Ectopic expression of luteinizing hormone-releasing hormone and peripherin in the respiratory epithelium of mice lacking transcription factor AP-2α

Mechanisms of Development 94 (2000) 79±94

www.elsevier.com/locate/modo

Ectopic expression of luteinizing hormone-releasing hormone and peripherin in the respiratory epithelium of mice lacking transcription factor AP-2a P.R. Kramer a, G. Guerrero a, R. Krishnamurthy b, P.J. Mitchell b, S. Wray a,* a

Cellular and Developmental Neurobiology Section, National Institute of Neurological Disorders and Stroke, National Institutes of Health, Building 36, Bethesda, MD 20895, USA b Department of Biochemistry and Molecular Biology, Pennsylvania State University, University Park, PA 16302, USA Received 19 August 1999; received in revised form 27 January 2000; accepted 14 March 2000

Abstract The vertebrate transcription factor activator protein-2 (AP-2a ) is involved in craniofacial morphogenesis. In the nasal placode AP-2a expression delineates presumptive respiratory epithelia from olfactory epithelia, with AP-2a expression restricted to the anterior region of the respiratory epithelium (absent from the olfactory epithelium) at later stages. To address the role AP-2a plays in differentiation of cell groups in the nasal placode, the spatiotemporal expression pattern of four markers normally associated with olfactory epithelial structures was analyzed in mice lacking AP-2a . These markers were the intermediate ®lament protein peripherin, the neuropeptide luteinizing hormone-releasing hormone (LHRH), the neural cell adhesion molecule (NCAM) and the olfactory transcription factor Olf-1. Development of cells expressing these markers was similar in both genotypes until embryonic day 12.5 (E12.5), indicating that the main olfactory epithelium and olfactory pit formation was normal. At E13.5 in mutant mice, ectopic LHRH neurons and peripherin axons were detected in respiratory epithelial areas, areas devoid of Olf-1 and NCAM staining. Over the next few days, an increase in total nasal LHRH neurons occurred. The increase in nasal LHRH neurons could be accounted for by LHRH neurons arising and migrating out of respiratory epithelial regions on peripherin-positive ®bers. These results indicate that AP-2a is not essential for the separation of the olfactory and respiratory epithelium from the nasal placode and is consistent with AP-2a preventing recapitulation of developmental programs within the respiratory epithelium that lead to expression of LHRH and peripherin phenotypes. q 2000 Elsevier Science Ireland Ltd. All rights reserved. Keywords: AP-2a ; Transcription factor; Cranial placode; Gonadotropin releasing hormone; Respiratory epithelium; Homozygous mutant; Olfactory axon

1. Introduction The identities and speci®c roles of regulatory molecules controlling olfactory morphogenesis are largely unknown. The lining of the nasal cavity exhibits distinct epithelial domains: the sensory olfactory epithelium distal to, and the non-sensory respiratory epithelium proximal to, the nasal openings. Both the olfactory and respiratory epithelia arise from the nasal placode which is an ectodermal thickening on the ventrolateral aspects of the head (Tarozzo et al., 1995). The olfactory epithelium produces the main olfactory (MOE) as well as the vomeronasal organ epithelia (VNOE), the former becoming the chemosensory system and the latter the pheromone receptive system (for reviews * Corresponding author. Cellular and Developmental Neurobiology Section, National Institute of Neurological Disorders and Stroke, National Institutes of Health, Building 36, Room 5A-25, Bethesda, MD 20895, USA. Tel.: 11-301-496-8129; fax: 11-301-496-8578. E-mail address: [email protected] (S. Wray).

see Halpern, 1987; Farbman, 1992). A diversity of cell types are associated with the olfactory epithelium. Sensory olfactory receptor neurons and non-sensory support cells are present within the chemosensory system (Farbman, 1992). Sensory pheromone receptor neurons (Halpern, 1987), luteinizing hormone-releasing hormone (LHRH) neurons (Schwanzel-Fukuda and Pfaff, 1989; Wray et al., 1989a,b), GABA neurons (Tobet et al., 1996; Wray et al., 1996), and support cells (Farbman, 1992) have been identi®ed within the developing pheromone receptive system. In contrast to the olfactory epithelium, the cell types residing within the respiratory epithelium are unclear, as there is a paucity of phenotypic markers for cells residing in this area (Croucher and Tickle, 1989). The molecules regulating speci®cation of the wide variety of cell types derived from the nasal placode remain unclear. The initial development of two adjacent tissue types, olfactory and respiratory epithelia, suggests that molecular boundaries may be established early, and play an important role in determining cellular phenotypes there-

0925-4773/00/$ - see front matter q 2000 Elsevier Science Ireland Ltd. All rights reserved. PII: S 0925-477 3(00)00316-6

