Ectodomain shedding of CD200 from the B-CLL cell surface is regulated by ADAM28 expression

Leukemia Research 37 (2013) 816–821

Contents lists available at SciVerse ScienceDirect

Leukemia Research journal homepage: www.elsevier.com/locate/leukres

Ectodomain shedding of CD200 from the B-CLL cell surface is regulated by ADAM28 expression Tal Twito a , Zhiqi Chen a , Ismat Khatri a , Karrie Wong a , David Spaner b , Reg Gorczynski a,∗ a b

Transplant Research Division, University Health Network, Toronto General Hospital, University of Toronto, Canada Division of Molecular and Cellular Biology, Research Institute, Sunnybrook Health Sciences Centre, and Sunnybrook Odetted Cancer Centre, Toronto, ON, Canada

a r t i c l e

i n f o

Article history: Received 25 January 2013 Received in revised form 1 April 2013 Accepted 9 April 2013 Available online 1 May 2013 Keywords: CLL ADAMs Ectodomain shedding SCD200

a b s t r a c t CD200, a membrane glycoprotein of the immunoglobulin superfamily, is overexpressed in CLL. Soluble in serum CD200 (sCD200) is correlated with poor prognosis in CLL. ADAM (a disintegrin and metalloproteinase) enzymes are implicated in membrane protein shedding. ADAM28 mRNA expression in CLL was correlated with plasma sCD200 levels, and release into culture from CLL cells. siRNA for ADAM28 decreased release of sCD200 from cultures and transfection of a cloned ADAM28 gene into CD200+ cells enhanced release of sCD200. Our data support the hypothesis that ADAM28 plays a role in the shedding of CD200 from B-cell CLL cells. © 2013 Elsevier Ltd. All rights reserved.

1. Introduction Chronic lymphocytic leukemia (CLL) of B cells (B-CLL) is a tumor of CD5+ CD19+ and CD23+ lymphocytes. It is the most common type of leukemia among adults in the western world and is characterized by a profound but poorly understood immunodeficiency state [1]. CD200, a membrane glycoprotein of the immunoglobulin superfamily (IgSF), exerts immunosuppressive function in autoimmune disease, fetal rejection and transplant tolerance [2]. CD200 is expressed on cells in many tissues, including B cells [3], and it exerts its immunoregulatory function following interaction with its receptor (CD200R) [2]. CD200 expression is increased in several hematology malignancies [4–6] and is linked with disease progression/prognosis in lymphoma and leukemia [5,6]. We and others have reported increased expression of CD200 on cells from B-cell CLL patients compared to normal B cells [7–9] and reported that elevated levels of a soluble form of CD200 (sCD200) are associated with poor prognosis [10]. ADAM (A Disintegrin And Metalloprotease) enzymes are a family of transmembrane proteases, composed of several domains. ADAMs are involved in cell adhesion, cell signaling, migration, degradation of extracellular matrix (ECM) and proteolytic ectodomain shedding [11–13]. Ectodomain shedding is a process in which a cell surface protein is cleaved near its transmembrane

domain with the released protein ectodomain exerting a function. ADAMs are over expressed in human cancers [12,14] and implicated in cancer metastasis [15–17]. ADAM28 is expressed in human lymphocytes and is upregulated in certain cancer cells [18–20]. In contrast with other ADAMs, where furin-like proprotein convertases are involved in prodomain removal, ADAM28 is activated by autocatalytic removal of the prodomain with the mature transmembrane protein expressed on the cell surface [18]. The active form of ADAM28 cleaves specific sites in protein substrates, including CD23 and insulin-like growth factor binding protein-3 (IGFBP-3) [21]. ADAM 28 is expressed as two alternative forms, a membrane-anchored form (ADAM28m) and a short secreted form (ADAM28s) [22]. Immunoblotting with antiserum against the disintegrin domain of human ADAM28m showed two bands of 87 and 67 kDa in peripheral blood leukocytes. The 67 kDa form may represent a processed form of ADAM28 or a truncated, secreted form, ADAM28s [22]. We have asked whether elevated levels of sCD200 in CLL plasma reflect the action of unique ADAMs, and screened expression of 12 different ADAM species in CLL cells, correlating mRNA expression with soluble CD200 levels in patient serum. Our data show expression of ADAM28 is significantly correlated with sCD200, and siRNA-mediated inhibition of ADAM28 expression attenuates shedding of sCD200. 2. Materials and methods

