Ectopic dendrite initiation: CNS pathogenesis as a model of CNS development

Int. J. Devl Neuroscience 20 (2002) 373–389

Ectopic dendrite initiation: CNS pathogenesis as a model of CNS development夽 Donald A. Siegel∗ , May K. Huang, Shannon F. Becker Department of Neuroscience, Albert Einstein College of Medicine, Kennedy Center, 1410 Pelham Parkway So., Bronx, NY 10461, USA Received 25 January 2002; received in revised form 26 April 2002; accepted 30 April 2002

Abstract The neuronal storage diseases are a rare group of disorders with profound clinical consequences including severe mental retardation and death in early childhood. A subset of these disorders, those with elevated levels of GM2 ganglioside, are further characterized by the reinitiation of primary dendrites on mature cortical neurons. These ectopic dendrites are unusual as primary dendrite initiation is normally confined to a narrow developmental window. Thus, ectopic dendritogenesis appears to be a recapitulation of the normal developmental program temporally displaced. Consequently, understanding ectopic dendritogenesis should offer insights into both the pathogenesis of the neuronal storage diseases as well as mechanisms of normal CNS development. Using a feline model of GM2 gangliosidosis, we compared patterns of gene expression in normal newborn and mature diseased animals (both undergoing active primary dendritogenesis) with normal, mature controls (where primary dendritogenesis has ceased). From this work, we have identified two genes that appear to function in primary dendrite initiation. One, tomoregulin, is an integral membrane protein with both EGF- and follistatin-like motifs in its extracellular domain. The second, Tristanin, is a member of the positive regulatory domain (PRD) family of a zinc-finger transcription factors. Both genes are up regulated in the disease state, and both show a shift in their intracellular location to the nucleus in diseased animals that is not observed in age matched controls. In normal mouse brain, tomoregulin and Tristanin reveal developmental patterns consistent with a role in dendrite initiation and show changes in subcellular localization similar to that observed in the cat. © 2002 ISDN. Published by Elsevier Science Ltd. All rights reserved. Keywords: Tristanin; Tomoregulin; Primary dendritogenesis; Epidermal Growth Factor (EGF); Follistatin; Positive Regulatory Domain (PRD)

1. Introduction The dendritic arbor of cortical pyramidal cells is of fundamental importance in mentation and cognition. It has been estimated that over 90% of postsynaptic surface area is accounted for by the dendritic tree (Jacobson, 1991) and that synaptogenesis during early postnatal development occurs at the robust rate of between 10,000 and 40,000 synapses formed per second (Rakic et al., 1994). Rakic, Bourgeois and Goldman-Rakic argue that “synaptic architecture defines the Abbreviations: ARF3, ADP-ribosylation factor 3; BAC, bacterial artificial chromosome; EGF, epidermal growth factor; FF, follistatin–follistatin domain; PRDM, positive regulatory domain member; Ribo, ribosomal protein L12; Tris, Tristanin; TR, tomoregulin 夽 Sequence data for clones described in this article have been deposited in the GenBank data bank. Accession numbers are as follows: Tristanin AF503171, Unk1 AF503172, BAC16 AF503173. ∗ Corresponding author. Tel.: +1-718-430-2388; fax: +1-718-430-8821. E-mail address: [email protected] (D.A. Siegel).

limits of individual mental capacity and provides the framework for comprehending the major psychiatric disorders” (Rakic et al., 1994). It also provides a framework for understanding mental retardation. Alterations in dendritic tree architecture, dendritic atrophy, agenesis and ectopic dendrite growth, have all been hypothesized to be causative in numerous forms of mental retardation (Marin-Padilla, 1972, 1974, 1976; Purpura, 1974, 1978, 1979; Purpura and Suzuki, 1976). Yet, despite the importance of the dendritic arbor in both normal and abnormal cognitive function, little is known about the mechanisms that control its initiation and development. We have taken a unique approach toward understanding these processes. During normal cortical development, cells migrate from the ventricular zone outward building the multi-tier neocortex in successive layers from the inside, closest to the ventricular zone, outward. After completing migration, neurons undergo an explosive burst of dendritogenesis that is not repeated during the lifetime of the cell, with one notable

0736-5748/02/$22.00 © 2002 ISDN. Published by Elsevier Science Ltd. All rights reserved. PII: S 0 7 3 6 - 5 7 4 8 ( 0 2 ) 0 0 0 5 5 - 2

374

D.A. Siegel et al. / Int. J. Devl Neuroscience 20 (2002) 373–389

exception. In several of the lysosomal storage disorders, typified by but not restricted to Tay–Sachs disease (GM2 gangliosidosis), mature cortical pyramidal cells respond to the storage of GM2 ganglioside by initiating new primary dendrites. Evidence suggests that this process is a recapitulation of the normal developmental mechanism temporally displaced (Purpura and Suzuki, 1976; Purpura, 1978; Siegel and Walkley, 1994; Walkley et al., 1998). Consequently, this group of disorders opens a unique avenue of approach to specifically tease out the molecular mechanisms controlling normal dendrite initiation from the myriad of other complex processes occurring in the developing brain. By comparing patterns of gene expression in normal developing cortex and mature diseased cortex (both undergoing active primary dendritogenesis) with mature normal cortex where primary dendritogenesis does not occur, it should be possible to isolate genes specific to the process of dendrite initiation. We have exploited a well-documented feline model of GM2 gangliosidosis and the technique of PCR-based subtractive hybridization to identify genes important in this process. The storage disease model is an authentic biochemical and morphological replica of human Sandhoff disease (a variant of GM2 gangliosidosis similar to Tay–Sachs disease) (Cork et al., 1977, 1979). Cortical pyramidal neurons of affected cats exhibit prolific ectopic dendritogenesis. Primary dendritogenesis in normal kittens peaks within the first week of age, and by 4–6 weeks neurons appear mature. Thus, in this work, we have compared the two states of active primary dendritogenesis (a 3-day-old normal kitten and a 3-month-old GM2 cat) with mature, normal cortical tissue where primary dendritogenesis has ceased (a 3-month-old normal cat). A distinct advantage of this project is that the three-way comparison adds a level of stringency to the technique. Only those messages that are common to both the developing newborn and the Sandhoff brains, but absent or significantly reduced in the normal, mature brain (or conversely present in normal brain, but absent or reduced in the developing and Sandhoff brains) are pursued. By comparing three tissue samples, the number of false positives that might otherwise be followed is reduced. From our initial screen, we have identified two genes that appear to function in primary dendrite initiation. One is tomoregulin (TR), a recently discovered transmembrane protein with a unique extracellular domain containing both EGF- and follistatin-like motifs and a possible intracellular G-protein binding domain (Horie et al., 2000; Liang et al., 2000; Uchida et al., 1999). The second gene is a novel zinc-finger transcription factor of the positive regulatory domain (PRD) family we have designated Tristanin (Tris). We have obtained full length cDNAs as well as made antibodies to both. Results from Northern and Western blots and immunocytochemistry in both the feline model of GM2 gangliosidosis and developing mouse brain suggest these genes may play a fundamental role in dendrite initiation during development and in disease.

2. Materials and methods 2.1. Preparation of mRNA and cDNA for PCR subtraction Total RNA was prepared by the guanidine thiocyanate method (Chomczynski and Sacchi, 1996). The only modification was that the total RNA pellet was extracted a second time following the same procedure but using half the original volume of guanidine. RNA was quantified spectrophotometrically at A260 and quality checked by monitoring 18S and 28S ribosomal RNAs by alkaline/agarose gel electrophoresis. The mRNA was isolated using Qiagen’s Oligotex mRNA Kit following manufacturer’s instructions, and quantified by fluorescence with Molecular Probes RiboGreen RNA Quantitation Kit. Full length double stranded cDNA was prepared using Gibco/BRL SuperScript Choice System as per manufacturer’s instructions and quantified by spotting aliquots on agarose/ethidium bromide plates and comparing against known amounts of DNA. Sequences of adaptors A and B (Huang et al., 1998) are as follows: A1: 5 -pTAG TCC GAA TTC AAG CAA GAG CAC A-3 , A2: 5 -CTC TTG CTT GAA TTC GGA CTA-3 , B1 5 -pATG CTG GAT ATC TTG GTA CTC TTC A-3 , B2 5 -GAG TAC CAA GAT ATC CAG CAT-3 . A1 and B1 were prepared with 5 phosphates. Oligonucleotides were from Research Genetics, Huntsville, AL. For subtractions, [32 P] labeled tracers and biotinylated drivers were prepared using the polymerase chain reaction (PCR); Taq thermostable DNA polymerase and biotinylated Bio-11-dUTP were from Sigma, [32 P]dCTP from New England Nuclear and dNTPs from Gibco/BRL. 2.2. PCR-based subtractive hybridization and cloning The method followed was primarily that of Patel and Sive (1996). In short, mRNA was isolated from the same area of cerebral cortex from three littermate cats: a 3-day-old normal kitten (K), a 3-month-old normal cat (control C) and a 3-month-old GM2 gangliosidosis cat (G), and full length double stranded cDNA prepared as described. Aliquots of cDNA were digested with Alu I and Rsa I (New England Biolabs, Beverly, MA) to produce fragments averaging between 200 and 600 base pairs in length. This is done to eliminate the amplification advantage of short cDNAs over longer ones during PCR. Following digestion, adaptor A (sequence above) was ligated to the kitten and GM2 samples (designated K0 , and G0 , respectively) and adaptor B to the 3-month-old normal control (designated C0 ). The adaptors serve as unique priming sites for amplification of the two cDNA populations to be subtracted, they also contain distinct restriction sites for cloning following subtraction (A = EcoRI, B = EcoRV). Subtractions are done in both directions, i.e. A−B and B−A, as it is not possible to know a priori whether a message of interest is up- or downregulated in the biological process under examination. In this