80

P.R. Kramer et al. / Mechanisms of Development 94 (2000) 79±94

after. Considerable evidence indicates that the genetic programs necessary for determination of cellular phenotypes is mediated, in part, by the spatiotemporal pattern of transcription factor(s) expression. Several transcription factors are involved in rostral placode induction (OTX-1 and -2 (Ang et al., 1996; Suda et al., 1999), Pax-6 (Hogan et al., 1986; Hill et al., 1991; Grindley et al., 1995), and/or differentiation (Eya 1 and 2 (Xu et al., 1997), Six-3 (Bovolenta et al., 1998)), with mutations resulting in head abnormalities or absence of the head altogether. OTX-1 and -2 (Ang et al., 1996; Suda et al., 1999) and Pax-6 (Hogan et al., 1986; Hill et al., 1991; Grindley et al., 1995) are expressed early in the anterior neural ridge and subsequent non-neural ectodermal derivatives, i.e. the nasal placode, ectoderm of nasal cavity and Rathke's pouch (Couly and Le Douarin, 1985). Expression of Eya 1 and 2 (Xu et al., 1997) and Six-3 (Bovolenta et al., 1998) are detected later, after formation of the derivatives, in the nasal placode. OTX-1 and -2 are expressed in both olfactory (MOE and VNOE) as well as respiratory epithelium (Simeone et al., 1993), while Pax-6, although robustly expressed throughout the nasal placode, becomes restricted to cells in the olfactory epithelium (Grindley et al., 1995). Eya 1 and 2 (Xu et al., 1997) and Six-3 (Bovolenta et al., 1998), expressed throughout the nasal placode, also appear to become restricted to the olfactory epithelium. To date, the only transcription factor reported to be limited to the respiratory epithelium is AP-2 (Chazaud et al., 1996; Kramer et al., 2000). Three related AP-2 genes plus variants have been identi®ed, AP-2a , -b and -g (Mitchell et al., 1987; Meier et al., 1995; Moser et al., 1995; Chazaud et al., 1996; OhtakaMaruyama et al., 1998). AP-2a , the focus of this study, is a trans-acting regulatory protein (enhancer-binding protein) expressed initially in neural crest (Mitchell et al., 1991; Shen et al., 1997) and in many neural, neuroectodermal and ectodermal tissues during development. AP-2a is important in embryogenesis, especially in craniofacial development and midline fusion (Schorle et al., 1996; Zhang et al., 1996). It is expressed throughout nasal regions in mesenchymal cells (Moser et al., 1997) and has also been detected in the nasal cavity; but limited to the respiratory epithelium (Kramer et al., 2000). AP-2a mediates transcriptional activation in response to two different signal transduction pathways, the phorbol-ester and diacylglycerolactivated protein kinase C and the cAMP-dependent protein kinase A (Imagawa et al., 1987). Coupled to more than one pathway, AP-2a may serve as a bridge, coordinating effects and ensuring that target genes will be regulated in response to a variety of different signals (Moser et al., 1997). The AP-2a gene encodes a retinoic acid-inducible basic, helix±span±helix DNA-binding protein (Luscher et al., 1989; Williams and Tjian, 1991a,b), and its expression is associated with a decrease in proliferation (Gaubatz et al., 1995; Zeng et al., 1997) and cellular differentiation (Mitchell et al., 1987; Medcalf et al., 1990; Greco et al., 1995;

Johnson et al., 1997; Ohtaka-Maruyama et al., 1998). A mechanistic linkage in AP-2a dependent systems is the commonality of inductive tissue interactions (Mitchell et al., 1991; Schorle et al., 1996; Zhang et al., 1996; Shen et al., 1997; Nottoli et al., 1998) usually associated with an epithelial±mesenchymal transition. Recent work using chimeric mice indicates direct involvement of AP-2a in early eye development (West-Mays et al., 1999) and demonstrated trans-differentiation of speci®c retinal cell types as well as absence of de®ned cell layers in the lens of chimeric mice. The detection of AP-2a in the respiratory epithelium, together with its role in early morphogenesis of the lens vesicle (West-Mays et al., 1999), suggested that AP-2a may play a similar role in the developing olfactory system ± part of a mechanism (molecular boundary) delineating the respiratory epithelium from the olfactory epithelium. To examine this issue, nasal development was analyzed in mice lacking AP-2a using four phenotypic markers: the neuropeptide LHRH which is ®rst detected in cells localized to the olfactory pit/vomeronasal organ anlage (Wray et al., 1989a,b), the olfactory epithelial intermediate ®lament peripherin which is expressed in all axons of sensory receptors in the olfactory epithelium (Gorham et al., 1991), the neural cell adhesion molecule NCAM which is expressed on sensory receptor axons and cells in the olfactory epithelium (Croucher and Tickle, 1989), and the transcription factor Olf-1 which is expressed in sensory receptors (Davis and Reed, 1996). The nasal placode is identi®able at ,embryonic day 10.0 (E10.0) in mice. The transcription factor, Olf-1 is present in sensory cells of the olfactory epithelium, both MOE and VNOE and has been detected as early as E11 (Davis and Reed, 1996). Sensory ®bers have been detected leaving the olfactory epithelium using antibodies to peripherin or NCAM at E11±11.5 (Wray et al., 1994). The presence of such axons associated with respiratory epithelial cells has not been reported. Thus, Olf-1, peripherin and NCAM can be used as markers for sensory olfactory epithelial cells. LHRH neurons are ®rst detected in cells located in the budding olfactory pit at E10.75 (Wu et al., 1995), shortly after the nasal placode begins to invaginate. Thereafter LHRH cells migrate into the CNS; leaving the nasal region unlike other cells types arising from the nasal placode (Wray et al., 1989a,b). Thus, the use of these four markers allows analysis of a wide range of developmental events in differentiation and morphogenesis of the nasal placode. Alterations in these markers in the absence of AP-2a could elucidate the role this transcription factor plays in the development of the respiratory and olfactory epithelium, how they are speci®ed and how the boundary between them is de®ned. Our ®ndings con®rm that AP-2a is a marker of respiratory epithelium during development and that removal of AP-2a does not alter initial differentiation of the respiratory and olfactory epithelium from the nasal placode. However, at a later stage, a small proliferative region of presumptive respiratory epithelium ectopically expressed the markers

