes from these 70 strains revealed no sequence differences among these isolates. Whole-cell protein profiling by SDSPAGE also indicated low variation between isolates. Virulence was assessed for a representative isolate and demonstrated a high degree of pathogenicity against rainbow trout fry at 15 °C. These results suggest the emergence of a highly successful F. columnare strain that can affect very early life stages of fish being reared at a constant 14.5 °C at a commercial rainbow trout farm in Idaho. Published by Elsevier B.V.
1. Introduction Flavobacterium columnare is the etiological agent for columnaris disease and is a Gram-negative, rod-shaped bacterium that forms rhizoid colonies on solid growth medium. Columnaris disease was first described by Davis (1922); the F. columnare bacteria was later isolated in 1944 (Ordal and Rucker, 1944). Columnaris disease is usually associated with external lesions on the skin and gills (Decostere et al., 1999; Noga, 2000; Thune, 1993) of fish being reared at warm water temperatures but can also be isolated from internal tissues (Hawke and Thune, 1992). Genetic variability between F. columnare isolates was demonstrated by Triyanto and Wakabayashi (1999) and three genomovar classifications were established based on the HaeIII restriction fragment length polymorphism (RFLP) of the 16S rRNA gene. Recent studies by LaFrentz et al. (accepted for publication) and Olivares-Fuster et al. (2007a, 2007b) have increased the number of subdivisions to include I-B, II-B and I/II genomovars by improving on the original RFLP assay. Host-specific association between genomovar and fish species was demonstrated in threadfin shad Dorosoma petenense (Olivares-Fuster et al., 2007a, 2007b) and salmonids (LaFrentz et al., 2012). To date, all but one isolate of F. columnare from rainbow trout (Oncorhynchus mykiss) have been classified as genomovar I. The one variation is a genomovar III isolate obtained from fish in Georgia (LaFrentz et al., accepted for publication).
⁎ Corresponding author. Tel.: +1 304 724 8340x2135; fax: +1 304 725 0351. E-mail address: [email protected] (J.P. Evenhuis). 0044-8486/$ – see front matter. Published by Elsevier B.V. http://dx.doi.org/10.1016/j.aquaculture.2013.09.044
Columnaris disease is a major problem for the U.S. channel catfish aquaculture industry with losses up to $30 million annually (Declercq et al., 2013; Shoemaker et al., 2008) where water temperatures are typically N 25 °C. Worldwide salmon and rainbow trout aquaculture industries have also experienced outbreaks of columnaris disease in former Czechoslovakia (Rehulka and Mraz, 1982), Turkey (Kubilay et al., 2008) and Finland (Suomalainen et al., 2005). The outbreak in Turkey reported up to 30% losses in a single day for trout ranging from 5 to 10 g, while the outbreak in former Czechoslovakia reported 24% losses. Both outbreaks occurred during the summer months where water temperatures ranged from 9.8 °C to 16.2 °C. Recently, LaFrentz et al. (2012) have suggested that F. columnare may be an emerging problem for the U.S. Idaho rainbow trout aquaculture industry. The outbreak described herein has persisted over the past 4 years in a rainbow trout early life stage rearing facility in the Hagerman Valley, Idaho, USA, in small fish being reared at a constant 14.5 °C. We report the proteomic, genomic and virulence characteristics of the F. columnare isolates associated with this outbreak.
2. Method and materials 2.1. Facility and histology The early life stage rearing facility is an enclosed and covered facility on natural photoperiod with single use, flow-through spring water at a constant temperature of 14.5 °C. Groups were maintained at approximately 200,000 fish per raceway from alevins to a final weight of ~4 g
J.P. Evenhuis et al. / Aquaculture 418–419 (2014) 126–131
(~1200°days). Fish were hand fed a standard rainbow trout fry feed (Clear Springs Foods, Inc.), 3–5% of body weight, daily. Histopathology was performed on six 1–2 g commercial rainbow trout associated with a natural outbreak of F. columnaris. Fish were euthanized with 250 mg/ml MS-222 and placed in 10% neutral buffered formalin (Fisher-Scientific) for 72 h prior to being placed in decalcification solution (Cal-Rite, Thermo-Scientific) for 8 h. Fish were serially sectioned and tissues were processed routinely, embedded in paraffin, sectioned at 5 μm, and stained with hematoxylin and eosin (H&E).