∗ Corresponding author at: 101 College Street, Toronto, ON M5G1L7, Canada. Tel.: +1 416 5812 7519; fax: +1 416 581 7515. E-mail addresses: [email protected], [email protected] (R. Gorczynski). 0145-2126/$ – see front matter © 2013 Elsevier Ltd. All rights reserved. http://dx.doi.org/10.1016/j.leukres.2013.04.014

2.1. Clinical samples Peripheral blood was collected from consenting B-CLL patients and from healthy volunteers (all protocols were approved by institutional review boards). Cells were

T. Twito et al. / Leukemia Research 37 (2013) 816–821 Table 1 Primer sequences used in real-time PCR.

817

were added in 100 ␮l buffer. Plates were incubated for 3 h at room temperature, followed by washing and incubation for 2 h with 100 ␮l detection antibody (rabbit anti-CD200 serum, 1:500 dilution). After further washing, 100 ␮l goat anti-rabbit IgG-HRP antibody (1:12,500 dilution) was added with incubation at room temperature for 30 min. 100 ␮l TMB substrate was added with 10 min incubation at room temperature in the dark. The reaction was stopped using 50 ␮l sulfuric acid per well, and plates read in an ELISA plate reader at 450 nm. The sensitivity of detection of sCD200 is ∼50 pg/ml.

Accession #

Gene

Sequence 5 –3

NM 001109.3

ADAM8

ACACCCGGCAGGCACCAAAG GTGGGAGCTCGGCTCCTTGC

NM 001005845.1

ADAM9

TTTTCCCGCCACTGCACGAAGT AGAAGAGCTGTCTTGCCACAGA

NM 001110.2

ADAM10

GGTTGGCCAGATTCAACAAAAC TTTGGATCCCCACATGATTCTG

2.5. Knockdown of ADAM 10, 17 and 28 expression with Stealth RNA interference (RNAi)

NM 003474.4

ADAM12

TTCCTGCTGCAACTGCTGAACA GGAATTGTCATGGACCATTCAG

NM 207197.1

ADAM15

TTCGAAGAGGCAGCTGCCCATT AACATGGACCACTCCACCAGCA

NM 003183.4

ADAM17

TTCATCCACCCTCGAGTTCCCA TACAAAGGAAGCTGACCTGGTT

NM 033274.2

ADAM19

GAAGGAGGGCCGTGTGGTGC GGATGGGAGGAGGCCCCAGG

NM 003814.4

ADAM20

AGCACTGCAGCTCTGATGG GCATGGCTGACCTTTAGGG

NM 003813.2

ADAM21

TGCATCCATAAGAAGTGTGTCA TCCCCTTCATATTGCAGGTC

Three independent Stealth RNAi samples, complementary to ADAMs 10, 17 or 28 were purchased from Invitrogen and tested for specific suppression of the respective ADAM mRNA expression in CD200-stably transfected human breast cancer cells (MDA-MB-231CD200 ). Transfection was performed using 2 × 106 adherent MDA-MB231 cells and 3 ␮g siRNA (or control siRNA) using lipofectamine as transfection agent. qPCR was used to assess mRNA expression for the different ADAMs as well as a control housekeeping gene (GAPDH). Culture supernatants were also assessed for sCD200 release from the (CD200-transfected) MDA-MB-231 cells. When fresh CLL cells were treated with 3 ␮g siRNA, 107 fresh B-cell CLL cells were used, and transfection used AmaxaTM NucleofectorTM Technology, applying Solution-V with a U-013 running program. After transfection, cells were resuspended with 900 ␮l pre-warmed AIM-V media and incubated for 48 h, 72 h or 96 h at 37 ◦ C until harvest. Culture supernatants were stored at −20 ◦ C for sCD200 ELISA assay.