P.R. Kramer et al. / Mechanisms of Development 94 (2000) 79±94

LHRH and peripherin in the absence of AP-2a . These results are consistent with ectopic inductive interactions leading to aberrant expression of signals specifying LHRH and peripherin cell types within the respiratory epithelium of AP-2a mutant mice. 2. Results 2.1. Transcription factor AP-2a expression within the developing nasal epithelium in vivo Camera lucida drawings of E10.5±12.5 mice are shown in Fig. 1 and indicate the complex morphogenesis that the nasal placode undergoes in the early stages of nasal cavity formation. AP-2a transcript was detected in cells in nasal regions during nasal placode formation (E10.0 animals, data not shown). As the nasal placode begins to invaginate (E10.5, n ˆ 3), AP-2a mRNA and protein (Fig. 1A) were expressed in a small group of cells close to the surface ectoderm (Fig. 1A, arrowheads) as well as throughout nasal mesenchymal cells. The invaginating region of the nasal placode was devoid of AP-2a staining but cells positive for Olf-1 were present (Fig. 1B) indicating the area of the presumptive olfactory epithelium. Many cells between these two regions were unstained by either marker. At E11.5 (n ˆ 3) AP-2a expression appeared restricted to cells within the respiratory epithelium anlage (Fig. 2A (mRNA) and Fig. 2B (protein), arrow), and was still absent from cells within the developing olfactory epithelium (Fig. 2A,B). At all older stages examined (E12.5±14.5, n ˆ 3; E15.5, n ˆ 4), the olfactory pit/vomeronasal organ and olfactory epithelium contained no AP-2a -expressing cells. In contrast to derivatives of the olfactory epithelium, AP-2a expression continued in cells in the rostral respiratory epithelium (Fig. 2C±F, arrow). However, a region along the midline nasal passage was AP-2a negative. Between E13.5 and 15.5, a decrease in nuclei staining for AP-2a in cells in the rostral respiratory epithelium was noted (compare 2E and F, arrow), suggesting AP-2a expression is restricted to fewer respiratory cell types in older animals. 2.2. Ectopic LHRH-expressing cells and peripherinexpressing cells in the respiratory epithelium of AP-2a mutant embryos As previously reported (Schorle et al., 1996; Zhang et al., 1996), the craniofacial area of AP-2a mutant animals was deformed. However, the surface ectoderm invaginated and formation of the respiratory epithelium, olfactory epithelium and olfactory pit was morphologically evident in most AP-2a mutants (Fig. 3). To determine whether nasal region cell types were present in mutant mice, the expression patterns of four olfactory epithelial markers were examined; LHRH, peripherin, NCAM (n ˆ 5) and Olf-1 (n ˆ 4). In both wild-type and AP-2a mutant E13.5±15.5 (n ˆ 5) embryos, periph-

81

erin-positive axons were detected emerging from cells in the olfactory epithelium and olfactory pit (Fig. 3A (wild type) and Fig. 3B (mutant), arrows). In addition to peripherin-positive axons, LHRH-expressing cells were detected leaving the olfactory pit and migrating across the nasal septum into the forebrain (Fig. 3C±F, arrows). The LHRH cells migrated along axonal tracks (arrowheads) in both wild-type (Fig. 3E) and mutant mice (Fig. 3F). These axonal tracks were peripherin-positive (see Fig. 3A,B), indicating that in both genotypes LHRH neurons migrated in association with peripherin-positive axons (data not shown; Wray et al., 1994). Notably, during this same developmental period, LHRH cells (Fig. 3F, white arrow; Fig. 4B,C,E,F, arrows) and peripherin-expressing cells (Fig. 4C,D) were visualized within (Figs. 3F and 4B,D), and adjacent to (Fig. 4C±F) the respiratory epithelium in mutant but not wild-type embryos. Both LHRH mRNA (Fig. 4E) and protein (Fig. 4B,C,F) were visualized in serial sections. Similar to that observed for LHRH neurons leaving the olfactory pit (Fig. 3; Wray et al., 1994), ectopic LHRHexpressing cells within and adjacent to the respiratory epithelium were associated with peripherin-positive axons (Fig. 4C). LHRH cells directly adjacent to the respiratory epithelial tissue were observed starting at E13.5 (Fig. 4B). 2.3. LHRH cells within the respiratory epithelium are not associated with Olf-1 or NCAM As in normal mice ((Davis and Reed, 1996) Fig. 8), Olf-1 was present throughout cells of the olfactory epithelium in AP-2a mutants (Fig. 4B), but was not detected in the region of the respiratory epithelium that ectopically expressed LHRH and peripherin (Figs. 4B and 5). NCAM-positive axons were detected leaving the MOE and crossing the nasal septum to the developing brain in both mutant (Fig. 5C) and normal mice (data not shown; Wray et al., 1994). In addition, NCAM (Fig. 5C, boxed asterisk and inset) and Olf-1 (Fig. 5E, asterisk) were detected in association with LHRH-immunopositive neurons, in the nasal/palatine epithelium of a few mutant mice. The presence of these markers in this region suggests that an aspect of the VNOE underwent inappropriate morphogenesis in some animals, although most AP-2a mutants had clearly formed olfactory pits (Fig. 3D,F). An occasional light NCAM-immunopositive cell (Fig. 5D) was detected in the region of the respiratory epithelium in which ectopic LHRH neurons and peripherin-positive ®bers were observed (Fig. 5A,B). Unlike peripherin, no NCAM-positive axons were detected leaving the respiratory epithelium in mutant mice. In addition, large clusters of LHRH-immunopositive neurons were observed in the nasal septal area which were not associated with NCAM-positive axons (Fig. 5C, arrow). 2.4. The total number of LHRH cells in the nasal region increases in AP-2a mutant embryos Large numbers of LHRH neurons are present in murine

82

P.R. Kramer et al. / Mechanisms of Development 94 (2000) 79±94

Fig. 1. AP-2a is expressed in the presumptive respiratory epithelium in the nasal placode. (Left) Camera lucida drawings of E10.5, 11.5 and 12.5 mice showing complex morphogenesis that occurs in the nasal placode to produce the respiratory and olfactory derived structures. fb, forebrain; III, third ventricle; IV, fourth ventricle; oe, olfactory epithelium; p, olfactory pit; t, tongue; re, respiratory epithelium. (Right) AP-2a staining was present in cells at the ventral and dorsal edges of the nasal placode (A, white cells, arrowheads) while Olf-1 was present medially, de®ning the olfactory epithelial anlage (B, black cells, arrowheads). (C) Is overlay of (A,B). AP-2a -positive nuclei are mainly facial mesenchyme (m). Olf-1-positive cells are also present in the developing forebrain (B, arrow). There is a region of nasal placode that does not contain Olf-1 or AP-2a (contains neither white nor black cells). Note: the E10.5 section was cut diagonally such that a majority of the nasal placode is pictured. Bar ˆ 100 mm.

nasal regions at E12.5 (Schwanzel-Fukuda and Pfaff, 1989; Wray et al., 1989a). Thereafter, from E13.5 to 15.5, the number of LHRH neurons within this region declines as LHRH neurons migrate into the developing brain (Schwanzel-Fukuda and Pfaff, 1989; Wray et al., 1989a). Immunopositive LHRH neurons in nasal regions of AP-2a mutants

and wild-type littermates were quantitated at these developmental stages. At E12.5 and 13.5, no differences were found between mutant and wild-type mice in the number of LHRH neurons present in nasal regions (Fig. 6A), indicating that migration of LHRH neurons was proceeding normally in mutants. Consistent with previous results (Wray et al.,