D.A. Siegel et al. / Int. J. Devl Neuroscience 20 (2002) 373–389

375

work, two separate pairs of subtractions were performed (Section 3). In a typical subtraction, one sample, A, is amplified with 32 P; this is designated as the tracer (which remains after subtraction). The second sample, B, is amplified with biotinylated dUTP, and is designated the driver. Tracer and driver are mixed at a molar ratio of 1:20. The strands are separated by heating and allowed to anneal. Sequences common to tracer and driver base pair and are removed with avidin. Sequences unique to the tracer remain after subtraction. As a single subtraction is insufficient to remove all common sequences, additional subtractions are done. Two types of subtractions are performed. In the first, tracer and driver are annealed for 2 h, this removes common sequences that are abundant in both samples. In the second subtraction, samples are annealed for 30–40 h. This removes rare as well as abundant common sequences. All short subtractions are performed with initial starting materials as drivers (i.e. A0 or B0 ); long subtractions use the most recently subtracted cDNAs as drivers (An or Bn ). Subtraction efficiency is monitored and subtractions stopped when the subtracted samples (An and Bn ) are cross-hybridized on dot blots and the subtracted sample hybridizes to itself with a signal at least 20-fold stronger than it hybridizes to its oppositely subtracted sample (i.e. An binds to itself with a signal 20-fold greater than it does to Bn ). The number of subtractions necessary to achieve this end, depends on the complexity of the starting material’s mRNA, i.e. the number of different messages, not the amount of message. Subtracted cDNAs were cloned into pBluescript and transfected into XL1-Blues (Stratagene). Dot and Northern blots used Magna Charge nylon membranes (Osmonics Inc., Westborough, MA). Probes were labeled with [32 P] by PCR using A1 or B1 primers, or by random priming with RTS RadPrime DNA Labeling System (Gibco/BRL). Blots were hybridized in RapidHyb (Amersham) at 65 ◦ C and washed to between 0.5 and 1.0× SSPE/1.0% SDS at 65 ◦ C for a minimum of 30 min and exposed to XAR film (Kodak) in double screened cassettes at −80 ◦ C.

to get single pick clones following the same procedures. Plasmids were excised following manufacturer’s instructions, and sequenced three times at our in-house sequencing facility. Tristanin cDNA was obtained by PCR screening of a human fetal brain cDNA library by Incyte Genomics Inc. (St. Louis, MO) using forward primer TAAACTGCGACTCCACATGC and reverse primer TGTCGTAGTCTGTGGACGTGA; Tris insert was sequenced three times by our in-house sequencing facility.

2.3. cDNA library screening

All organ samples were homogenized in 10 volumes of lysis buffer containing protease inhibitors (20 mM HEPES, pH 7.2, 1% Igepal CA-630, 10% glycerol, 1 mM Na3 VO4 , 50 mM NaF with 0.5 ␮g/ml leupeptin, 0.1 M N-ethylmaleimide, 1.0 ␮g/ml pepstatin A, 1 mM phenylmethylsulfonyl fluoride). Homogenates were spun at 21,000 × g for 15 min at 4 ◦ C. Protein concentration was determined using the Bradford method (Simonian and Smith, 1996). Samples were diluted with H2 O; BSA, in the presence of appropriate concentrations of lysis buffer, was used as standard. Two micrograms of supernatant protein were loaded on 4–15% gradient polyacrylamide gels and transferred to PVDF-Plus 0.1 ␮m membranes (Osmonics Inc.). Blocking was in 5% non-fat milk. Our anti-tomoregulin antibody (2.2 mg/ml) was typically used at a dilution of 1:10,000, and anti-Tristanin antibody (0.21 mg/ml) typically

A 19-week-old mouse brain ␭ cDNA library (Stratagene) was screened by DNA hybridization following manufacturer’s instructions, using Magna Lift nylon membrane disks (82 and 132 mm, Osmonics Inc.). Colonies (106 on 20 150 mm plates) were fixed to membranes by flash heating in an autoclave at 250 ◦ F and UV cross-linking at 120 mJ (Stratagene UV Stratalinker 1800). Membranes were washed, and prehybed in 6× SSC, 5× Denharts, 0.1% SDS and 160 ␮g/ml sonicated salmon sperm (Sigma). Membranes were hybridized with 107 DPM of PCR labeled probe/ml of hybridization solution (same as prehyb) at 65 ◦ C overnight, and washed to 0.5× SSC/0.1% SDS and put against film in double screened cassettes at −80 ◦ C. Primary colonies were rescreened three additional times

2.4. Northern blots All Northern blots were prepared from 0.5 ␮g mRNA and run on alkaline formaldehyde gels with mRNA size standards (Gibco/BRL). Following electrophoresis, gels were washed 2× 10 min with 5 volumes DEPC water followed by 2× 15 min in 5 volumes 10× SSC (DEPC). Standards were cut away from the gel and stained with SYBR Green II (Molecular Probes); the remaining gel was transferred to Magna Charge nylon membranes (Osmonics Inc.) by capillarity and RNA fixed by UV cross-linking. Membranes were probed overnight with 107 DPM [32 P] labeled probe/ml RapidHyb at 65 ◦ C, washed as described for dot blots, and exposed to film with double screens at −80 ◦ C. 2.5. Antibodies Rabbit antibodies to tomoregulin were prepared against a 20 amino acid synthetic peptide (DDRENDLFLCDTNTCKFDGE, aa 60–79) cross-linked to keyhole limpet hemocyanin (KLH). Antibodies to Tristanin were prepared in a similar fashion using the 15 amino acid peptide (ESQSELEEKQTSALS, aa 1001–1015). Both antibodies were produced and affinity purified by column chromatography prepared with their respective immunizing peptides by Research Genetics Inc. 2.6. Western blots

376

D.A. Siegel et al. / Int. J. Devl Neuroscience 20 (2002) 373–389

at 1:200. Primary antibody incubations were overnight at room temperature. Secondary antibody, goat anti-rabbit IgG conjugated to horseradish peroxidase (Jackson Labs), was typically used at 1:200,000. Antibody binding was detected by chemiluminescence (ECL Plus, Amersham). 2.7. Immunocytochemistry (ICC) Following deep anesthesia, animals were perfused with ice cold PBS followed by ice cold 4% paraformaldehyde (PFA) in PBS. Tissues were kept in PFA overnight at 4 ◦ C and then washed extensively in PBS and kept at 4 ◦ C. Both cryostat and vibratome sections were used. Staining was done using the Vectastain Elite ABC Peroxidase Kit (Vector Labs, Burlingame, CA) following manufacturer’s instructions. Sections were blocked in 2% normal goat serum (NGS), 1% BSA, 0.1% Triton X-100 in PBS. TR and Tris antibodies were typically used at dilutions of 1:6000 and 1:400, respectively. Diluent was 1% NGS, 1% BSA, 0.1% Triton X-100 in PBS. The secondary was biotinylated goat anti-rabbit IgG (Vector Labs), followed by avidin–peroxidase and DAB. Cat brain tissues were generously provided from the GM2 gangliosidosis colonies of Drs. Steven U. Walkley, Albert Einstein College of Medicine, and Henry Baker, Auburn University. Mice were C57BL/6Js from Jackson Labs.

3. Results 3.1. Subtraction cDNAs were prepared from the cortices of a 3-day-old normal kitten (K0 ), 3-month-old normal cat (control, C0 ) and a 3-month-old GM2 gangliosidosis cat (G0 ), and two separate pairs of subtractions preformed. The first subtraction pair was kitten−mature control (K−C) and vice versa (C−K); the second subtraction pair was GM2−mature control (G−C) and vice versa (C−G). As a single subtraction is insufficient for substantial enrichment, multiple subtractions were performed and every third subtraction monitored for enhancement. This was done by spotting 100 ng of each of the four subtracted cDNA, as well as the three starting cDNAs, on strips of nylon membrane and probing each strip with one of these same samples labeled with [32 P]dCTP. In total, nine subtractions were performed for each sample. The final subtracted libraries were designated: K9 (Kitten−Control), Ck9 (Control−Kitten), G9 (GM2−Control), and Cg9 (Control−GM2). Fig. 1 demonstrates the dramatic enrichment of cDNAs obtained following the ninth subtraction. Row 1, for

2.8. Tissue culture Cortical neuronal cultures were prepared from E14 C57BL/6J mice. Approximately 0.5 × 106 cells were plated in 3.5 cm dishes, on acid washed coverslips coated with poly-D-lysine, in DMEM supplemented with glucose, pyruvate, B27 supplement, 5% fetal bovine serum (FBS) and antibiotic/antimycotic. After 3–4 days in vitro (DIV), cells were fed with Neurobasal media supplemented with glucose, glutamine, B27 supplement, 2.5% FBS and antibiotic/antimycotic. Thereafter, media was changed every third day by removing 50–66% of old media and adding fresh Neurobasal-supplemented media. All cell culture reagents were from Gibco/BRL. For immunocytochemistry cells were washed in DMEM without serum prior to fixation. Cells were fixed in 4% paraformaldehyde/4% sucrose in PBS at 4 ◦ C × 45 min, washed 3× 5 min with PBS, 1× 30 min with 0.1% Triton X-100/PBS, and 4× 5 min with PBS. Blocking was done in 10% NGS with 0.1% Triton X-100 in PBS for 30 min. Cells were incubated with primary antibodies (TR at 1:500, and MAP2 (mouse IgG, clone no. AP-20, Sigma) at 1:100) in 0.1% Triton X-100 in PBS overnight at 4 ◦ C, washed 3× 10 min with PBS, incubated with appropriate secondary antibody conjugates (Alexa Fluor 488 goat anti-mouse IgG typically at 1:1000, and Alexa Fluor 546 goat anti-rabbit IgG typically at 1:1000 (Molecular Probes)) for 1 h, and washed 6× 10 min with PBS. Cover-slips were mounted with ProLong Antifade (Molecular Probes).