127
40% methanol and 10% acetic acid wash buffer to remove unbound stain. An additional spleen isolate (FC-CSF-24) was used for this comparison. 2.5. Sequencing of the 16S, 16S–23S spacer region and the Gyrase B genes
A total of 70 F. columnare isolates were obtained from several tissues of moribund fish, as small as 0.2 g, including kidney (18), gill (7), skin (7), spleen (15) and brain (9) and water (14) the fish were being reared in. Tissues were sampled aseptically and plated on Shieh medium (Decostere et al., 1997), tryptone yeast extract salts (TYES) agar (Holt et al., 1994) with and without 1 μg ml−1 of tobramycin and incubated overnight at 30 °C. Four isolates, from water (FC-CSF-1), kidney tissue (FC-CSF-9), and two from gill tissue (FC-CSF-58 and CSF298-10) as well as genomovar controls were used for comparisons.
The 16S rRNA gene was sequenced from the PCR product used to determine genomovar classification. Primers for the 16S–23S rDNA spacer, ColF3a and ColR3a (Table 1) were taken from Darwish and Ismaiel (2005), while primers for the Gyrase B subunit (GyrB_F and GyrB_R), were generated against the published ATCC23463 genome (Tekedar et al., 2012). The thermocycle program was the same as previously described. Confirmation of the PCR products, including control genomovar I, II, and III products, was determined by electrophoresis using 5 μl of PCR product added to a 1% TAE (w/v) agarose gel and visualized as previously described. Sequencing was performed using the Big Dye® Terminator v3.1 labeling kit (Applied Bioscience) and an ABI3100 DNA Analyzer (Applied Biosystems). Sequence alignments and analysis were performed on Sequencer 4.2 software and verified by manually visualizing sequence chromatographs.
2.3. Genomovar characterization
2.6. Bacterial immersion challenges
Genomovar classification was determined using the protocol established by Darwish and Ismaiel (2005). Briefly, the 16S rDNA gene was amplified from total genomic DNA using primer mix (UN-20 and R1438) (Table 1) at a final concentration of 200 μM, 45 μl of Platinum PCR SuperMix High Fidelity (Invitrogen) and 100 ng of DNA on a DNA engine thermocycler (Bio-Rad), with the thermocycle program including a 10 m initial 94 °C denaturing step, followed by 30 cycles at 94 °C, 55 °C annealing and 72 °C elongation: each step was 1 m in length. The RFLP profile was generated by digestion of the 16S rDNA product with the HaeIII restriction enzyme and by running the product on a tris–acetate–EDTA (TAE) + 1% (w/v) agarose gel cast with 1× SYBR Safe DNA gel stain (Invitrogen) and visualization by ultraviolet transillumination. Control genomic DNA for genomovars I (ATCC 23464), II (ALG-00-530) and III (ALM-05-53) (LaFrentz et al., accepted for publication; Shoemaker et al., 2008) were generously provided by Dr. Ben LaFrentz, USDA, Auburn, AL. Sequence alignments were determined by CLUSTALW (Thompson et al., 1997) analysis and phylogenetic trees were generated by neighbor-joining test using the MEGA v5.2 (Tamura et al., 2011).