P.R. Kramer et al. / Mechanisms of Development 94 (2000) 79±94

83

Fig. 2. During development, AP-2a expression is restricted from cells of the olfactory epithelium and vomeronasal organ but maintained in cells in the rostral tip of the respiratory epithelium. For schematic diagrams of embryonic tissue at E11.5 (A,B) and 12.5 (C,D, see Fig. 1. AP-2a transcript (A) and protein (B) were detected in the presumptive respiratory epithelium at E11.5 (arrow). At this stage, AP-2a expression was not detected in cells in the developing olfactory epithelium (oe). AP-2a transcript was present in the hindbrain of the E11.5 animal (A); this view is not present in (B). At E12.5 (C: mRNA; D: protein), when LHRH neurons emerge from the olfactory pit and begin their migration into the developing forebrain (fb), AP-2a expression was not detected in cells in either the olfactory epithelium (oe) or olfactory pit (p). However, AP-2a transcript and protein were maintained in respiratory epithelial cells, located adjacent to the nasal openings (arrow). This pattern of AP-2a expression was maintained throughout the time points examined (E: AP-2a protein at E13.5; F: AP-2a protein at E15.5). Inset in lower left corner of (E) displays enlarged view of box region to indicate the nuclear AP-2a staining (arrows) adjacent to Nissl-stained nuclei. t, tongue. Bar ˆ 100 mm (A,B,F); 200 mm (C±E).

1989a), the total number of LHRH neurons within nasal regions and within the forebrain totaled ,800 in both mutant and wild-type mice, implying differentiation of LHRH neurons was similar (E13.5 wild-type (nasal region, 447 ^ 42) 1 (forebrain, 317 ^ 87) ˆ 764); (E13.5 mutant (nasal region, 399 ^ 118) 1 (forebrain, 306 ^ 51) ˆ 705).

These results suggested that AP-2a expression is not essential for early development of LHRH neurons in the olfactory pit or their migrational pathway. In contrast to E12.5 and 13.5 embryos, E14.5 and 15.5 mutant embryos had a signi®cant increase (P , 0:01) in the mean number of LHRH cells present in nasal regions (Fig. 6A).

84

P.R. Kramer et al. / Mechanisms of Development 94 (2000) 79±94

Fig. 3. Initial development of olfactory derived cell types appeared normal in AP-2a mutants followed by ectopic expression in respiratory epithelium. The olfactory epithelium (oe) and olfactory pit (p) form in the wild-type and mutant mice (compare A, C and E (wild-type mice) to B, D and F (mutants), respectively). Peripherin ®bers form axonal bundles (A,B, arrows) which extend from both the olfactory pit and olfactory epithelium towards the forebrain (fb). Peripherin ®ber formation and position were unaffected by the AP-2a mutation (compare A (wild-type) to B (AP-2a mutant)). Between E12.5 and 13.5, differentiation and migration of LHRH neurons was similar in wild-type embryos (C) and AP-2a mutants (D), with immunopositive LHRH neurons (black arrows) emerging from the olfactory pit and migrating across the nasal septum on tracks into the developing forebrain (fb; dashed line). From E14.5 (E,F) to 15.5 (data not shown), migration of LHRH neurons from the olfactory pit (arrows) on tracks (arrowheads) across the nasal septum was still observed in both wild-type (E) and mutants embryos (F). However, a small population of LHRH-expressing cells (F, open arrow) was also detected in the rostral nasal epithelium (F, dotted region) in mutant mice (see Fig. 4). Dashed lines, nasal/forebrain junction in (A±E). Bar ˆ 100 mm.

E14.5 and 15.5 wild-type and mutant embryos had large numbers of LHRH neurons crossing the cribriform plate (Fig. 6B, n ˆ 15), indicating that LHRH neurons continued to migrate into the forebrain at these ages. Unexpectedly, in mutant mice, forebrain LHRH cell counts could not be obtained after E13.5 due to a signi®cant decrease in LHRH expression,

both mRNA and protein, in forebrain but not nasal LHRH cells (Kramer et al., 2000). However, the increase in nasal LHRH cells observed in E14.5 and 15.5 mutant mice, in conjunction with the high number of LHRH neurons detected crossing the cribriform plate and entering the forebrain (Fig. 6B) suggested a signi®cant increase in the total number of LHRH cells in these

P.R. Kramer et al. / Mechanisms of Development 94 (2000) 79±94

85

Fig. 4. A subpopulation of LHRH-expressing cells originate from the respiratory epithelium of AP-2a mutants. Schematic of an E13.5 mouse embryo (A) indicates the location of the respiratory epithelium (re, black arrow) in relation to the olfactory epithelium (oe) in the developing nose. LHRH neurons are present in the respiratory epithelium of AP-2a mutant mice (B, E13.5): note that this section has an unusually high number of LHRH cells in, and emerging from, the respiratory epithelium. Olf-1-Positive cells (B, brown cells) are present in the olfactory epithelium. A cell immunopositive for LHRH (C, black arrow) is within the respiratory epithelium (re; a low magni®cation of this section can be seen in Fig. 3F). Adjacent sections (C±F) were overlaid on (C) and each was assigned a different color. Panel (D) is a dark-®eld image showing peripherin staining (red ®bers in C). Peripherin-immunopositive ®bers were detected in the nasal septum (open arrow) and also emerging from the respiratory epithelium (white arrows) towards the brain; inset is an enlarged image of the peripherin ®bers (black arrows) adjacent to the respiratory epithelium (bright ®eld). In a subsequent section (E) in situ hybridization for LHRH mRNA is shown (dark ®eld, white arrows; appears as blue grains in C). Staining for LHRH protein in the adjacent section (green cells in C, and black cells in F, open arrows) indicated LHRH cells apposed to peripherin ®bers, tracking linear to previously shown LHRH cells (C±E). Sections (C±F) are an E14.5 embryo where the rostral tip of the nose is to the right. Bar ˆ 100 mm.

mice had occurred, since migrational cues appeared to be intact. Mutant mice had ,300 more nasal LHRH cells than their wildtype littermates (E14.5: 287 ^ 77, n ˆ 4; E15.5: 311 ^ 43,

n ˆ 3). These results suggested that in mutant mice, onset of LHRH expression occurred late ….E12:5† in a population of cells leading to the observed increase at E14.5 (Fig. 6A). To