Fig. 1. Dot blot evaluating cDNA enrichment after nine subtractions. One hundred nanograms of each subtracted or starting cDNA was spotted, in duplicate, on strips of nylon membrane (columns designated along the top of the figure). Each of the seven strips (numbered) were then probed separately with one of the subtracted or starting cDNAs labeled with [32 P]dCTP (designated to the right of the figure). The results show a dramatic enrichment of subtracted cDNAs over starting materials, e.g. in Row 1, K9 vs. K0 . Equally important, the presence of multiple signals in the subtracted libraries, e.g. K9 and G9 in Row 1, suggest that mature GM2 and newborn cat cortices express common genes not expressed in mature normal cortex, e.g. Ck9 in Row 1. See text for abbreviations.

D.A. Siegel et al. / Int. J. Devl Neuroscience 20 (2002) 373–389

example, shows that the K9 subtracted library hybridized strongly to itself, but negligibly to its oppositely subtracted library Ck9 . Likewise, Row 5 shows that Ck9 subtracted cDNA binds strongly to itself, but does not bind its oppositely subtracted mate K9 . This same binding pattern may be seen in the G9 and Cg9 subtraction pair (Rows 2 and 6, respectively). Most interesting however, are the strong cross-hybridization signals observed between the kitten and GM2 subtracted libraries. Row 1, for example, shows that K9 (the K−C subtracted library) not only binds avidly to itself, but also to G9 (the G−C subtracted library). Similarly, Row 2 shows that G9 bind strongly to both itself and K9 . This same cross-hybridization is observed between Ck9 and Cg9 (Row 5) and Cg9 and Ck9 (Row 6). These data suggest that the 3-day-old normal kitten and 3-month-old diseased cat express common genes that are absent in the normal 3-month-old cat and vice versa, and strongly support the fundamental hypothesis on which this work is based.

377

3.2. Differential screen In order to identify specific genes shared between the GM2 and newborn subtracted cDNAs, the G9 subtracted library was cloned into pBluescript and plated on selective media. Fifty random clones were picked and spotted onto six identical gridded membranes resting on selective plates. Following overnight growth, colony DNA was fixed to the membranes in alkali solution, neutralized and UV cross-linked. Duplicate membranes were probed with [32 P] labeled G9 , K9 and Cg9 subtracted cDNAs (Fig. 2). As expected, G9 bound strongly to itself (Row 1), however, K9 also bound strongly to a significant number of G9 clones (Row 2, nos.: 3, 5–7, 13, 16, 21–24, 26–28, 31, and 40), thus identifying commonly expressed genes. Control Cg9 cDNA bound only weakly to three clones nos.: 12, 15 and 31 (Row 3). Further, comparison of these filters reveals other information as well. For example, many of the colonies that labeled strongly with GM2 subtracted cDNA (G9 ) are unique

Fig. 2. Autoradiograph of 50 randomly selected clones from the GM2 subtracted cDNA library probed with 32 P labeled cDNAs from the mature GM2 (G9 ), newborn (K9 ), and mature normal (Cg9 ) subtracted libraries. Clones in Rows 1 and 2 sharing common signals represent genes commonly expressed in the kitten and mature GM2 subtracted libraries. Clones unique to Row 1 may represent genes upregulated in the diseased animal. Row 3 shows the same 50 clones probed with the oppositely subtracted Cg9 library. The six membranes in this figure have the same 50 clones. Right and left filters are hybridization pairs. (∗ ) On this membrane spots 31 and 39 were reversed.

378

D.A. Siegel et al. / Int. J. Devl Neuroscience 20 (2002) 373–389

to the diseased animal, i.e. they do not show a hybridization signal when probed with newborn subtracted cDNA (K9 ), e.g. nos.: 2, 11, 14, 17, 30, 32–39, 41, 42, 44–48, and 50. These clones likely represent genes specifically upregulated in response to the disease process and are unlikely to be directly related to dendritogenesis. More interesting, however, are clones 21, 22, 28, and 40 which show a stronger signal when probed with newborn subtracted cDNA than with GM2 subtracted cDNA. These clones may represent genes abundantly expressed during normal cortical development but only minimally, although significantly, upregulated in the disease state. This would, at least on a teleological level, make sense, since dendritogenesis is occurring to a far greater extent in the normal developing brain than in the diseased brain. 3.3. Picking and identifying clones Three types of clones were picked, those giving equally strong signals when probed with both GM2 and newborn cDNAs, Group 1 (nos.: 3, 5, 16, 23, 24, 26, and 27), one clone which gave its strongest signal when probed with newborn cDNA, Group 2 (no.: 40), and three clones which hybridized almost exclusively with GM2 subtracted cDNA, Group 3 (nos.: 2, 47, and 50; Table 1). Plasmids from these 11 clones were purified. Sequence analysis revealed that eight had single insert, and that three were chimeric, two with two inserts and one with three, giving a total of 15 inserts. The presence of multiple inserts was suggested by the occurrence of internal EcoRI sites within the clones (GM2 subtracted cDNA was cloned into the pBluescript EcoRI cloning site). This was subsequently confirmed by a BLAST search. The BLAST search of the 15 inserts revealed that they represent seven distinct categories of genes: five with homologies to published sequences (all clones in categories with multiple inserts, Table 1, were overlapping). Of the five, three are known genes: ribosomal protein L12 (Ribo), ADP-ribosylation factor 3 (ARF3) and the recently identified gene tomoregulin (TR). The two remaining inserts have homologies to cloned sequences of unknown function: one

Fig. 3. Northern analysis of tomoregulin (TR), Tristanin (Tris) and ribosomal protein L12 (Ribo) in newborn (K), GM2 (G) and normal mature (C) cat brain. TR and Tris each have two bands, suggesting splice variants may exist. The smaller bands of both genes and the single Ribo band show greatest expression in the newborn. Cortical mRNA 0.5 ␮g/lane. Glyceraldehyde 3-phosphate dehydrogenase (GAPDH) was used to determine equality of loading. RNA standards noted at left.

to a segment of a human chromosome 16 bacterial artificial chromosome (BAC16), the other to a recently published sequence from fetal human brain that we have now designated Tristanin (Tris). Homologies of known clones to human sequences are strong, ranging from 82 to 94%. 3.4. Northern analysis: cat brain To examine differential gene expression in the three different cat brains, clones from each category (Table 1) were labeled with [32 P]dCTP and hybridized to Northern blots prepared with 0.5 ␮g of whole brain mRNA from newborn, mature GM2 and mature normal cats. Tomoregulin, Tristanin and Ribo revealed differential patterns of expression (Fig. 3); TR and Tris also showed multiple transcripts. TR has two bands, one <1.35 kb, the other between 2.37 and 4.4 kb. Tris has bands at approximately 1.35 and 2.37 kb. For both TR and Tris, it is the smaller transcripts that appear to be differentially expressed, both are up regulated in the new born. The BAC16 clone revealed three bands by Northern analysis. Two were equally expressed in all three animals, one

Table 1 Clones isolated by PCR-based subtractive hybridization Clone no.

Size (bp)

Category

Percentage of homology to human

Group

3, 5, 16, 23.1a , 26, 27 24.1a 40 2, 47, 50.1a 23.2a 23.3a , 24.2a 50.2a

148–257 282 113 134–145 289 211 28

Tristanin (Tris) Ribosomal protein L12 (Ribo) Tomoregulin (TR) Chromosome 16 BAC (BAC16) ARF3 Unknown 1 (Unk1) Unknown 2 (Unk2)

90–94 89 94 82–89 89 – –

1 1 2 3 1 1 3

BLAST search of 15 inserts identified by PCR-based subtractive hybridization fall into seven categories, five have homologies to sequences of known or unknown function, two have no known homologies. Group nos. refer to the hybridization pattern seen in Fig. 2: Group 1 hybridized most strongly with newborn and GM2 subtracted libraries, Group 2 with newborn alone, and Group 3 with GM2 only. a Chimeric clones.