Rainbow trout were acquired from Troutlodge, Inc., Sumner, Washington, USA, as specific-pathogen-free eyed eggs, and no apparent health problems were observed prior to being used in immersion challenges with F. columnare. All fish were challenged in 4 l tanks with ~ 15.8 °C water flowing at 0.5 l m− 1 and were allowed to acclimate for 7 days prior to challenge. The F. columnare strain, CSF289-10, a 2010 isolate from the head kidney of a diseased fish from the same facility, was used as the challenge strain. The immersion challenge protocol used was from LaFrentz et al. (2012). Challenge 1 included 0.3 g (~ 375°days post-hatch) fish that were immersion challenged at bacterial concentrations of ~ 5.6 × 105, 2.6 × 106 and 1.1 × 107 CFU ml− 1, and challenge 2 included 1.1 g (~ 650°days post-hatch) fish that were challenged at concentrations of ~ 2.3 × 106, 1.0 × 107 and 2.1 × 107 CFU ml− 1. Bacterial concentrations were estimated by direct plate counting of 10-fold serial dilutions of the challenge to determine total CFU. Mortalities were removed and recorded daily for 21 days. Survival graphs were produced using GraphPad 5 software.
2.2. Bacterial isolation and culture
3. Results 2.4. SDS-PAGE Differences in protein profiles were determined by SDS-PAGE on a Bio-Rad mini-gel system utilizing a 10% polyacrylimide gel. Briefly, 700 μl of suspended bacteria was taken from an overnight TYES culture and centrifuged at 8000 ×g for 20 m. Pellets were suspended in 100 μl of Lamelli sample buffer + β-2ME and heated for 10 m at 100 °C. A total of 10 μl of each sample were loaded in individual wells and gels were run for approximately 1 h at 100 V, followed by staining with a 0.1% w/v Coomassie Brilliant Blue R-250 for 1 h and de-stained with a
F. columnare was isolated from gill, brain, spleen and/or head kidney tissues of naturally infected diseased fish and the water the fish were being reared in. Mortality ranged between 5 and 50% in rainbow trout fry as small as 0.2 g. Signs of disease in moribund fish included rapid gill movement, dorsal (saddleback) erosive and ulcerative lesions (Supplemental Fig. 1), and changes in gill pigmentation. Histopathologic examination of six fish revealed multifocal and locally extensive loss of epithelium of the dorsal and lateral integument and/or mucosa of the oral cavity (Supplemental Fig. 1). In one fish, there was additional
Table 1 Primers, approximate nucleotide length, percent identity and origin of the primers used for gene sequencing. Genes include the 16S rRNA, 16S–23S rDNA spacer region and the Gyrase B subunit. Gene
Length (bp)
% identity (between isolates)
FWD primer (5′–3′)
REV primer (5′–3′)
Origin
16S rRNA 16S–23S rDNA spacer Gyrase B subunit
1450 647 798
100 100 100
UN-20 AGAGTTTGATC(AC)TGGCTCAG ColF3a GGCTGGATCACCTCCTTTCTA GryB_F GTACGTATGCGTCCGTCCAT
R1438 GCCCTAGTTACCAGTTTTAC ColF3a CTAGGCATCCCCCATACGC GryB_R GTGTTCCTCCTTCGTGCGTA
Darwish and Ismaiel (2005) Darwish and Ismaiel (2005) This paper
128
J.P. Evenhuis et al. / Aquaculture 418–419 (2014) 126–131
and neutrophils but inflammatory infiltrates were largely absent. There were signs of systemic infection in three fish including splenic necrosis, granulomatous splenitis and mild to moderate granulomatous nephritis, suggesting septicemia 3.1. Isolate characterization
Fig. 1. The RFLP profile generated by 16S rRNA, HaeIII restriction-enzyme digested and resolved on a 1% TAE agarose gel. Five individual isolates (G = gill tissue, K = kidney tissue, W = water sample and C = CSF298-10) are a representation of all the isolates collected from this disease outbreak. M = 100 bp marker and the relative (bp) length, (*) = the stain that had an alternative protein banding pattern. All isolates from this facility are genomovar I based on this analysis.