86

P.R. Kramer et al. / Mechanisms of Development 94 (2000) 79±94

Fig. 5. LHRH cells and peripherin cells within the respiratory epithelium arise from tissue that does not contain other olfactory epithelial markers. Sections (A,C) are separated by a distance of 60 mm, the remainder are adjacent sections. In (A), high magni®cation of boxed region is shown in inset (upper right), while (D,F) are high magni®cations of (C,E), respectively. LHRH neurons (blue-black, black arrows) are associated with peripherin ®bers (A,B, brown ®bers, arrowheads) in the nasal regions as well as the respiratory epithelium (re) in AP-2a mutant mice (E14.5): note that the olfactory pit is lateral of section in A. NCAM-positive ®bers (C, brown ®bers) are present in the olfactory epithelium (oe), near the cribriform plate and in the ventral nasal region (boxed region: asterisk). High magni®cation of the box region (*) is shown in the inset (lower left). One NCAM-positive cell was within the respiratory epithelium (D, open arrowhead); note that this was the highest NCAM signal observed in the respiratory epithelium (n ˆ 4 embryos). An LHRH cell cluster is present in the nasal septum (C, arrow) which is not associated with NCAM-positive ®bers. Olf-1 staining (E, brown nuclei) was present in the olfactory epithelium and the ventral nasal region (*), but absent from this region of the respiratory epithelium (F). Bar ˆ 200 mm (A,C,E); 50 mm (B,D,F).

further understand the increase in LHRH neurons in nasal regions of AP-2a mutants, the number of ectopic LHRH neurons in the respiratory epithelium was quanti®ed and the mitotic activity of cells within this region was examined. 2.5. LHRH cells associated with proliferative cells in or near the respiratory epithelium The number of LHRH-expressing cells in the respiratory epithelium was greatest between E13.5±14.5 (E12.5 ˆ 7.5, n ˆ 2; E13.5 ˆ 40 ^ 8, E14.5 ˆ 65 ^ 10, E15.5 ˆ 17 ^ 3, n $ 3; note that only cells within the respiratory epithelium were included in these values). To determine the mitotic

activity of cells within this region, the marker Ki67 was chosen. The protein recognized by the Ki67 antibody is believed to maintain higher order structure for DNA during mitosis and as such is a robust marker of proliferative cells (Sawhney and Hall, 1992). Ki67 is found in the nuclei of all cells in the G1, S, G2 and M phases of the proliferative cycle, unlike tritiated thymidine and BrdU that are limited to detecting S-phase cells (Smith et al., 1995). Ki67 is absent from resting cells (Wang et al., 1996). The use of a marker present throughout the entire mitotic cycle, increased the likelihood of detecting proliferating neurons associated with LHRH expression. In the nasal tracks (cords of olfactory axons) or forebrain of AP-2 mutant embryos,

P.R. Kramer et al. / Mechanisms of Development 94 (2000) 79±94

,2% of LHRH-expressing cells were found within 20 mm of Ki67-positive nuclei (n ˆ 6; data not shown). In contrast, 65±70% of LHRH-expressing cells (Fig. 7, blue-black cells) within (Fig. 7C) or 40 mm from (Fig. 7A,B, arrow) the respiratory epithelium of E13.5±15.5 mutant embryos (n ˆ 6) were touching or within 10 mm of cells that had Ki67-positive nuclei (Fig. 7B,C,E, brown nuclei). In a few cells, LHRH and Ki67 expression colocalized (Fig. 7B,C, white arrowhead). In the respiratory epithelium where LHRH cells (Fig. 7E, black cells, arrows) were adjacent to Ki67 cells (Fig. 7E, brown cells, arrowhead), Olf-1 (Fig. 7D) was not expressed. At these same ages, LHRH cells in tracks (Fig. 7A, black cells, no arrows) and crossing the nasal septum (data not shown) were rarely found within 40 mm of Ki67-positive cells. In wild-type embryos Olf-1, NCAM- and peripherin-positive nuclei were not observed in the respiratory epithelium (Fig. 8). Ki67-positive cells were present in wild-type embryos in the dividing basal layer of the olfactory epithelium (for review see Crews and Hunter, 1994), in the ventral olfactory epithelial tissue (Fig. 8F,G) and a few Ki67-positive cells were present in the respiratory epithelium (Fig. 8F,H). Wild-type embryos had ,2% of LHRH-expressing cells within 150 mm of the respiratory epithelium (n ˆ 6).

87

in the MOE and VNOE. Peripherin-positive ®bers and NCAM-positive ®bers were detected exiting the MOE and VNOE, fasciculated into large axon bundles that crossed the nasal septum and entered the developing CNS. LHRH cells were within and adjacent to the olfactory pit/VNO anlage, detected in the nasal septum in association with sensory axons and traversed the cribriform plate into the developing CNS. The similarities between mutant and wild-type mice, with respect to olfactory morphological changes and molecular expression patterns, suggest that AP-2a is not essential for differentiation of olfactory tissue from the nasal

3. Discussion Transcription factor AP-2a is known to play a developmental role, effecting both differentiation and cell growth (Mitchell et al., 1991; Schorle et al., 1996; Zhang et al., 1996). In vivo examination of AP-2a transcript and protein in nasal regions determined that AP-2a expression is in cells in the nasal placode and continues in a region of the respiratory epithelium. To date, this is the only identi®ed transcription factor present in the nasal placode that becomes limited to cells of the respiratory epithelium and restricted from cells in the olfactory epithelium. Mice lacking AP-2a were analyzed to address the role AP-2a plays in differentiation of these two tissue types from the nasal placode. Four markers, the intermediate ®lament protein peripherin, the olfactory transcription factor Olf-1, neural cell adhesion molecule (NCAM) and neuropeptide LHRH, were used to monitor a wide range of developmental events associated with morphogenesis and differentiation of the nasal region. As in wild-type mice, AP-2a mutants showed several morphological changes associated with the development of the olfactory region. These included invagination of the nasal placode, budding off of the olfactory pit and formation of the VNO anlage, convolution of the nasal cavity and formation of the nasopalatine passage (Brunjes and Frazier, 1986). In addition to conserved morphological changes, all four markers examined were associated with structures of the olfactory epithelium in mutant mice similar to that observed in wild-type mice. Olf-1 was expressed in cells