ADAM28(m)

CCACTGGCACCAGGCCACAC GAGGCTGGGGGCTCATTGCC

NM 021777.3

ADAM28(s)

AATCCTTTCCCCTGTGCATG AATGGTCCTTTGACCATGGT

NM 021794.3

ADAM30

CCTCCATTCTGTGAGGAAGTG CCCAAATTGACGAGGGAAT

NM 025220.2

ADAM33

CTTGAGCTGGAGAAGAACCAC TAGTGGCAATGATCCGTGTG

NM 002046.3

GAPDH

TCATCCATGACAACTTTGGTATCG TGGCAGGTTTTTCTAGACGGC

NM 000194.2

HPRT1

CAAGCTTGCTGGTGAAAAGGA TGAAGTATTCATTATAGTCAAGGGCATATC

NM 014265.4

2.6. Transfection of Ly5CD200+ cells with a cloned ADAM28 cDNA A glycerol stock of the human full-length cDNA clone of Adam 28 was obtained from Origene (Rockville, MD), containing 1.5 kb full-length cDNA of the human Adam 28 inserted into the pCMV6-XL5 mammalian expression vector. Plasmid DNA was purified using an EndoFree Plasmid Maxi Kit from Qiagen (Valencia, CA) and verified by DNA sequencing. A pmaxGFP vector was provided by Amaxa Inc. (Gaithersburg, MD) and used as a positive control for transfection. 1 × 106 Ly5 B cell lymphoma cells were centrifuged, resuspended in 100 ␮l of Nucleofector Solution V (Amaxa Inc.), and mixed with 2 ␮g of plasmid DNA. Electroporation was performed as above and cells cultured in triplicate in serum free medium with supernatants collected at 48 h post-transfection to measure sCD200. 2.7. Immunoblotting of CLL extract with anti-ADAM28 antibody

isolated by density centrifugation using Ficoll-Paque (Amersham Pharmacia Biotech AB, Uppsala, Sweden). The B-CLL cells were isolated from blood by negative selection (RosetteSep, StemCell Technologies, Vancouver, BC) according to the manufacturer’s instructions. 2.2. Isolation of total RNA and synthesis of cDNA Total RNA was extracted using TRIzolR Reagent (Invitrogen) and treated with RNase-free Dnase I (Promega, Madison, WI) for 30 min at 37 ◦ C. 2 ␮g RNA was reverse transcribed with SuperScript II (Life Technologies Inc., Rockville, MD) using a random oligonucleotide hexamer (Takara Bio Inc., Shiga, Japan) at 42 ◦ C for 50 min, followed by heating at 70 ◦ C for 15 min. cDNA was stored at −20 ◦ C until PCR analysis (Table 1). 2.3. qPCR Primers specific for individual ADAM isoforms were designed based on sequences available in the GenBank. PCR was performed on an ABI Prism 7900 Real Time PCR instrument (Applied Biosystems, Foster City, CA) with SYBR Green I as a double-stranded DNA-specific binding dye. Cycling conditions were, 95 ◦ C for 10 min, and after initial denaturation (95 ◦ C, 5 min) 40 cycles at 95 ◦ C for 15 s and 60 ◦ C for 1 min. All reactions used triplicate samples on a 384 plate, amplifying mRNAs for ADAM8, ADAM9, ADAM10, ADAM12, ADAM15, ADAM17, ADAM19, ADAM20, ADAM21, ADAM28m, ADAM28s, ADAM30 and the two housekeeping genes, HPRT1 and GAPDH. Results were expressed as relative gene expression in comparison to HPRT1 using the 2−Ct method [23], where 2−Ct = 2[−Ct(ADAM) −Ct(HPRT ) ]B−CLL . Applying the same formulation using GAPDH as comparator did not change any of the conclusions discussed below. 2.4. ELISA essay for soluble CD200 High binding 96-well plates (Corning Life Sciences) were coated overnight at 4 ◦ C in Tris–HCI, pH 8.1 with a capture monoclonal anti-CD200 antibody (1B9) at 1.25 ␮g/ml concentration. All washings used PBS + 0.01% Tween20. Plates were blocked for 1 h at room temperature with blocking buffer (5% FBS in PBS) and different concentrations of CD200Fc (standard curve) or samples (plasma or supernatant)