multifocal loss of gill architecture and necrosis of gill filaments. Affected epithelium of the skin and oral mucosa were covered by mats of long, filamentous bacteria that infiltrated into the underlying tissue eliciting localized necrosis and degeneration of skeletal muscle (Supplemental Fig. 1). Bacteria were associated with scattered epithelial macrophages
A total of 70 individual isolates, 56 from tissues and 14 from water samples, were obtained from the early life stage rearing facility where the outbreaks were occurring. F. columnare was isolated from all fish tested and was the only bacteria isolated from internal organs, including the brain, kidney and spleen. Several individual trout accounted for multiple isolates that were obtained from different tissues. Isolates from water were only found on TYES and TYES + tobramycin agar. All samples were classified as genomovar I by the RFLP banding pattern regardless of the isolates origin (Fig. 1). Every isolate's protein banding pattern was characterized by SDSPAGE, though one isolate taken from gill tissue (the only isolate recovered from this fish) had a single banding pattern difference (Fig. 2). No other variations in protein banding patterns were observed among the isolates obtained from this rainbow trout early life stage rearing facility. 3.2. Sequencing of the 16S, Gyrase B subunit and the 16S–23S rDNA spacer The PCR products for the 16S rRNA, Gyrase B subunit and the 16S– 23S rDNA spacer region were generated using the proofreading Taq to increase sequence accuracy. Primers for the 16S and 16S–23S rDNA
Fig. 2. CLUSTALW alignments and neighbor-joining phylogenetic trees generated, by MegAlign v.4 software, to (A) 16S rRNA, (B) 16S–23S spacer region and (C) gyrase B. Idaho isolates are illustrated by brackets. The only differences found by sequencing and CLUSTALW analysis were between control genomovar I, II and III strains.
J.P. Evenhuis et al. / Aquaculture 418–419 (2014) 126–131
129
3.3. Challenges with CSF298-10 A single isolate, CSF298-10, was designated for virulence determination and used in all immersion challenges. Several bacterial concentrations were tested in rainbow trout with a mean body weight of approximately 0.3 g and 1.1 g to characterize the relative virulence of this bacterial strain and determine potential changes that occur in virulence due to the increase in fish size. Challenge 1 used trout that were 0.3 g in size with approximate bacterial concentrations of 5 × 105, 2.6 × 106 and 1.1 × 107 CFU ml−1. Survival for the 3 bacterial concentrations was ~65, 38 and 10%, respectively (Fig. 4A). Challenge 2 compared the virulence of this isolate in rainbow trout that were 1.1 g in size with approximate bacterial concentrations of 2.3 × 106, 1 × 107 and 2.1 × 107 CFU ml−1. Survivals for this challenge were ~77, 32 and 12%, respectively (Fig. 4B). Approximately 10% of the mortalities were sampled for spleen and head kidney tissues, and all samples were positive for the same strain of F. columnare. The strain was confirmed by colony morphology and sequencing of the 16S rRNA gene. 4. Discussion
Fig. 3. A 1 dimension 10% SDS-PAGE resolution of the total protein profile from 5 different isolates. A single band from a gill isolate, marked by (→), was the only banding pattern variation found out of 70 different isolates tested. The challenge strain CSF298-10 in included in the final lane.
spacer region give products of 1450 and 647 bp, respectively (Table 1). The Gyrase B subunit primers generated for this work resulted in a product 798 bp in length. All 70 isolates, including the challenge strain, were 100% identical for all three DNA segments tested which was confirmed by CLUSTALW alignments and illustrated by a neighbor-joining phylogenetic tree (Fig. 3). The only differences found by sequencing and CLUSTALW analysis were between control genomovar I, II and III strains. Thorough genetic comparisons between isolates from the early life stage rearing facility and those of other genomovars will be undertaken in future studies.