D.A. Siegel et al. / Int. J. Devl Neuroscience 20 (2002) 373–389

band showed slightly greater expression in the kitten and diseased animals than the mature normal animal (data not shown). ARF3 and Unk1 showed no differences in expression between the three samples. Unk2 was not checked as its sequence was too short for good hybridization. Glyceraldehyde 3-phosphate dehydrogenase (GAPDH) is used to determine loading. Two important observations may be drawn from these data: (i) the two inserts that did not show differential gene expression (ARF3 and Unk1) are from chimeric clones and consequently would likely not have been identified had they not been covalently linked to truly differentially expressed genes, and (ii) the 11 clones from the original three groups remained segregated with respect to the genes they represent, i.e. clones from one group were not found in categories of another group (Table 1). 3.5. Northern analysis: mouse brain development To determine if TR, Tris and Ribo are developmentally regulated, Northern blots were prepared from whole mouse brain mRNA at postnatal days 0, 5, 10, 15, 20, as well as adult, and hybridized with [32 P] labeled probes (Fig. 4). In mouse, as in cat, both TR and Tris reveal multiple bands. For TR, three bands are apparent in the mouse, one at ∼1.35 kb and a second between 2.37 and 4.40 kb are similar in size to those observed in the cat. A third larger band, between 4.40 and 7.46 kb is absent in the cat. Both the largest and the smallest bands show declining expression after day 10 consistent with a role in dendrite initiation; for the 1.35 kb band, this is similar to what is observed in the cat (Fig. 3). The middle TR band shows a low level of expression in the adult, also consistent with what is observed in the cat Northern. The Tris mouse brain Northern shows two bands, one <1.35 kb, the other >7.49 kb. Expression of the larger transcript declines significantly after P10. The smaller transcript is expressed at nearly equal levels in the postnatal period, but

379

somewhat less in the adult. This is similar to the >1.35 kb cat transcript. The larger cat transcript, between 2.37 and 4.40 kb is absent in the mouse. The multiple bands observed for both Tris and TR suggest splice variants may exist, and that these variants may be developmentally regulated. This possibility is particularly intriguing with regard to what is known about the structure and function of these two genes (Section 4). Ribo shows its strongest signal at 0 days, declines steadily to 20 days but rises again in the adult. The developmental profile of this gene may reflect changes in protein synthesis occurring during development. GAPDH was used to determine loading. 3.6. Full length cDNAs and antibody production As the RNA expression patterns of tomoregulin and Tristanin in both the feline model of GM2 gangliosidosis as well as in normally developing mouse brain are consistent with roles in dendritogenesis, we focused attention on obtaining cDNAs and producing antibodies for both these genes. 3.7. Tomoregulin A full length cDNA for tomoregulin was isolated by screening a 19-week-old mouse brain ␭ phage cDNA library (Stratagene) by DNA hybridization using labeled cat TR as probe. The clone obtained is 1626 bp long, has an ORF of 1125 bp, and is nearly identical to that isolated by Uchida et al. (1999). The cat cDNA used as probe spanned the 3 end of the ORF and part of the 3 UTR of the mouse clone and is ∼92% identical to it. TR is a recently identified transmembrane protein with an EGF-like and two follistatin-like moieties on its extracellular domain (Uchida et al., 1999). Rabbit polyclonal antibodies were prepared using a 20 amino acid synthetic peptide located at the amino terminus of the protein encompassing part of the distal end of the last follistatin-like motif (Section 2).

Fig. 4. Message expression of TR, Tris and Ribo during postnatal mouse brain development. As in cat, TR and Tris reveal multiple transcripts suggesting possible splice variants. TR has three bands, the largest and the smallest of which show greatest expression at younger ages. Tris has two bands, the larger showing a significant decline in expression after P10, the smaller in the adult. Ribo also shows a declining expression pattern with age. Whole brain mRNA 0.5 ␮g/lane. A: adult; GAPDH: glyceraldehyde 3-phosphate dehydrogenase. RNA standards noted at left.

380

D.A. Siegel et al. / Int. J. Devl Neuroscience 20 (2002) 373–389

Fig. 5. Human Tristanin clone: (A) protein sequence: shaded area near the amino terminus represents part of the PR domain, bolded sequences are the 10 Zn-finger domains, lightly shaded and italicized area near the carboxy terminus represents the sequence used for preparing antibodies, and underlined sequence represents the area isolated in the original subtraction; (B) schematic representation of Tris; (C) comparison of Tris with other positive regulatory domain member (PRDM) proteins, clearly demonstrating that Tris is a member of this family of transcription factors. Top line represents consensus sequence; when evenly divided, Tris sequence was chosen.

D.A. Siegel et al. / Int. J. Devl Neuroscience 20 (2002) 373–389

3.8. Tristanin A full length human Tris cDNA was obtained using a PCR-based screening strategy from Incyte Genomics Inc. The Tris clone is 5838 bp long with a predicted open reading frame of 3072 bp. The cat subtraction fragment, from which primers were designed for the library screening, is near the center of the ORF (Fig. 5) and is 89% homologous to the human clone. Our full length cDNA is nearly identical to the human sequence in GenBank (Yang and Huang, 2000), however, it contains two deletions within the ORF, one short (12 bp) and one long (102 bp), and one insertion (6 bp) 3 of the ORF. The predicted proteins, except for the two deletions, are identical. That the deletions are multiples of three (consequently there are no frame shifts) suggest that the two sequences may represent alternate splice variants. Protein analysis by PSORT II identified 10 zinc-finger motifs of the Krüppel (CCHH) type (Fig. 5A). A comparison of Tris with other positive regulatory domain containing proteins (Fig. 5C) confirms that it is a member of that small group of zinc-finger transcriptions factors known as positive regulatory domain members (PRDM). The prototypical members that define this family are Blimp1, a mediator of B cell differentiation through down regulation of c-myc (Huang, 1994; Lin et al., 1997), and RIZ, a tumor suppressor that binds the retinoblastoma protein, and is primarily expressed in the CNS (Buyse et al., 1995; Huang et al., 1998). Rabbit antibodies to Tris were prepared against a 15 amino acid synthetic peptide at the carboxy terminus of the protein (Fig. 5A and B). 3.9. Western analysis: tomoregulin TR expression was examined by Western blot in newborn, GM2 and age matched control cat cortices. As may be

381

seen in Fig. 6(A), a single band of approximately 50 kDa, the expected size of this glycosylated protein (Uchida et al., 1999), is observed; preincubation of the antibody with the synthetic, immunizing peptide abolished the signal (data not shown). However, contrary to expectations, TR expression appears greatest in the 3-month-old normal cat and least in the 3-day-old kitten. This unanticipated pattern is repeated in developing mouse brain (Fig. 7A) where TR expression increases with age. Several explanations are possible for these observations. It may be, for example, that TR expression is regulated at the translational level, or that the antigenic determinant chosen for antibody production belongs solely to the >2.37 kb transcript which is not developmentally regulated. This latter possibility is consistent with what is known about TR structure and is examined in more detail in the Section 4. In the other mouse organs examined, several different sized bands were detected, none however, were expressed at the same level observed for brain (Fig. 7B). Nearly all organs show a signal at <50 kDa, and three (liver, adipose tissue and skeletal muscle) have an additional band between 25 and 37 kDa. The ratio in the level of expression between these bands varies between tissues, e.g. the smaller band is more intense than the larger in skeletal muscle, while the opposite is true in adipose tissue. Heart and liver have an additional band greater in size than that seen in brain. The relatively large differences in the sizes of these bands suggest that TR splice variants may exist (consistent with the Northern blots), or that significant protein processing is occurring in these organs. It should be noted that neither Uchida et al. (1999) nor Horie et al. (2000) detected TR message in human or mouse organs other than brain. However, both groups used Northern blots prepared from adults, whereas our Western blots were prepared from 10-day-old mice. This age difference, or the sensitivity of Western blots may explain these differences.

Fig. 6. Tomoregulin and Tristanin expression (Western blot) in mature GM2 (G), mature normal (C) and newborn (K) cat brain cortices. (A) A single band of ∼50 kDa is detected by our anti-TR Ab, and is present at slightly higher levels in normal brain; (B) two major bands, one at <25 kDa, and the second at ∼50 kDa are detected by our anti-Tris Ab. The smaller band shows a slightly higher level of expression in normal, mature cortex, the larger band shows its greatest expression in the new born. TR and Tris show similar sized bands in mouse brain (Fig. 7). Protein 2 ␮g/lane. All signals were abolished by preincubating the Abs with immunizing peptides. Molecular weight standards are noted at right.

382

D.A. Siegel et al. / Int. J. Devl Neuroscience 20 (2002) 373–389

Fig. 7. Western blots of tomoregulin and Tristanin expression in developing mouse brain, and 10-day-old mouse organs. (A) A single TR band (>50 kDa) is present in postnatal mouse brain and shows increased expression with age; (B) TR shows its greatest expression in 10-day-old mouse brain and is present to varying degrees in all other organs except kidney. Several organs have more than one band (see text for discussion); (C) Tris shows three distinct bands in developing mouse brain, one at ∼50 kDa, and a doublet at ∼25 kDa. The 50 kDa band and the smaller band in the doublet show declining expression with age. The larger doublet band increases with age; (D) in addition to brain, Tris is expressed in three other organs, liver spleen and thymus. Two bands are present in liver and spleen, and the spleen band at ∼100 kDa is the only band near the predicted size of the Tris ORF (see text for discussion). Protein 2 ␮g/lane. A: adult; B: brain; Li: liver; K: kidney; S: spleen; Lu: lung; H: heart; T: thymus; A: adipose tissue; SM: skeletal muscle. Molecular weight standards are noted at right.