Cells were lysed on ice in 400 ␮l of 50 mM Tris–HCl buffer (pH 7.5), 150 mM NaCl, 1 mM PMSF, SDS 0.1% and Na. Deoxycholate 0.5% containing a cocktail of proteinase inhibitors (Roche Diagnostics, Mannheim, Germany). SDS-PAGE (7.5% total acrylamide) was performed under reducing conditions and resolved proteins were transferred to polyvinylidene difluoride membranes with a semidry blotter. Membranes were probed with a commercial Rabbit polyclonal antibody against the cytoplasmic domain of ADAM 28 (ab39875; Abcam, Cambridge, UK), at a dilution of 1:1000 using Rabbit anti-beta actin (ab8227; Abcam), at a dilution of 1:5000, as positive control. Blots were performed with 2% milk in TBST overnight at 4 ◦ C. Goat anti Rabbit HRP was added as developer with protein bands detected with ECL Western blotting reagents (Amersham Pharmacia Biotech). 2.8. Statistical analysis Data were analyzed using JUMP5 software. Differences in mRNA expression of ADAM28 between paired groups was determined by Student’s t-test. Correlations between the mRNA expression levels of the ADAMs species and sCD200 levels used a Pearson correlation coefficient. p-Values <0.05 were considered significant.

3. Results 3.1. mRNA expression of different ADAM isoforms in B-CLL cells mRNA expression of ADAM8, ADAM9, ADAM10, ADAM12, ADAM15, ADAM17, ADAM19, ADAM20, ADAM21, ADAM28, ADAM30 and ADAM33 was screened by qPCR in CLL cells from 18 different patients (% CD5+ cells varied from 65% to 92% in these different samples), and CD19+ B cells from six normal donors. Fig. 1 shows the relative expression level of ADAMs 9, 10, 17, 28, and 30 was significantly higher (p < 0.0001) in CLL cells compared to normal CD19+ B cells (nominally set as one). mRNA expression for ADAM 8 and 12 was significantly lower (p < 0.0001) in the same cells compared to control cells. While data are shown in Fig. 1 using CD19+ cells from all donors (CLL and normal) no significant differences were seen when comparing relative mRNA expression in

818

T. Twito et al. / Leukemia Research 37 (2013) 816–821

Fig. 1. ADAM isoform mRNA expression (qPCR) in 18 CLL and 6 normal samples, using delta-delta Ct for relative fold change. Expression of ADAM 9, 10, 17, 28, and 30 was increased (2.4 logs) and 8 and 12 decreased (1.7 logs); p < 0.0001.

CD5+ enriched vs CD19+ enriched cells from CLL donors (data not shown) – thus differences were not significantly affected by the relative percentage (above 65%) of CD5+ CLL cells in the CD19+ population. We next compared ADAM mRNA expression with sCD200 protein levels in the plasma of matched patients. mRNA expression levels of ADAM28 is correlated with sCD200 in plasma of CLL patients and release of sCD200 protein from the surface of CLL cells in vitro. sCD200 levels were determined by ELISA (Materials and Methods) in the plasma of all subjects shown in Fig. 1. Levels in CLL plasma were higher than in controls (6.4 ± 3.2 ng/mL and 1.0 ± 0.6 ng/mL, respectively, mean ± SD: p < 0.0001). Of the 12 ADAM mRNAs analyzed, ADAM28 was most strongly correlated with sCD200 levels (r2 = 0.68, p < 0.00001) (Fig. 2A also supplementary Figure 1). sCD200 levels in CLL population were increased relative to normal CD19+ B cells, regardless of whether comparison