Fig. 6. (A) Quantitation of immunopositive LHRH cells in nasal regions. Cell counts revealed signi®cant differences (P , 0:01) between the mean LHRH cell number detected in wild-type versus mutants at these stages (double asterisk). In wild-type mice, the number of LHRH neurons detected in nasal regions decreased as LHRH neurons migrated into the developing forebrain (single asterisk indicates signi®cant difference in LHRH nasal cell counts (P , 0:05) at E12.5 vs. 14.5 and E12.5 vs. 15.5). However, in mutant embryos, although LHRH cells migrated into the forebrain (see B), the number of LHRH cells in nasal areas increased at E14.5 and 15.5 (double asterisk indicates signi®cant difference in LHRH cells in nasal areas between wild-type and mutant mice at speci®c age), suggesting proliferation of new LHRH-expressing cells (possibly from the respiratory epithelium) and/or recruitment of differentiated non-LHRH-expressing cells just prior to E14.5. n ˆ 2 for E12.5 and n $ 3 for all other ages. Values are mean ^ SEM. In mutant mice (B), as in wild-type mice, LHRH cells (blue-black) crossed the cribriform plate (solid line) and entered into the developing forebrain (fb, arrows). Bar ˆ 50 mm.

88

P.R. Kramer et al. / Mechanisms of Development 94 (2000) 79±94

Fig. 7. LHRH-expressing cells in the respiratory epithelium arise from a proliferating population in AP-2a mutants. Immunostaining for Ki67 indicated positive cells (A, brown nuclear staining, arrowhead; higher magni®cation shown in B) associated with LHRH-expressing cells (black staining, white arrowhead) emerging from the respiratory epithelium in an E15.5 mutant mouse. An LHRH cell, adjacent to the lateral edge of the respiratory epithelium, was-positive for Ki67 (white arrowhead). Apposed to this coexpressing cell is a cluster of LHRH-positive/Ki67-negative cells (B, arrow). LHRH cells in the respiratory epithelium (C, dashed line delimits the respiratory epithelium) were associated with Ki67-positive cells (black arrowheads) and one cell (open arrowhead) is positive for both LHRH (black reaction product) and Ki67 (brown nucleus), while another was positive for LHRH only (arrow). Olf-1 staining (D, brown nuclei) decreases dramatically (line) before the respiratory epithelium (re) in AP-2a mutants. Note: very few Olf-1-positive nuclei are found in the respiratory epithelium (inset ± high magni®cation of (re) in D). Adjacent section (E) indicates LHRH cells (black cells, arrows) within the respiratory epithelial region negative for Olf-1 (D) are adjacent to Ki67-positive cells (brown cells, arrowheads). c, cartilage; oe, olfactory epithelium; re, respiratory epithelium. Bar ˆ 20 mm (B,C); 100 mm (A); 200 mm (D,E).

placode and subsequent olfactory sensory maturation and axon outgrowth, as well as LHRH neuronal development. In contrast to the olfactory epithelium, differences between AP-2a mutant and wild-type mice were observed in the respiratory region. LHRH-positive cells and peripherin-positive cells were present in, extending out of, and adjacent to the respiratory epithelium starting at E12.5 and continuing until E15.5. LHRH cells have been reported in the respiratory epithelium of normal chick (Hilal et al., 1996); however, the expression of these markers in cells in the respiratory epithelia was not observed in wild-type mice. Although LHRH-positive cells and peripherin-positive cells were detected in the respiratory epithelium of mutants, Olf1 expression was absent from this region. Sporadic Olf-1 cells were detected outside the olfactory epithelium (MOE and VNOE) in both mutant and wild-type mice, but decreased in occurrence towards the respiratory epithelial region. An occasional NCAM-positive cell was detected in

the respiratory epithelium region in which ectopic LHRHpositive cells and peripherin-positive cells were observed. But NCAM-positive ®bers were not detected extending from this region as was found for peripherin-positive ®bers. The ectopic expression of LHRH and peripherin in respiratory epithelial cells in mutants overlapped the time period of AP-2a expression in the respiratory epithelium in wild-type mice (E10.5±15.5). These results suggest that AP-2a represses expression of certain olfactory epithelial-associated subpopulations within the respiratory epithelium and/or displacement of a subset of LHRH and peripherin progenitors cells occurred in AP-2a mutant mice. To distinguish between repression of phenotypic expression and/or displacement of progenitor cells, we quantitated the number of LHRH neurons in nasal regions and examined proliferation of cells within the respiratory epithelium of mutant mice. In normal mice, LHRH cells become postmitotic between E10.0 and 11.0 and it has been hypothesized

P.R. Kramer et al. / Mechanisms of Development 94 (2000) 79±94

that two bilateral groups of 50 cells (100 progenitors) give rise to this population of 800 LHRH cells (Wray et al.,

89

1989a). The normal number of LHRH neurons (,800) quantitated at E12.5±13.5 in mutant mice, together with the fact

Fig. 8. Olf-1, NCAM and peripherin cells are not expressed in the respiratory epithelium in wild-type mice. At E14.5, Olf-1 (A, brown cells) was expressed in the olfactory epithelium (oe) and the olfactory pit (op; vomeronasal organ) but not the respiratory epithelium (re). Note the Olf-1-positive cells along the channels of the olfactory epithelium (A enlarged in B, left-hand side of the dashed line). The epithelial channel (hatched marked tissue) extending from the respiratory epithelium is negative for Olf-1 until the solid line borders. The respiratory epithelium in (A) is enlarged in (C). No Olf-1-positive cells are present. A section from an E15.5 embryo stained for NCAM is shown in (D) and peripherin in (E) (adjacent sections). NCAM and peripherin ®bers (arrows) are adjacent to the respiratory epithelium but these ®bers arise from the trigeminal ganglia. (F) Mitotic cells (brown) are present within the olfactory epithelium (G: enlargement of F) and the respiratory epithelium (H: enlargement of F) of wild-type mice (E14.5) as indicated by Ki67 staining. Dashed line indicates the center of the epithelial channel and solid line marks the olfactory-respiratory epithelium border as in (A,B). Bar ˆ 500 mm (A); 200 mm (F); 100 mm (D,E).