3.10. Western analysis: Tristanin An immuno blot of the three cat samples probed with our anti-Tristanin antibody (Fig. 6B) revealed two major bands. One, at <25 kDa, was present in all three animals, but appeared slightly stronger in the normal 3-month-old cat. The second, at ∼50 kDa was most intense in the kitten, but showed faint signals in the GM2 and control cats. Again, antibody binding to all bands was blocked by preincubation of the antibody with the immunizing peptide (data not shown). Similar sized bands were seen in developing mouse brain, except here the 25 kDa band was resolved into two distinct signals (Fig. 7C). All three mouse proteins revealed changes in their developmental patterns of expression. The 50 kDa band shows its strongest signal at P0 and declines steadily through adulthood, similar to what is seen in the cat and consistent with a role in dendritogenesis. The two bands in the 25 kDa doublet show opposite expression patterns; the larger displaying its weakest signal at birth and increasing with age, the smaller is strongest at P0, declines steadily to P15; it is absent at P20 and in the adult. It is not yet clear whether the large 50 kDa band and smaller doublet observed by Western blot correspond to the large and small bands detected by Northern blot (Fig. 4), but their

developmental expression patterns are consistent with such an interpretation. In addition to brain, Tris is also expressed in 10-day-old mouse liver, kidney, spleen and thymus (Fig. 7D). All four organs have a band <25 kDa. Liver has a second band at between 25 and 37 kDa, and spleen shows an additional faint band at ∼100 kDa. It is interesting to note that only spleen expresses a protein near the predicted size of the Tris ORF (∼116 kDa). However, as discussed later, Tris appears to be a member of the PRDM family of transcription factors which commonly express multiple splice variants. 3.11. Immunocytochemistry: tomoregulin Immunocytochemistry with our anti-tomoregulin antibody revealed unexpected and intriguing results both in developing mouse brain, as well as in the feline model of GM2 gangliosidosis. In mouse cortex, TR expression was examined at P0, P10, and in the adult. During early cortical development TR-immunoreactivity (IR) was observed not, as expected, on the neuronal cell surface, but as small punctate staining within the cell (see P0 in Fig. 8b). With age, these small dots, clearly confined to the nucleus, became larger in size, but

D.A. Siegel et al. / Int. J. Devl Neuroscience 20 (2002) 373–389

383

Fig. 8. Tomoregulin immunocytochemistry in cat and mouse brains. (a) TR immunoreactivity (IR) is observed throughout the neuronal perikarya and apical dendrite in 3-day-old kitten (K). In the mature cat (C) TR-IR is seen outlining both the cell soma, and apical and basilar dendrites. It is not present in the nucleus. In the mature GM2 mutant (G) TR-IR is clearly seen as punctate staining within the nucleus, suggesting a translocation of TR to the nucleus in the diseased state; (b) TR expression in developing postnatal mouse brain. Note the punctate staining within the nucleus in the early postnatal period (P0 and P10), and its absence in the nucleus of the adult (A). These results are similar to what is observed above (a) in the developing (K) and mature cat (C) cortices. Scale bar = 10 ␮m.

fewer in number (see P10, Fig. 8b) until, in the adult, they were difficult to find and a more generalized surface staining became apparent. A similar progression in staining pattern was observed in primary mouse neuronal cultures (Fig. 9). Within the first week of plating E-14 mouse cortical neurons showed multiple small dots within the nucleus. By the end of the second week, these dots had coalesced into fewer larger ones, and by the fourth week generally only one or two large dots remained. These results were unanticipated as tomoregulin possesses a putative transmembrane domain as well as a large, highly glycosylated EGF-like/follistatin-like “extracellular” domain (Uchida et al., 1999). As such, we anticipated finding TR-IR primarily on the neuronal cell surface. Its presence in the nucleus suggests a role in signal transduction not confined to the plasmalemma. Consistent with our results is the recent finding by Ogawa et al. (1997) demonstrating follistatin-IR within the cytoplasm and nuclei of spermatocytes during spermatogenesis. In addition to the nuclear staining observed in P10 mouse cortex, TR-IR is also seen in the cell body, and small puncta can be observed within the apical dendrite. In the adult mouse, staining is seen within the soma as well as the apical and basilar dendrites. Perhaps the most interesting aspect of TR immunostaining, however, is in the GM2-gangliosidosis cat (Fig. 8a). In

developing 3-day-old normal cat cortex, TR-IR is seen primarily within the neuronal perikarya, similar to what is observed in the early developing mouse, as well as in the apical dendrite. In the mature normal cat TR-IR is clearly seen on the surface of the cell body, proximal portions of basilar dendrites and for some distance along the apical dendrite; it is typically not found within the nucleus (Fig. 8a C). However, in the mature GM2 gangliosidosis cat (an age matched littermate of the normal cat) TR-IR is primarily observed within the nucleus (Fig. 8a G). This shift of TR-IR from the cell surface to within the nucleus in the diseased state at the time of extensive ectopic dendritogenesis is similar to what is seen in developing mouse cortex when primary dendritogenesis is at its peak, and is consistent with our hypothesis that normal and ectopic dendritogenesis share a common molecular mechanism. That mechanism may, in part, involve the subcellular location of TR. 3.12. Immunocytochemistry: Tristanin During mouse brain cortical development Tris is seen as small punctate staining throughout the cell body at P0, but by P10 staining has largely disappeared and is absent in the adult (Fig. 10b). This pattern is repeated in normal cat; in 3-day-old kitten punctate staining is observed in

384

D.A. Siegel et al. / Int. J. Devl Neuroscience 20 (2002) 373–389

4. Discussion

Fig. 9. Tomoregulin immunofluorescence (IF) in E14 mouse cortical neurons in culture. The multiple dots observed in nuclei early in culture decrease with age. TR-IF is red, the cell body and dendritic processes are clearly outlined using MAP2 antibody (green). These results are similar to what is seen in normal developing mouse cortex, Fig. 8. DIV: days in vitro. Scale bar = 10 ␮m.

the neuronal perikarya, but in the 3-month-old cat little immunoreactivity is detected (Fig. 10a K and C). This is not the case in the 3-month-old GM2 gangliosidosis animal where Tris-IR is observed in the nucleus in nearly all cortical neurons (Fig. 10a G). The appearance of Tristanin-IR in the diseased animal is unusual. In both developing cat and mouse cortices Tris is observed throughout the neuronal perikaryon but is effectively absent in mature, normal brain. Its reappearance in mature, diseased brain at a time of extensive ectopic dendritogenesis suggests that it may function in that process, and is consistent with what is known of the functions of the PRDM family transcription factors (Section 4).

Ectopic dendrite initiation in mature cortex in the lysosomal storage diseases appears to be a recapitulation of the normal developmental process (Purpura and Suzuki, 1976; Purpura, 1978; Walkley et al., 1998). Consequently, by comparing patterns of gene expression in normal newborn and mature diseased cortices, it should be possible to identify genes common to both states that specifically function in primary dendritogenesis. Using a feline model of GM2 gangliosidosis and PCR-based subtractive hybridization, we have identified tomoregulin and Tristanin as two likely candidates. Both genes show multiple bands by Northern analysis, suggesting that splice variants may exist, and although, both genes were isolated from mature GM2 cat brain, each has a single transcript that shows greater expression in newborn brain than in normal age matched control. This observation supports our hypothesis that the GM2 and newborn cats share commonly expressed genes not found (or found at lower levels) in the normal mature cat. That these transcripts do not show greater expression in the GM2 cat than newborn is not surprising as the extent of dendrite initiation in the newborn far exceeds the amount of ectopic dendrite growth occurring in the mature diseased animal. Northern blots of developing mouse brain confirm developmental profiles for both genes. In mouse, TR reveals an additional band between 4.40 and 7.46 kb that shares the same developmental expression pattern as the 1.35 kb band. Tris also shows a new transcript in the mouse that is developmentally regulated (between 7.46 and 9.49 kb), but is missing the ∼2.37 kb band that was observed in cat. A small ∼1.35 kb Tris transcript shows diminished expression in the adult mouse, consistent with what is observed with the similar sized cat transcript. Western analysis of TR in both cat and mouse were contrary to expectations as TR protein expression appears greatest in the adult. One explanation may be that TR expression is regulated at the translational level, or that protein turnover is less rapid in the adult than at younger ages. Alternatively, it may be that our antibody, directed against the distal follistatin motif, does not recognize those TR splice variant(s) expressed at higher levels in developing and diseased brain. This interpretation would be consistent with our Northern data, as well as with what is known about the multiple functional units of TR and their distinct biological roles (see later). Our Tris Ab recognizes multiple bands by Western blot, two in cat brain and three in mouse. Although, the largest band (∼50 kDa) is smaller than the predicted value of the full length ORF, its developmental expression pattern mirrors message expression, as does the smaller protein band and the smaller Tris transcript. The discrepancy in size of the larger band may be due to post-translational modifications, e.g. proteolytic cleavage, or, to alternative splicing, which is a common feature of PRDM transcription factors

D.A. Siegel et al. / Int. J. Devl Neuroscience 20 (2002) 373–389

385

Fig. 10. Tristanin immunocytochemistry in cat and mouse brains. (a) Tris immunoreactivity (IR) is seen as punctate staining within the neuronal perikarya in 3-day-old kitten (K), but is only faintly observed in mature cat cortex (C). It is not present in the nucleus of the normal mature animal. However, in the mature GM2 mutant (G) Tris-IR is clearly seen as punctate staining within the nucleus, suggesting a translocation of Tris to the nucleus in the diseased state; (b) Tris-IR in developing postnatal mouse brain. Nearly, all cells are heavily stained immediately after birth (P0), but this staining declines rapidly with age until in the adult (A) little Tris-IR is apparent. These results are similar to what is observed above in the developing (K) and normal mature cat (C) cortices in A. Scale bar = 10 ␮m.