was made with CD19+ or CD5+ cells in the PBL sample (Fig. 2A1 ). Based on sCD200 levels, individuals were subdivided into three groups, low, medium and high respectively in Fig. 2B (sCD200: 1.00 ± 0.08, 4.7 ± 0.2 and 9.0 ± 1.6 ng/ml). Expression levels of ADAM28 in these groups showed a significant difference by ANOVA, with a p value of <0.0001 (Fig. 2B). Supplementary material related to this article found, in the online version, at http://dx.doi.org/10.1016/j.leukres.2013.04.014. Levels of sCD200 in 48 h culture supernatants of CLL cells from 12 different patients were compared with mRNA expression levels of ADAM28 in the same cells, with similar results – see Fig. 2C and D (sCD200 levels in the three grouped culture samples were 0.60 ± 0.05, 0.73 ± 0.13 and 1.4 ± 0.07 ng/ml – Fig. 2D. p (ANOVA) <0.001). Note that levels of sCD200 in culture supernatants were not correlated with CLL cell viability at 48 h (≥90% in all cases by trypan blue dye exclusion).

Fig. 2. ADAM28 mRNA and serum sCD200 in 18 CLL patients (A/B); ADAM28 mRNA and 48 h supernatant sCD200 in 12 separate patients (C/D). (A1) sCD200 levels for control (CD19+ ) cells or CLL cells (enriched for CD19+ or CD5+ ); *p < 0.05. (B/D) ANOVA used subjects grouped according to mean (±SD) sCD200 levels (ng/ml) of 1.0 ± 0.8, 4.7 ± 0.2 and 9.0 ± 1.6 (low, medium and high) in panel (B), or 0.60 ± 0.05, 0.73 ± 0.13 and 1.4 ± 0.07 (panel D) (p < 0.0001).

T. Twito et al. / Leukemia Research 37 (2013) 816–821

3.2. ADAM28m and ADAM28s genes expression in B-CLL cells Two alternative forms of ADAM28 have been identified [21] representing a membrane-bound form (ADAM28-m) or secreted form (ADAM28-s). qPCR (Fig. 3A) showed no significant difference between ADAM28-m and ADAM28-s expression levels (22 ± 15 and 20 ± 14 respectively; p = 0.56), nor a correlation between the expression levels of these two isoforms (r2 = 0.45; p = 0.1) – Fig. 3B. Re-analysis of data in Fig. 2 (not shown) showed the correlation between sCD200 and ADAM28 expression was most evident for ADAM28m and not ADAM28s, which we take to imply that the secreted form plays little role in sCD200 shedding. We examined ADAM28 protein expression by immunoblotting using whole cell lysates (∼20 ␮g total protein/lane) with a commercial rabbit anti-ADAM28. Two bands of 87 and 92 kDa were recognized by this reagent (Fig. 3C), with the predicted size (from cDNA) being ∼85 kDa. These may represent different glycosylated forms of the same molecule. No bands were obtained using control Hek cells (human embryonic kidney) which lack expression of ADAM28mRNA, even though 50 ␮g of protein was used.

3.3. Transfection with siRNA anti-ADAM28 decreased sCD200 protein release siRNA specific for ADAMs 10,17 or 28 (see Fig. 1) were examined for their effect on shedding of sCD200 from MDA-MB-231CD200 and CLL cells in vitro. siRNA for ADAMs 10,17 and 28 all altered sCD200 release from MDA-MB-231CD200 (supplementary Figure 2). Fig. 4A shows ≥60% knockdown of ADAM28 mRNA in CLL cells by qPCR, with no knockdown of two control genes (CD200 and GAPDH). ADAM10 and ADAM17 siRNAs also attenuated specifically their respective ADAM mRNA expression (≥65%), without affecting

819

expression of the two other ADAMs tested. There was no significance difference in viability between cells treated with the siRNAs. Expression of both the 87- and 92-kDa bands of the ADAM28 protein was decreased at 72 h of transfection with siRNA (Fig. 4B). Supplementary material related to this article found, in the online version, at http://dx.doi.org/10.1016/j.leukres.2013.04.014. CLL cells from 12 individual patients were transfected with siRNA, and sCD200 levels measured in supernatants after 48, 72 and 96 h of treatment. Reduction in both ADAM28 mRNA expression and sCD200 levels was observed after 72 and 96 h of transfection (Fig. 4C: data for 72 h post-transfection). Summed over all 12 patients knockdown of ADAM28 mRNA expression was correlated with the decline in sCD200 levels in culture supernatants while siRNAs for ADAM10/17 produced no significant attenuation (≤10%) of sCD200 release (Fig. 4D). Again there was no correlation between loss of cell viability after siRNA treatment (≤15%) and sCD200 released into culture supernatants-Spearman’s rank correlation, r ≤ 0.14 (not shown).