F. columnare is a significant disease problem for warm water aquaculture and has been known to cause mortalities in cool or cold water fish including salmonids. To our knowledge, no columnaris-specific disease has previously been reported in young stages of rainbow trout from Idaho, USA. Previous reports of F. columnare outbreaks in rainbow trout from Turkey (Kubilay et al., 2008) and Czechoslovakia (Rehulka and Mraz, 1982) occurred during months when the water increased in temperature. LaFrentz et al. (2012) describe F. columnare as a potential emerging rainbow trout disease. Herein we describe a persistent columnaris disease outbreak in early life stages of rainbow trout from the Hagerman Valley, Idaho, which has caused mortalities over several years regardless of the season. This may be due to the unique nature of this area as the water is at a constant temperature of ~14.5 °C. 4.1. Highly related genetic background The research presented here, including the sequencing of several genes and the protein banding pattern, indicated that the outbreak occurring at this facility is due to a highly related population of F. columnare. However, our current testing methods may not be sensitive enough to determine genetic variation between individual isolates of a highly related population. These results are interesting because previous work (Olivares-Fuster et al., 2007a, 2007b) has indicated variation between genomovar I isolates in the RFLP and SSCP banding patterns
Fig. 4. Survival curve graphs generated on GraphPad v.5 software. Challenge 1 was performed on fish that averaged 0.3 g/fish and challenge 2 was performed on fish that averaged 1.1 g/fish.
130
J.P. Evenhuis et al. / Aquaculture 418–419 (2014) 126–131
of the 16S rRNA and 16S–23S spacer region. Darwish and Ismaiel (2005) also showed variation between genomovar I isolates from similar geographic regions by 16S–23S rRNA RFLP. Phylogenetic analysis illustrates the lack of variation between the isolates taken from this facility and that they cluster separately from the control genomovar strains (Fig. 3). The lack of genetic variation for the three DNA sequences suggests that the outbreaks occurring in fish at this early life stage rearing facility are the result of the expansion of a highly related virulent strain of F. columnare. The single protein banding pattern variation supports the close relationship of all the isolates tested. Prior to this report, F. columnare was not a disease concern for all life stages at this facility. That this strain is highly related but not an obviously unique strain (genomovar I) suggests that this outbreak may be due to an environmental difference that has occurred either within the facility or to the water supply. An increase in water temperature would be the easiest explanation for the expansion of a bacterium that is associated with warm water disease but the unique nature of the Hagerman Valley, and a constant water temperature of ~ 14.5 °C, does not suggest that an increase in water temperature is responsible for this outbreak. An in depth investigation at the facility and the incoming water supply is needed to determine the source of F. columnare.
population of F. columnare. Further study is required to determine if all of the isolates are the expansion of a single clone. An isolate taken from the facility was shown to be, in a laboratory setting, highly virulent to small (0. 3 and 1.1 g) rainbow trout. The variation in fish size/age affected the susceptibility of rainbow trout in an immersion challenge. Whether this population of F. columnare has emerged from the water supply prior to entering the early life stage rearing facility, from a reservoir within the facility itself or from the mutation of a non-virulent to a virulent form of F. columnare, has yet to be determined. Supplementary data to this article can be found online at http://dx. doi.org/10.1016/j.aquaculture.2013.09.044.
Acknowledgments The authors thank Ryan Lipscomb and Travis Moreland for the expert technical assistance, and Mark L. Richardson and Tim Welch for the critical comments on the manuscript. Mention of trade names or commercial products in this publication is solely for the purpose of providing specific information and does not imply recommendation or endorsement by the United States Department of Agriculture. USDA is an equal opportunity provider and employer.