(Yang and Huang, 1999). Clearly, determining the nature of the multiple transcripts observed for both TR and Tris will help resolve these discrepancies. Perhaps the most intriguing and unexpected results were obtained from the immunocytochemistry experiments. This is particularly true for TR. In normal adult cat and mouse TR-IR outlines the neuronal perikarya and can be seen for some distance along both apical and basilar dendrites. This was not unexpected as TR is a putative transmembrane protein with a large extracellular domain and cytosolic G-protein binding site (Uchida et al., 1999). However, in developing brain TR-IR is also present as large discrete puncta within the nucleus, not the anticipated location of plasmalemmal protein. Most interesting, however, is the presence of TR-IR within the nuclei of neurons in the mature GM2 cat (Fig. 8 G). Its location within the nuclei of diseased and developing neurons at the time when both are undergoing active dendritogenesis suggests that (i) TR may function in dendrite initiation, and (ii) that it may function through a signal transduction pathway requiring all or part of its “extracellular domain” to translocate to the nucleus. Likely, the distal follistatin motif is involved, as our TR Ab recognizes part of this epitope. These results are intriguing

as follistatin has recently been found to localize within nuclei of dividing spermatozoa (Ogawa et al., 1997). The role of follistatin in nervous system development is already well-established (see later). It may be that follistatin-like molecules play fundamental roles in cell division and differentiation through a nuclear mechanism. Tristanin immunocytochemistry shows a staining pattern similar to that observed for TR, i.e. it is most extensively expressed in developing brain and declines with age. Tris also shows a nuclear localization in mature GM2 neurons which is not observed in the age matched, normal control. Thus, like TR, Tris is localized to the nucleus in diseased and developing neurons coincident with the time of greatest dendrite initiation, suggesting a role for Tris in this complex developmental process. However, unlike TR, Tris is a transcription factor and its location within the nucleus was not unexpected. Thus, from the nature of the screen that identified them, their expression patterns in normal developing brain, and their changes in subcellular localization in diseased brain, both TR and Tris appear likely to play important roles in primary dendrite initiation: evidence from the literature support this hypothesis.

386

D.A. Siegel et al. / Int. J. Devl Neuroscience 20 (2002) 373–389

4.1. Tomoregulin TR is a recently discovered transmembrane protein with a unique extracellular domain (ECD) containing an epidermal growth factor-like (EGF) motif (closest to the membrane) followed by two follistatin-like motifs (FF) (Horie et al., 2000; Uchida et al., 1999). The transmembrane portion of the protein makes a single pass through the plasmalemma, and there is an apparent G-protein activating domain on its cytoplasmic side (Uchida et al., 1999). Although, found in a variety of human tumors (Glynne-Jones et al., 1999; Liang et al., 2000), we and others have shown that it is normally and predominately expressed in brain (Horie et al., 2000; Uchida et al., 1999). From its structure, tomoregulin appears to offer a dramatic number of possible signaling mechanisms. On the one hand, it may function as a receptor for, as yet, unknown ligand(s) transducing its signal through its putative G-protein binding site. On the other hand, it appears that the extracellular EGFand follistatin-like domains may function independently as soluble ligands (Horie et al., 2000). Indeed, the entire ECD and FF-like domains have been found in culture media of CHO cells transfected with full length TR (Uchida et al., 1999). Functionally, the ECD purified from this media was able to weakly stimulate erbB4 phosphorylation. Furthermore, recombinant TR ECD has been shown to function as a survival factor for primary cultures of hippocampal and mesencephalic neurons, and appears to stimulate dendrite growth in mesencephalic dopaminergic neurons (Horie et al., 2000). 4.2. EGF and follistatin: important regulators of growth, survival and development 4.2.1. EGF EGF-like domains are present on a wide variety of distinctly different proteins, most playing significant roles in CNS development, growth, and neuronal survival. These include: EGF, neuregulins (NRG), agrin, betacellulin, brevican, transforming growth factor ␣ (TGF␣), heparin-binding epidermal growth factor (HB-EGF), and others (Kornblum et al., 1999; Xian and Zhou, 1999). Receptors for these ligands are the EGF/erbB family of receptor tyrosine kinases (EGF-R (also known as erbB1), and erbB2–4). Tomoregulin has been shown to activate erbB4 (Uchida et al., 1999). Functionally, all of these proteins have been shown to participate in aspects of CNS development ranging from cell proliferation, migration, differentiation and, most importantly, neurite outgrowth (Nakagawa et al., 1998; Opanashuk and Hauser, 1998; Xian and Zhou, 1999). Indeed, neuregulin, betacellulin, TGF ␣, HB-EGF and brevican have all been shown to induce neurites, brevican, for example, in primary rat hippocampal cultures (Miura et al., 2001), and NRG in PC-12 cells (Vaskovsky et al., 2000). The latter appears to function through the erbB4 receptor, the same receptor activated by tomoregulin.

4.2.2. Follistatin Follistatin also plays a role in early nervous system development. In the Xenopus blastula, for example, activin (a TGF␤-like protein) has been shown to inhibit neural tissue formation from ectoderm, follistatin, however, can antagonize the function of activin and consequently promote neural tissue induction (Hemmati-Brivanlou and Melton, 1994; Hemmati-Brivanlou et al., 1994). When ectopically expressed follistatin has also been shown to induce a secondary neuronal axis, and follistatin is found in the Spemann/Mangold organizer at the time of normal neural induction (Hemmati-Brivanlou et al., 1994). Finally, it was also shown that the bone morphogenic proteins (BMPs— members of the TGF␤ superfamily like activin) are also expressed in developing Xenopus blastula, can inhibit neural tissue formation, and are blocked by follistatin (Wessely et al., 2001; Iemura et al., 1998). Follistatin has also been shown to play a role in later aspects of nervous system development. In developing Xenopus, for example, follistatin appears to function as a chemoattractant for trigeminal nerve innervation of the cement gland. Explants of follistatin secreting cells can cause misrouting and improper target innervation of the trigeminal nerve (Honore and Hemmati-Brivanlou, 1996). It is not clear, however, whether follistatin functions directly as a chemoattractant or indirectly by inactivating chemorepellents. For example, in rat embryonic spinal cord, commissural neurons from the roof plate near the dorsal mid-line send axons ventrally toward the floor plate where they cross to the contralateral side of the cord. BMP-7, expressed on the dorsal side of the cord, appears to function as a chemorepellent forcing dorsal cells to send their axons ventrally. Follistatin antagonizes BMP-7 activity and consequently diminishes its repellant effects (Augsburger et al., 1999) functioning through a mechanism similar to that of activin and follistatin in Xenopus blastula neural induction described earlier. Might follistatin play a similar role in dendrite initiation? Significantly, several members of the TGF␤ superfamily have been shown to function in dendrite growth in both the peripheral and central nervous systems (Guo et al., 1998; Le Rouxet al., 1999). BMP-7, for example, has been demonstrated to increase dendritic branching, length and synapse formation in hippocampal and cortical neurons in culture. It has not, however, been shown to increase the number of primary dendrites (Guo et al., 2001; Withers et al., 2000). The role of follistatin in dendrite initiation has not yet been evaluated. Finally, as mentioned, follistatin immunoreactivity has been found to translocate from the cytosol to the nucleus during spermatogenesis where it is believed to function as a transcriptional activator (Ogawa et al., 1997). These latter data are consistent with our observations of a nuclear localization for tomoregulin early in CNS development and point to possible mechanisms of TR function. Clearly, EGF- and follistatin-like molecules play vital roles in neuronal differentiation and CNS development.

D.A. Siegel et al. / Int. J. Devl Neuroscience 20 (2002) 373–389

The presence of both these domains on TR make it a likely candidate to function in primary dendrite initiation. 4.3. Tristanin A Tristanin cDNA sequence was published along with 99 others as part of a larger effort aimed at identifying novel, human, brain cDNAs (Nagase et al., 1999). That clone was 5249 bp with an open reading frame (ORF) of 2649 bp; no functional or descriptive studies were performed. A second, longer human cDNA was subsequently isolated as part of a screen for positive regulatory domain (PRD) containing transcription factors (see later). That sequence was a direct submission to NCBI and is otherwise unpublished (Yang and Huang, 2000); it is 6010 bp with a predicted ORF of 3183 bp. Our human Tristanin clone is 5838 bp with a 3072 bp ORF. Protein analysis by PSORT II identified 10 zinc-finger motifs of the Krüppel (CCHH) type (Fig. 5A). A comparison of Tris with other PRD containing proteins (Fig. 5C) indicates that it is a member of that small group of zinc-finger transcriptions factors known as positive regulatory domain members (PRDM). The prototypical members that define this family are Blimp1, a mediator of B cell differentiation through down regulation of c-myc (Huang, 1994; Lin et al., 1997), and RIZ, a tumor suppressor that binds the retinoblastoma protein and is primarily expressed in the CNS (Buyse et al., 1995; Huang et al., 1998). PRDMs function in cell differentiation. The PR domain is believed to be involved in protein–protein interactions that modulate transcription factor function (Huang et al., 1998). Disruption or loss of the PR motif commonly results in tumor formation (Fang et al., 2000; Yang and Huang, 1999). Structurally, PRDMs share a common organization with the PR domains at the amino terminus of the protein and the zinc-fingers at the carboxy terminus. Tris fits this general scheme (Fig. 5B). Alternative splicing is a common feature of PRDMs resulting in transcripts that either possess or lack the PR domain (Jiang and Huang, 2000; Yang and Huang, 1999). The ratio of PR+ /PR− forms of PRDMs appear to be maintained in a delicate balance, and a shift in this ratio favoring the PR− form often results in cancer. For example, inactivation of the PR domain of the MDS1–EVI1 gene by viral insertion or chromosomal translocation is a common cause of leukemia. Over expression of the PR− form of this gene has similar effects (Fears et al., 1996; Morishita et al., 1988, 1992; Nucifora et al., 1994). Similar observations have been made for the RIZ gene. Loss of the RIZ PR+ , but not the PR− gene product results in breast and liver cancer. Over expressing the RIZ PR+ form arrests cell division and can suppress hepatoma growth in nude mice (He et al., 1998; Jiang et al., 1999). PRDMs also appear to play an important function in the nervous system. SC-1, for example, is a recently discovered PR domain containing Zn-finger transcription factor that has been shown to specifically interact with the p75 neurotrophin