3.4. Transfection of Ly5CD200+ cells with ADAM28cDNA augments shedding of sCD200 In a final study, we explored the effect of transfection of ADAM28 cDNA into Ly5 lymphoma cells known to overexpress the membrane product of human CD2008 on shedding of sCD200 from those cells. Ly5 cells themselves do not express ADAM28 by PCR analysis (data not shown). Supplementary Figure 3 shows that at 48 h of culture with cells transfected with 2 ␮g of plasmid DNA encoding ADAM28, sCD200 release into culture supernatants was twice that seen from cultures transfected with control DNA (levels were not significantly different from that in supernatants of non-transfected control cultures).

Fig. 3. Equivalent and independent mRNA expression of isoforms of ADAM28 (m and s), assessed by q PCR in 18 patients (A/B); 87/92 kDa mADAM28 (commercial antibody) from separate patients (C), absent in Hek cells. ␤-actin shown in lower panel.

820

T. Twito et al. / Leukemia Research 37 (2013) 816–821

Fig. 4. (A) Gene specific ADAM silencing (qPCR) in CLL. (B) Protein expression in CLL after treatment with ADAM28 or control siRNA. (C) ADAM28 mRNA in CLL using control/ADAM28siRNA (−/+) and sCD200 in cell supernatants (upper/lower panels). (D) sCD200 levels after ADAMsiRNA treatment of patients in (C).

Supplementary material related to this article found, in the online version, at http://dx.doi.org/10.1016/j.leukres.2013.04.014.

4. Discussion Immunosuppression in CLL patients is a significant problem, with patients frequently dying of infectious disease and generally rendering attempts at immunotherapy unsuccessful. The cell surface ligand, CD200, is known to deliver immunosuppressive signals and this molecule is over-expressed in several hematologic and solid tumor malignancies 4–6 [24–26]. Increased CD200 expression is correlated with the disease progression [6,9], though for CLL this correlation is best observed for the soluble form of CD200 in patient plasma, sCD200, and not with cell-bound CD200 [10]. This latter observation in turn heightens interest in the mechanism(s) involved in regulation of release of surface CD200 into the plasma as sCD200. We identified overexpression of ADAMs 9, 10, 17, 28, and 30 in B-cell CLL, with a corresponding decrease in expression of ADAM 8 and 12. ADAM28 mRNA expression in CD5+ CLL cells was most strongly associated with levels of sCD200 in patient plasma, and treatment with siRNA for ADAM28 proved optimal for suppression of sCD200 release from fresh CLL cells (Fig. 4). Treatment with siRNAs caused some loss of cell viability (≤15%), but changes in sCD200 release were not associated with altered cell death. These data are most consistent with the hypothesis that ADAM28 plays a key role in the shedding of CD200 from the cell surface in CLL. Two distinct ADAM28 transcripts have been identified [22] with the one encoding a prototypical protein and the other a secreted form (ADAM28-m and ADAM28-s respectively). ADAM28-s is preferentially expressed in spleen and lymph node, suggesting that the two forms may express different functions in different tissues. However, we observed no correlation between ADAM28s mRNA levels and sCD200 (data not shown), implying that the ADAM28m is the most important form involved in shedding of sCD200.