90

P.R. Kramer et al. / Mechanisms of Development 94 (2000) 79±94

that LHRH cells emerged from the olfactory pit, suggests that the usual group of LHRH neuronal progenitors was not affected by the absence of AP-2a . As such, this argues against misplaced LHRH progenitors ending up in the respiratory epithelium due to morphological changes in the facial structures of AP-2a mutants. However, with this small a number of cells, could a single misplaced progenitor which did not become postmitotic at the normal time, possibly produce the extra 300 LHRH cells observed at E14.5±15.5? In the respiratory epithelium, ,8 LHRH cells were detected at E12.5, 40 ^ 8 were detected at E13.5, 65 ^ 10 were detected at E14.5 and17 ^ 3 were detected at E15.5. A single misplaced progenitor cell, showing three cell divisions (average cell cycle at this time being ,8.5 h, Wray et al., 1989a) between E11.5 and 12.5 would produce eight cells. If the mitotic cycle of such cells then increased to ,12 h (Minkoff, 1984), one would expect to see 32 cells at E13.5 and 128 at E14.5. Bilateral misplacement of a single progenitor cell could thus account for 256 ectopic LHRH cells. Alternatively, with an average mitotic cycle of ,12 h (Minkoff, 1984) a population of 40 recapitulated LHRH `progenitor' cells observed at E13.5 would produce ,160 cells at E14.5 and thus could account for ,320 new LHRH cells (bilateral populations), similar to the ,300 extra LHRH cells observed in this region. Both premises described above rely on the fact that the ectopic LHRH cells in the respiratory epithelium were derived from mitotic progenitors. To examine proliferative cells an antibody against Ki67 was used. The presence of a few double-labeled Ki67 stained LHRH neurons in the respiratory epithelium indicate proliferative cells gave rise to at least a portion of the ectopic LHRH population and suggests that the ectopic LHRH neurons were not induced by developmental cues at the same time as the cues that produced the original LHRH neuronal population from the olfactory pit (E10.0±11.0, Wray et al., 1989a). This observation argues against recruitment of differentiated post-mitotic non-LHRH-expressing cells being responsible for the increase in the total LHRH cell number observed in nasal regions. Furthermore, the signi®cant (P ˆ 0:05) decrease in the number of LHRH neurons within the respiratory epithelium at E15.5 indicates the events leading to the excess LHRH neurons are restricted to a speci®c developmental window. Thus, the increase in nasal LHRH neurons in mutant mice, could be accounted for exclusively by proliferative cells in the respiratory epithelium producing the LHRH phenotype and subsequent migration of these neurons into the nasal septum. 3.1. LHRH neurons are associated with peripherin ®bers from the respiratory epithelium In AP-2a mutant mice, peripherin-positive axons were consistently observed in the region of the respiratory epithelium in which ectopic LHRH cells were detected. Although only a subpopulation of the respiratory epithelium showed ectopic LHRH and peripherin expression, an important rela-

tionship between these components was maintained; the LHRH cells exiting the respiratory epithelium were apposed to peripherin-positive ®bers that formed tracks from the epithelial border into the nasal septum. Together these results indicate that LHRH cells within and migrating from the respiratory epithelium led, at least in part, to the increase in LHRH neurons in nasal regions of AP-2a mutants. Furthermore, these results suggest that in addition to the cues leading to the LHRH and the peripherin phenotype, other developmentally important cues were maintained in these ectopically located cells. Cues which lead to peripherin ®bers showing appropriate orientation in outgrowth and LHRH cells recognizing these peripherinpositive ®bers as an appropriate migrational pathway. 3.2. Respiratory epithelium in AP-2a mutants does not have olfactory epithelial markers Unlike peripherin, NCAM-positive ®bers were not consistently observed in the region of the respiratory epithelium in which ectopic LHRH cells were detected. A role for NCAM/PSA-NCAM in LHRH neuronal migration in wild-type mice has been proposed (Murakami et al., 1991; Schwanzel-Fukuda et al., 1994; Yoshida et al., 1999). However, two lines of evidence indicate that the presence of all isoforms of NCAM are not essential for LHRH neuronal migration. These include movement of LHRH cells (1) in NCAM-180 mutant mice (Yoshida et al., 1999), and (2) on NCAM-negative ®bers in nasal explants (Fueshko and Wray, 1994). The absence of NCAM ®bers in association with ectopic LHRH cells in AP-2a mutant mice supports an alternative molecule being involved in LHRH neuronal migration. Future work in these mice may be useful to delineate the molecule(s) underlying LHRH cell movement. LHRH expression, morphology and migration towards the forebrain in a restricted population of cells from the respiratory epithelium and their association with peripherin ®bers is consistent with a recapitulation of developmental events normally observed in a subset of olfactory pit cells. However, the number of LHRH-expressing and peripherinexpressing cells in the respiratory epithelium of mutants was limited as compared to the number of AP-2a -expressing cells in wild-type mice. In addition Olf-1-positive nuclei are numerous in the olfactory epithelium, but rare in the respiratory epithelium of mutants, consistent with that of wild types (Davis and Reed, 1996). Similarly, large numbers of NCAM-positive ®bers are associated with the developing olfactory epithelium (Terkelsen et al., 1989), but are also rare in the respiratory epithelium of mutants, as in wild-type embryos. These data indicate that the absence of AP-2a does not make the molecular environment of the respiratory epithelium equivalent to that of the olfactory epithelium, and suggests that extracellular signals may lead to the restricted expression detected in respiratory epithelial cells of AP-2a mutants and/or that AP-2a induces apoptosis in