387

receptor but not with the TrkA receptor (Chittka and Chao, 1999). The Trks (receptor tyrosine kinases) and p75, play a myriad of important roles in the nervous system including: neuronal cell survival, differentiation, synaptic plasticity, axon guidance and dendrite growth (Levi-Montalcini, 1987; Lewin and Barde, 1996; Thoenen, 1995). When SC-1 was transfected into COS cells, it is found predominately in the cytoplasm. Co-transfection with p75 and treatment with nerve growth factor (NGF) resulted in the rapid translocation of SC-1 to the nucleus and a halt in cell division. Similar experiments with SC-1 and TrkA showed no changes on NGF treatment (Chittka and Chao, 1999). PC-12 cells treated with NGF show an upregulation of SC-1 (also known as PFM1) (Yang and Huang, 1999). These data suggest that SC-1 functions in the NGF signal transduction pathway and may be involved in neuronal differentiation. The role of PRDM transcription factors in development and disease offers insights into the function of Tristanin in the CNS. PRDMs play an important role in differentiation. They appear to do this through the tight regulation of splice variants possessing or lacking the PR domain, and they have been shown to function directly in neuronal signal transduction pathways. Our anti-Tris Ab recognizes the carboxy terminus of 25 and 50 kDa fragments of Tristanin. The Tris ORF predicts a protein >100 kDa in size with the Zn-finger motifs at the carboxy terminus of the protein and the PR domain at the amino terminus. It is possible that the Tris variants recognized by our antibody represent PR− forms of the protein, and that it is these forms that are involved in dendrite initiation. The presence of Tris–IR in nuclei of developing neurons at the peak of dendritogenesis, and its reappearance in nuclei of mature GM2 neurons at the time these cells are re-initiating primary dendrites suggest that Tris may be part of the molecular mechanism controlling primary dendritogenesis. Regulation of Tris PR+ and PR− isoforms may be a part of this regulatory process. The goal of this work has been to identify genes involved in primary dendrite initiation in the mammalian CNS. To achieve this end, we have exploited a feline model of the lysosomal storage disease GM2 gangliosidosis. Although, the biochemical and molecular lesions underlying this disorder have been known for decades, its pathogenesis, including the cause of ectopic dendrite growth, has remained obscured. Using molecular approaches to detect changes in gene expression in normal versus diseased brain, we have identified TR and Tris as likely candidates involved in both normal and ectopic dendritogenesis. Clearly, the use of animal models of human diseases in combination with new molecular approaches and relevant assay systems now make it possible to go beyond merely identifying the genetic lesions responsible for the myriad forms of mental retardation and psychiatric disorders to understanding the pathogenic pathways that result in their complex phenotypes. Only when these pathways are understood

388

D.A. Siegel et al. / Int. J. Devl Neuroscience 20 (2002) 373–389

can coherent approaches toward therapeutic intervention be designed.

Acknowledgements The authors wish to thank Dr. Kostantin Dobrenis for his help and guidance with the cell culture work and microscopy. Supported in part by Research Grant no. 12-FY99-274, March of Dimes Birth Defects Foundation.

References Augsburger, A., Schuchardt, A., Hoskins, S., Dodd, J., Butter, S., 1999. BMPs as mediators of roof plate repulsion of commissural neurons. Neuron 24, 127–141. Buyse, I.M., Shao, G., Huang, S., 1995. The retinoblastoma protein binds to RIZ, a zinc-finger protein that shares an epitope with the adenovirus E1A protein. Proc. Natl. Acad. Sci. U.S.A. 92, 4467–4471. Chittka, A., Chao, M., 1999. Identification of a zinc-finger protein whose subcellular distribution is regulated by serum and nerve growth factor. Proc. Natl. Acad. Sci. U.S.A. 96, 10705–10710. Chomczynski, P., Sacchi, N., 1996. Guanidine methods for total RNA preparation. In: Ausubel, F.M., Brent, R., Kingston, R.E., Moore, D.D., Seidman, J.G., Smith, J.A., Struhl, K. (Eds.), Current Protocols in Molecular Biology, Unit 4.2, Suppl. 36, Wiley, New York. Cork, L., Munnell, J.F., Lorenz, M.D., Murphy, J.V., Baker, H.J., Rattazzi, M.C., 1977. GM2 ganglioside lysosomal storage disease in cats ␤-hexosaminidase deficiency. Science 196, 1014–1017. Cork, L., Munnell, J.F., Baker, H.J., Rattazzi, M.C., 1979. A comparative pathologic study of feline and human GM2 gangliosidosis. In: Zimmerman, H.M. (Ed.), Progress in Neuropathology, Vol. 4, Raven Press, New York, pp. 161–177. Fang, W., Piao, Z., Simon, D., Sheu, J., Huang, S., 2000. Mapping of a minimal deleted region in human hepatocellular carcinoma to 1p36.13–p36.23 and mutational analysis of the RIZ (PRDM2) gene localized to the region. Genes Chromosomes Cancer 28, 269–275. Fears, S., Mathieu, C., Zeleznik-Le, N., Huang, S., Rowley, J.D., Nucifora, G., 1996. Intergenic splitting occurs on normal tissues as well as in myeloid leukemia and produces a new member of the PR domain family. Proc. Natl. Acad. Sci. U.S.A. 93, 1642–1647. Glynne-Jones, E., James, R.E., Seery, L.T., Harper, M.E., Anglin, I.E., Taylor, K.M., Nicholson, R.I., 1999. A novel transmembrane protein in prostate cancer, TENB2, identified by targeted differential display. Unpublished, direct submission to NCBI, Accession no. AF179274. Guo, X., Rueger, D., Higgins, D., 1998. Osteogenic protein-1 and related bone morphogenetic proteins regulate dendritic growth and the expression of microtubule-associated protein-2 in rat sympathetic neurons. Neurosci. Lett. 245, 131–134. Guo, X., Lin, Y., Horbinski, C., Drahushuk, K.M., Kim, I.J., Kaplan, P.L., Lein, P., Wang, T., Higgins, D., 2001. Dendritic growth induced by BMP-7 requires Smad1 and proteasome activity. J. Neurobiol. 48, 120–130. He, L., Yu, J.X., Liu, L., Buyse, I.M., Wang, M.-S., Yang, Q.-C., Nakagawara, A., Brodeur, G.M., Shi, Y.E., Huang, S., 1998. RIZ1, but not the alternative RIZ2 product of the same gene, is underexpressed in breast cancer, and forced RIZ1 expression causes G2–M cell cycle arrest and/or apoptosis. Cancer Res. 58, 4238–4244. Hemmati-Brivanlou, A., Melton, D.A., 1994. Inhibition of activin receptor signaling promotes neuralization in Xenopus. Cell 77, 273–281. Hemmati-Brivanlou, A., Kelly, O., Melton, D., 1994. Follistatin an antagonist of activin, is expressed in the Spemann organizer and displays direct neuralizing activity. Cell 77, 283–295.