ADAM28 expression is increased in human breast and nonsmall cell lung carcinomas, with a positive correlation between cancer cell proliferation and lymph node metastasis [27]. Inhibition of ADAM28 activity by ADAM inhibitors/siRNAs reduced cell proliferation and cell signaling, and eventually reduced tumor growth itself in a xenograft breast cancer mouse model [19]. Our data also suggest a role for ADAM28 in release of sCD200 from the CD200-transfected breast cancer line, MDA-MB-231CD200 – see supplementary Figure 2. Immunoblotting analyses with a commercial anti-ADAM28 antibody directed against the cytoplasmic domain showed protein bands of 87/92 kDa in B-cell CLL cells (Fig. 3D). Since this domain is not present in ADAM28-s, and based on the predicted molecular weight of the transmembrane ADAM28-m (85 kDa), we feel the 87/92 kDa protein bands are most likely the active form of ADAM28m expressed by CLL cells. A protein of similar size was reported previously in normal peripheral blood leukocytes, with an 87 kDa band for the ADAM28m and 67 kDa band for the ADAM28s [22]. Both in vitro and in vivo data to show a significant correlation between the membrane form of ADAM28 (ADAM28m) and sCD200 levels measured in CLL plasma, and in culture supernatants of non-stimulated CLL cells. Immunosuppressive activity in CLL plasma is removed by absorption over an anti-CD200 column [9], Recent studies (Wong et al., in preparation) have confirmed that the sCD200 released from CLL cells lacks the cytoplasmic epitopes of the full length (membrane bound) CD200, and that, at least following PMA stimulation of CLL cells (which significantly augments shedding of sCD200), loss of cell surface CD200 (by FACS) is correlated with increased sCD200 in culture supernatants. These additional studies have shown both that other synthetic commercial inhibitors of metalloproteinases, and even physiologic tissue inhibitors (TIMPs), can suppress release of sCD200 from CLL cells, and that the sCD200 released can bind to, and induce intracellular signaling of, the CD200 receptor, CD200R1. Taken together the data show above suggest that in CLL, in addition to consideration of the clinical utility of novel therapies

T. Twito et al. / Leukemia Research 37 (2013) 816–821

directed at blockade of CD200 expression/function, there may be benefit to targeting inhibition of release of sCD200 by inhibition of expression/function of ADAM28.

[9] [10]

Funding These studies were supported by a grant from CIHR (Canada) to RMG. Conflict of interest

[11] [12] [13] [14]

All authors attest to the fact that they have no conflict of interest to divulge. Acknowledgements None.Contributions. TT, DS and RMG contributed to the design of the study and interpretation of all data. TT, IK, and KW were responsible for the majority of the research experimentation. ZC performed all work related to the analysis of the effect of cloned ADAM28 on sCD200 release. TT and RMG were primarily responsible for writing the manuscript. References [1] Foa R, Catovsky D, Brozovic M, Ooyirilangkumaran T, Cherchi M, Galton DAG. Clinical staging and immunological findings in chronic lymphocytic leukaemia. Cancer 1979;44:483–7. [2] Gorczynski RM. CD200 and its receptors as targets for immunoregulation. Curr Opin Invest Drugs 2005;6:483–8. [3] Wright GJ, Jones M, Puklavec MJ, Brown MH, Barclay AN. The unusual distribution of the neuronal/lymphoid cell surface CD200 (OX2) glycoprotein is conserved in humans. Immunology 2001;102:173–9. [4] KretzRommel A, Qin FH, Dakappagari N, Ravey EP, McWhirter J, Oltean D, et al. CD200 expression on tumor cells suppresses antitumor immunity: new approaches to cancer immunotherapy. J Immunol 2007;178: 5595–605. [5] Moreaux J, Veyrune JL, Reme T, DeVos J, Klein B. CD200: a putative therapeutic target in cancer. Biochem Biophys Res Commun 2008;366:117–22. [6] Tonks A. CD200 as a prognostic factor in acute myeloid leukemia. Leukemia 2007;21:566–8. [7] McWhirter JR, KretzRommel A, Saven A, Maruyama T, Potter KN, Mockridge CI, et al. Antibodies selected from combinatorial libraries block a tumor antigen that plays a key role in immunomodulation. Proc Natl Acad Sci USA 2006;103:1041–6. [8] Palumbo GA, Parrinello N, Fargione G, Cardillo K, Chiarenza A, Berretta S, et al. CD200 expression may help in differential diagnosis between mantle

[15]

[16]

[17]

[18]

[19]

[20]

[21]

[22]

[23] [24]

[25]