4.2. F. columnare challenge The CSF298-10 strain, which was isolated in 2010 from fish at this same facility, illustrates the persistence of this strain over several years. Achieving 35% mortality in 0.3 g rainbow trout at a concentration of only 5 × 105 CFU ml− 1 supports that this is a virulent strain in rainbow trout. This bacterial dose is less than a tenth of the concentration used by LaFrentz et al. (2012) to get a cumulative percent mortality (CPM) of approximately 50% for rainbow trout that had a mean weight of 0.7 g. When the dose was increased to 2.6 × 106 CFU ml− 1 the CSF298-10 strain mortality reached 62% in 0.3 g fish (Fig. 4A). When we challenged fish at 1.1 g in size at a concentration of 2.3 × 106 CFU ml− 1 only 25% cumulative mortality was observed. Greater than 4 times that bacterial concentration was needed to reach N 60% mortality in the 1.1 g (Fig. 4B) fish as compared to the 0.3 g fish. The F. columnare concentrations used here are comparable to other established immersion challenge protocols for various pathogens of rainbow trout including Yersinia ruckeri (Evenhuis and Cleveland, 2012; Raida and Buchmann, 2007; Wiens et al., 2006), Vibrio anguillarum (Rasch et al., 2004) which both used immersion concentrations between 107 and 108 CFU ml−1, or Aeromonas salmonicida (Mulder et al., 2007) which used a bacterial concentration of 105 but with a longer 24 h exposure. In these studies F. columnare challenge organism was grown at 30 °C because high bacterial concentrations could be reached in a relatively short amount of time. This is in sharp contrast to the water temperatures (below 16 °C) associated with the disease outbreaks or temperatures used for experimental challenges reported in this study. It should be noted that while the effect of this elevated pre-challenge growth temperature on F. columnare virulence is unknown it clearly does not prevent F. columnare from causing disease and mortalities in rainbow trout being held at much lower temperatures. Our work here confirms that an immersion challenge will deliver reproducible results as suggested by LaFrentz et al. (2012). As fish grew in size the challenge concentration had to be increased to achieve similar results. These results suggest that size/age is an important factor for determining susceptibility of rainbow trout to immersion challenges with F. columnare. 5. Conclusion These results demonstrate that mortalities in rainbow trout as small as 0.2 g were the result of an outbreak and expansion of a highly related
References Darwish, A.M., Ismaiel, A.A., 2005. Genetic diversity of Flavobacterium columnare examined by restriction fragment length polymorphism and sequencing of the 16S ribosomal RNA gene and the 16S–23S rDNA spacer. Mol. Cell. Probes 19, 267–274. Davis, H.S., 1922. A new bacterial disease in freshwater fishes. U. S. Bur. Fish. Bull. 38, 37–63. Declercq, A.M., Haesebrouck, F., Van den Broeck, W., Bossier, P., Decostere, A., 2013. Columnaris disease in fish: a review with emphasis on bacterium-hot interactions. Vet. Res. 44, 1–27. Decostere, A., Haesebrouck, F., Devriese, L.A., 1997. Shieh medium supplemented with tobramycin for selective isolation of Flavobacterium columnare (Flexibacter columnaris) from diseased fish. J. Clin. Microbiol. 35, 322–324. Decostere, A., Haesebrouck, F., Van Driessche, E., Charlier, G., Ducatelle, R., 1999. Characterization of the adhesion of Flavobacterium columnare (Flexibacter columnaris) to gill tissue. J. Fish Dis. 22, 465–474. Evenhuis, J.P., Cleveland, B.M., 2012. Modulation of rainbow trout (Oncorhynchus mykiss) intestinal immune gene expression following bacterial challenge. Vet. Immunol. Immunopathol. 