Honore, E., Hemmati-Brivanlou, A., 1996. In vivo evidence for trigeminal nerve guidance by the cement gland in Xenopus. Dev. Biol. 178, 363– 374. Horie, M., Mitsumoto, Y., Kyushiki, H., Kanemoto, N., Watanabe, A., Taniguchi, Y., Nishino, N., Okamoto, T., Kondo, M., Mori, T., Noguchi, K., Nakamura, Y., Takahashi, E., Tanigami, A., 2000. Identification and characterization of TMEFF2, a novel survival factor for hippocampal and mesencephalic neurons. Genomics 67, 146–152. Huang, S., 1994. Blimp-1 is the murine homolog of the human transcriptional repressor PRDI-BF1. Cell 78, 9. Huang, S., Shao, G., Liu, L., 1998. The PR domain of the Rb-binding zinc-finger protein RIZ1 is a protein binding interface and is related to the SET domain functioning in chromatin-mediated gene expression. J. Biol. Chem. 273, 15933–15940. Iemura, S-I., Yamamoto, T.S., Takagi, C., Uchiyama, H., Natsume, T., Shimasadei, S., Sugino, H., Naoto Cleno, N., 1998. Direct binding of follistatin to a complex of bone-morphogenetic protein and its receptor inhibits central and epidermal cell fates in early Xenopus embryo. Proc. Natl. Acad. Sci. U.S.A. 95, 9337-9342. Jacobson, M., 1991. Developmental Neurobiology, Plenum Press, New York. Jiang, G.L., Liu, L., Buyse, I.M., Simon, D., Huang, S., 1999. Decreased RIZ1 expression but not RIZ2 in hepatoma and suppression of hepatoma tumorigenicity by RIZ1. Int. J. Cancer 83, 541–547. Jiang, G.L., Huang, S., 2000. The yin-yang of PR-domain family genes in tumorigenesis. Histol. Histopathol. 15, 109–117. Kornblum, H.I., Zurcher, S.D., Werb, Z., Derynck, R., Seroogy, K.B., 1999. Multiple trophic actions of heparin-binding epidermal growth factor (HB-EGF) in the central nervous system. Eur. J. Neurosci. 11, 3236–3246. Le Roux, P., Behar, S., Higgins, D., Charette, M., 1999. OP-1 enhances dendritic growth from cerebral cortical neurons in vitro. Exp. Neurol. 160, 151–163. Levi-Montalcini, R., 1987. The nerve growth factor 35 years later. Science 237, 1154–1164 (review). Lewin, G.R., Barde, Y.-A., 1996. Physiology of the neurotrophins. Annu. Rev. Neurosci. 19, 289–317. Liang, G., Robertson, K., Talmadge, C., Sumegi, J., Jones, P., 2000. The gene for a novel transmembrane protein containing epidermal growth factor and follistatin domains is frequently hypermethylated in human tumor cells. Cancer Res. 60, 4907–4912. Lin, Y., Wong, K., Calame, K., 1997. Repression of c-myc transcription by Blimp–1, an inducer of terminal B cell differentiation. Science 276, 596–599. Marin-Padilla, M., 1972. Structural abnormalities of the cerebral cortex in human chromosomal aberrations: a Golgi study. Brain Res. 44, 625–629. Marin-Padilla, M., 1974. Structural organization of the cerebral cortex in human chromosomal aberrations: a Golgi study I. D1 (13–15) trisomy, Patau syndrome. Brain Res. 66, 373. Marin-Padilla, M., 1976. Pyramidal cell abnormalities in the motor cortex of a child with Down’s syndrome: a Golgi study. J. Comp. Neurol. 167, 63–81. Miura, R., Ethell, I.M., Yamaguchi, Y., 2001. Carbohydrate-protein interactions between Hnk-1-reactive sulfoglucuronyl glycolipids and the proteoglycan lectin domain mediate neuronal cell adhesion and neurite outgrowth. J. Neurochem. 76, 413–424. Morishita, K., Parker, D.S., Mucenski, M.L., Jenkins, N.A., Copeland, N.G., Ihle, J.N., 1988. Retroviral activation of a novel gene encoding a zinc-finger protein in Il-3-dependent myeloid leukemia cell lines. Cell 54, 831–840. Morishita, K., Parganas, E., William, C.L., Whittaker, M.H., Drabkin, H., Oval, J., Taetle, R., Valentine, M.B., Ihle, J.N., 1992. Activation of EVI1 gene expression in human acute myelogenous leukemias by translocations spanning 300–400 kilobases on chromosome band 3q26. Proc. Natl. Acad. Sci. U.S.A. 89, 3937–3941.

D.A. Siegel et al. / Int. J. Devl Neuroscience 20 (2002) 373–389 Nagase, T., Ishikawa, K., Kikuno, R., Hirosawa, M., Nomura, N., Ohara, O., 1999. Prediction of the coding sequences of unidentified human genes. Part XV. The complete sequences of 100 new cDNA clones from brain which code for large proteins in vitro. DNA Res. 6, 337–345. Nakagawa, T., Sasahara, M., Hayase, Y., Haneda, M., Yasuda, H., Kikkawa, R., Higashiyama, S., Fumitada Hazama, F., 1998. Neuronal and glial expression of heparin-binding EGF-like growth factor in central nervous system of prenatal and early-postnatal rat. Dev. Brain Res. 108, 263–272. Nucifora, G., Begy, C.R., Kobayashi, H., Roulston, D., Claxton, D., Pedersen-Bjergaard, J., Parganas, E., Ihle, J.N., Rowley, J.D., 1994. Consistent intergenic splicing and production of multiple transcripts between Aml1 at 21Q22 and unrelated genes at 3Q26 In (3;21)(Q26;Q22) translocations. Proc. Natl. Acad. Sci. U.S.A. 91, 4004–4008. Ogawa, K., Hashimoto, O., Kurohmaru, M., Mizutani, T., Sugino, H., Hayashi, Y., 1997. Follistatin-like immunoreactivity in the cytoplasm and nucleus of spermatogenic cells in the rat. Eur. J. Endocrinol. 137, 523–529. Opanashuk, L.A., Hauser, K.F., 1998. Opposing actions of the EGF family and opioids: heparin binding-epidermal growth factor (Hb-EGF) protects mouse cerebellar neuroblasts against the antiproliferative effect of morphine. Brain Res. 804, 87–94. Patel, M., Sive, H., 1996. PCR-based subtractive cDNA cloning: in current protocols. In: Ausubel, F.M., Brent, R., Kingston, R.E., Moore, D.D., Seidman, J.G., Smith, J.A., Struhl, K. (Eds.), Molecular Biology, Unit 5.9, Suppl. 34, Wiley, New York. Purpura, D.P., 1974. Dendritic spine “dysgenesis” and mental retardation. Science 186, 1126–1128. Purpura, D.P., 1978. Ectopic dendrite growth in mature pyramidal neurons in human ganglioside storage disease. Nature 276, 520–521. Purpura, D.P., 1979. Pathobiology of cortical neurons in metabolic and unclassified amentias. In: Katzman, R. (Ed.), Congential and Acquired Cognitive Disorders, Raven, New York, pp. 43–68. Purpura, D.P., Suzuki, K., 1976. Distortion of neuronal geometry and formation of aberrant synapses in neuronal storage disease. Brain Res. 116, 1–21. Rakic, P., Bourgeois, J.-P., Goldman-Rakic, P.S., 1994. Synaptic development of the cerebral cortex: implication for learning, memory, and mental illness. In: Van Pelt, J., Corner, M.A., Uylings, H.B.M., Lopes da Silva, F.H. (Eds.), Progress in Brain Research, Vol. 102, Elsevier, Amsterdam (Chapter 15).

389

Siegel, D.A., Walkley, S.U., 1994. Growth of ectopic dendrites on cortical pyramidal neurons in non-ganglioside storage diseases correlates with abnormal accumulation of GM2 ganglioside. J. Neurochem. 62, 1852– 1862. Simonian, M.H., Smith, J.A., 1996. Spectrophotometric and colorimetric determination of protein concentration. In: Ausubel, F.M., Brent, R., Kingston, R.E., Moore, D.D., Seidman, J.G., Smith, J.A., Struhl, K. (Eds.), Current Protocols in Molecular Biology, Unit 10.1, Suppl. 35, Wiley, New York. Thoenen, H., 1995. Neurotrophins and neuronal plasticity. Science 270, 593–598. Uchida, T., Wada, K., Akamatsu, T., Yonezawa, M., Noguchi, H., Mizoguchi, A., Kasuga, M., Sakamoto, C., 1999. A novel epidermal growth factor-like molecule containing two follistatin modules stimulates tyrosine phosphorylation of erbB4 in MKN28 gastric cancer cells. Biochem. Biophys. Res. Commun. 266, 593–602. Vaskovsky, A., Lupowitz, Z., Erlich, S., Pinkas-Kramarski, R., 2000. erbB-4 activation promotes neurite outgrowth in PC12 cells. J. Neurochem. 74, 979–987. Walkley, S.U., Siegel, D.A., Dobrenis, K., Zervas, M., 1998. GM2 ganglioside as a regulator of pyramidal neuron dendritogenesis. In: Hakomori, S., Ledeen, R., Schneider, J., Yates, A., Yu, R. (Eds.), Sphingolipids as Signaling Modulators in the Nervous System, Vol. 845, Annals of the New York Academy of Sciences, pp. 188–199. Wessely, O., Agius, E., Oelgeschlager, M., Pera, E.M., De Robertis, E.M., 2001. Neural induction in the absence of mesoderm: beta-catenin-dependent expression of secreted BMP antagonists at the blastula stage in Xenopus. Dev. Biol. 234, 161–173. Withers, G.S., Higgins, D., Charette, M., Banker, G., 2000. Bone morphogenetic protein-7 enhances dendritic growth and receptivity to innervation in cultured hippocampal neurons. Eur. J. Neurosci. 12, 106–116. Xian, C.J., Zhou, X.F., 1999. Roles of transforming growth factor-␣ and related molecules in the nervous system. Mol. Neurobiol. 20, 157–183. Yang, X.-H., Huang, S., 1999. PFM1 (PRDM4), a new member of the PR-domain family, maps to a tumor suppressor locus on human chromosome 12q23–q24.1. Genomics 61, 319–325. Yang, X.-H., Huang, S., 2000. A Family of Novel PR-Domain (PRDM) Genes as Candidate Tumor Suppressors. Unpublished, direct submission to NCBI, Accession no. AF275817.