[26]

[27]

821

cell lymphoma and B-cell chronic lymphocytic leukemia. Leuk Res 2009;33: 1212–6. Wong KK, Khatri I, Shaha S, Spaner DE, Gorczynski RM. The role of CD200 in immunity to B cell lymphoma. J Leuk Biol 2010;88:361–72. Wong KK, Brenneman F, Chesney A, Spaner DE, Gorczynski RM. Soluble CD200 is critical to engraft chronic lymphocytic leukemia cells in immunocompromised mice. Cancer Res 2012;72:4931–43. Blobel CP. ADAMS. key players in EGFR-signaling, development and disease. Nat Rev Mol Cell Biol 2005;6:32–43. Murphy G. The ADAMs: signalling scissors in the tumour microenvironment. Nat Rev Cancer 2008;8:929–41. Duffy MJ, McKiernan E, Odonovan N, McGowan PM. The role of ADAMs in disease pathophysiology. Clin Chim Acta 2009;403:31–6. Peduto L. ADAM9 as a potential target molecule in cancer. Curr Pharm Des 2009;15:2282–7. Mazzocca A, Coppari R, DeFranco R, Cho JY, Libermann TA, Pinzani M, et al. A secreted form of ADAM9 promotes carcinoma invasion through tumor-stromal interactions. Cancer Res 2005;65:4728–38. Verbisck NV, Costa ET, Costa FF, Cavalher FP, Costa MDM, Muras A, et al. ADAM23 negatively modulates alpha(V)beta(3) integrin activation during metastasis. Cancer Res 2009;69:5546–52. Fry JL, Toker A. Secreted and membrane-bound isoforms of protease ADAM9 have opposing effects on breast cancer cell migration. Cancer Res 2010;70:8187–98. Howard L, Maciewicz RA, Blobel CP. Cloning and characterization of ADAM28: evidence for autocatalytic pro-domain removal and for cell surface localization of mature ADAM28. Biochem J 2000;348:21–7. Mitsui Y, Mochizuki S, Kodama T, Shimoda M, Ohtsuka T, Shiomi T, et al. ADAM28 is overexpressed in human breast carcinomas: implications for carcinoma cell proliferation through cleavage of insulin-like growth factor binding protein-3. Cancer Res 2006;66:9913–20. Ohtsuka T, Shiomi T, Shimoda M. ADAM28 is overexpressed in human nonsmall cell lung carcinomas and correlates with cell proliferation and lymph node metastasis. Int J Cancer 2006;118:263–73. Mochizuki S, Shimoda M, Shiomi T. ADAM28 is activated by MMP-7 (matrilysin1) and cleaves insulin-like growth factor binding protein-3. Biochem Biophys Res Commun 2004;315:79–84. Roberts CM, Tani PH, Bridges LC. MDC-L, a novel metalloprotease disintegrin cysteine-rich protein family member expressed by human lymphocytes. J Biol Chem 1999;274:29151–9. Livak KJ, Schmittgen TD. Analysis of relative gene expression data using realtime quantitative PCR and the 2(−C(T)) method. Methods 2001;25:402–8. Siva A, Xin H, Qin F, Oltean D, Bowdish KS, Kretz-Rommel A. Immune modulation by melanoma and ovarian tumor cells through expression of the immunosuppressive molecule CD200. Cancer Immunol Immunother 2008;57:987–96. Kawasaki BT, Mistree T, Hurt EM, Kalathur M, Farrar WL. Co-expression of the tolerogenic glycoprotein CD200, with markers for cancer stem cells. Biochem Biophys Res Commun 2007;364:778–82. Stumpfova M, Ratner D, Desciak EB, Eliezri YD, Owens DM. The immunosuppressive surface ligand CD200 augments the metastatic capacity of squamous cell carcinoma. Cancer Res 2010;70:2962–72. Ohtsuka T, Shiomi T, Shimoda M, Kodama T, Amour A, Murphy G, et al. ADAM28 is overexpressed in human non-small cell lung carcinomas and correlates with cell proliferation and lymph node metastasis. Int J Cancer 2006;118:263–73.