146 (1), 8–17. Hawke, J.P., Thune, R.L., 1992. Systemic isolation and antimicrobial susceptibility of Cytophaga columnaris from commercially reared channel catfish. J. Aquat. Anim. Health 4, 109–113. Holt, J.G., Krieg, N.R., Sneath, P.H.A., Staley, J.T., Williams, S.T., 1994. Bergey's Manual of Determinative Bacteriology. Williams & Wilkins, Baltimore 787. Kubilay, A., Altun, S., Diler, O., Ekici, S., 2008. Isolation of Flavobacterium columnare from cultured rainbow trout (Oncorhynchus mykiss) fry in Turkey. Turk. J. Fish. Aquat. Sci. 8, 165–169. LaFrentz, B.R., LaPatra, S.E., Shoemaker, C.A., Klesius, P.H., 2012. Reproducible challenge model to investigate the virulence of Flavobacterium columnare genomovars in rainbow trout Oncorhynchus mykiss. Dis. Aquat. Org. 101, 115–122. LaFrentz, B.R., Waldbieser, G.C., Welch, T.J., Shoemaker, C.A., 2013. Intragenomic heterogeneity in the 16S rRNA genes of Flavobacterium columnare and standard protocol for genomovar assignment. J. Fish Dis. http://dx.doi.org/10.1111/jfd.12166. Mulder, I.E., Wadsworth, S., Secombes, C.J., 2007. Cytokine expression in the intestine of rainbow trout (Oncorhynchus mykiss) during infection with Aeromonas salmonicida. Fish Shellfish Immunol. 23, 747–759. Noga, E.J., 2000. Fish Disease Diagnosis and Treatment. Iowa State University Press, South State Avenue, Ames, Iowa 367. Olivares-Fuster, O., Shoemaker, C.A., Klesius, P.H., Arias, C.R., 2007a. Molecular typing of isolates of the fish pathogen, Flavobacterium columnare, by single-strand conformation polymorphism analysis. FEMS Microbiol. Lett. 269, 63–69. Olivares-Fuster, O., Baker, J.L., Terhune, J.S., Shoemaker, C.A., Klesius, P.H., Arias, C.R., 2007b. Host-specific association between Flavobacterium columnare genomovars and fish species. Syst. Appl. Microbiol. 30, 624–633. Ordal, E.J., Rucker, R.R., 1944. Pathogenic myxobacteria. PSEBM 56, 15–18. Raida, M.K., Buchmann, K., 2007. Bath vaccination of rainbow trout (Oncorhynchus mykiss Walbaum) against Yersinia ruckeri: effects of temperature on protection and gene expression. Vaccine 26, 1050–1062. Rasch, M., Buch, C., Austin, B., Slierendrecht, W.J., Ekmann, K.S., Larsen, J.L., Johansen, C., Riedel, K., Eberl, L., Givskov, M., Gram, L., 2004. An inhibitor of bacterial quorum sensing reduces mortalities caused by vibriosis in Rainbow trout (Oncorhynchus mykiss, Walbaum). Syst. Appl. Microbiol. 27, 350–359. Rehulka, J., Mraz, O., 1982. Columnarosis in rainbow trout (Salmo gairdneri R.) in Czechoslovakia. Acta Vet. Brno 125–137.
J.P. Evenhuis et al. / Aquaculture 418–419 (2014) 126–131 Shoemaker, C.A., Olivares-Fuster, O., Arias, C.R., Klesius, P.H., 2008. Flavobacterium columnare genomovar influences mortality in channel catfish (Ictaluraus punctatus). Vet. Microbiol. 127, 353–359. Suomalainen, L.R., Tiirola, M.A., Valtonen, E.T., 2005. Influence of rearing conditions on Flavobacterium columnare infection of rainbow trout, Oncorhynchus mykiss (Walbaum). J. Fish Dis. 28, 271–277. Tekedar, H.C., Karsi, A., Gillaspy, A.F., Dyer, D.W., Benton, N.R., Zaitshik, J., Vamenta, S., Banes, M.M., Gulsoy, N., Aboko-Cole, M., Waldbieser, G.C., Lawrence, M.L., 2012. Genome sequence of the fish pathogen Flavobacterium columnare ATCC 49512. J. Bacteriol. 2763–2764.
131
Thompson, J.D., Gibson, T.J., Plewniak, F., Jeanmougin, F., Higgins, D.J., 1997. The CLUSTAL_X windows interface: flexible strategies for multiple sequence alignment aided by quality analysis tools. Nucleic Acids Res. 24, 4876–4882. Thune, R., 1993. Bacterial diseases of catfish. In: Stoskopf, M.W.B. (Ed.), Fish Med. Sounders Company, London, pp. 524–526. Triyanto, Wakabayashi, H., 1999. Genotypic diversity of strains of Flavoacterium columnare from diseased fishes. Fish Pathol. 27, 65–71. Wiens, G.D., Glenney, G.W., LaPatra, S.E., Welch, T.J., 2006. Identification of novel rainbow trout (Onchorynchus mykiss) chemokines, CXCd1 and CXCd2: mRNA expression after Yersinia ruckeri vaccination and challenge. Immunogenetics 58, 308–323.