P.R. Kramer et al. / Mechanisms of Development 94 (2000) 79±94

presumptive LHRH and peripherin cells in the respiratory epithelium of wild-type mice. The separation of the olfactory markers in the respiratory epithelium argues against misplacement of a progenitor population of cells. Alternatively, Olf-1 and NCAM progenitors are spatially separated from LHRH peripherin progenitors in the nasal placode. In normal mice, LHRH cells are ®rst observed in the olfactory pit (SchwanzelFukuda and Pfaff, 1989; Wray et al., 1989a,b; Wu et al., 1997). This observation, together with a variety of ablation/transplantation studies in rats (Daikoku-Ishido et al., 1990) and chick (Norgren and Lehman, 1991; Akutsu et al., 1992; Norgren and Gao, 1994), led to the hypothesis that LHRH cells originate in the nasal placode, in an area more associated with olfactory epithelial derived structures. However, in the chick these regions can be subdivided at early stages (prior to placode formation) with the more anterolateral neural ridge giving rise to the olfactory epithelium (which is located in the posterior area of the anterior lateral ridge) and the proximal part of the nasal cavity (where the olfactory and respiratory epithelium lining the superior and inferior conchae develop), and the more posterolateral neural ridge giving rise to the distal part of the nasal epithelial structures (the vestibular conchae and the nasal pit, Couly and Le Douarin, 1985). Experiments subdividing the anterior and posterior area of the anterior lateral ridge (Amrauoui and Dubois, 1993) found that removal of the posterior area eliminated olfactory epithelial structures but spared the LHRH nasal population. Conversely, removal of the anterior area eliminated respiratory epithelial cells and LHRH cells, but spared olfactory epithelial structures. These experiments suggest that the LHRH progenitors are more closely associated with respiratory rather than olfactory regions, being located in the anterior area of the anterior lateral ridge. In normal animals, at all ages examined, an area existed between AP2a -positive respiratory cells and cells expressing Olf-1. The location of LHRH progenitor cells in this area may explain the disassociation of NCAM- and Olf-1-positive cells from the ectopic region which expressed LHRH and peripherin in mutant mice. If this intermediate region normally gives rise to LHRH cells, then the absence of AP-2a -dependent systems may have led to a recapitulation of developmental events in a subset cells located in an anatomical region predisposed to becoming speci®ed to the LHRH lineage. 3.3. Does transcription factor AP-2a directly affect LHRH and peripherin expression? One role of transcription factor AP-2a in development is to suppress gene expression in differentiated cells (TsaiMorris et al., 1994; Bisgrove et al., 1997). The LHRH and peripherin promoter do not have classic AP-2a binding sites (data not shown), suggesting that AP-2a does not directly repress LHRH and peripherin gene transcription in the

91

respiratory epithelium. AP-2a induces differentiation or proliferation of cells through a signal cascade (Williams et al., 1988; Luscher et al., 1989; Leask et al., 1991; Kannan et al., 1994; Johnson et al., 1997; Ohtaka-Maruyama et al., 1998) as well as acting as a suppressor of these same processes (Gaubatz et al., 1995; Chen et al., 1997; Zeng et al., 1997; Ohtaka-Maruyama et al., 1998). Coexpression of AP-2a mRNA and LHRH mRNA in cells in nasal regions was examined (data not shown). These experiments were inconclusive due to the high expression of AP-2a mRNA in nasal mesenchyme which precluded single cell identi®cation. However, colocalization did not appear to occur. Thus, AP-2a expressed in a placodal progenitor and then approximately 2 days later (E10±12), through an unknown signaling cascade, suppressing LHRH and peripherin expression in the respiratory epithelium is unlikely but cannot be ruled out. Similarly, we cannot rule out that AP-2a induces apoptosis in presumptive LHRH and peripherin cells in the respiratory epithelium of wild-type mice. Tunel analysis was performed on a number of AP-2a mutant and wildtype mice (data not shown). No obvious differences were observed within the respiratory epithelium, but E12.5 mice were not examined and this is a time point for which a peak in apoptosis has been reported in the olfactory epithelium (Voyron et al., 1999). 3.4. Aberrant inductive tissue interactions in the absence of AP-2a could lead to ectopic expression A mechanistic linkage in AP-2a dependent systems is the commonality of inductive tissue interactions (Mitchell et al., 1991; Schorle et al., 1996; Zhang et al., 1996; Shen et al., 1997; Nottoli et al., 1998) usually associated with an epithelial±mesenchymal transition. Thus, the ectopic expression observed in the mutant mice may be dependent on environmental cues. Interestingly, the AP-2a protein has been implicated in the transcriptional regulation of cell adhesion molecules and matrix metalloproteinases, which may coordinate cell±cell communication and cell movement (Fini et al., 1994; Zutter et al., 1994; Hennig et al., 1996; Somasundaram et al., 1996). The nasal placode (E9±10), olfactory epithelium (E10±11) and olfactory pit (E11±12) form sequentially (Tarozzo et al., 1995). Fusion of the mesenchyme and epithelial layers of the olfactory and respiratory epithelium occurs between E10 and 12 of mouse development (Kuratani et al., 1997). Two recent studies led to a direct link between the absence of AP-2a expression and abnormal tissue formation in the facial prominences. One study in chick showed that downregulation of AP-2a in the nasal pit induced by retinoic acid prevented facial closure (Shen et al., 1997). The other study, in AP-2a mutant mice chimeras, discovered abnormal tissue formed in regions having abnormal fusion of the facial prominences (Nottoli et al., 1998). Based on the data acquired in this study and the action of AP-2a in other systems we suggest that aberrant fusion of the facial tissues in AP-2a mutants lead to the

92

P.R. Kramer et al. / Mechanisms of Development 94 (2000) 79±94

observed ectopic expression (E12±13.5) in a restricted region of the respiratory epithelium through inductive interactions. In summary, ectopic expression of LHRH and peripherin in the respiratory epithelium was observed in the absence of AP-2a , but normal morphogenesis of olfactory structures and phenotypes was maintained as was LHRH and peripherin expression and subsequent migration of LHRH neurons associated with peripherin ®bers from the olfactory pit. Thus, transcription factor AP-2a does not appear to be essential for early events in the development of olfactory epithelially derived structures or nasally derived LHRH cells. However, an apparent novel regulatory role for AP2a , uncovered in the AP-2a mutant mice, is to suppress recapitulation of cellular subsets (LHRH cells and peripherin cells) within the presumptive respiratory epithelium. 4. Experimental procedures 4.1. AP-2a 2/2 mouse embryos The homozygous mutation made in the AP-2a gene was described previously (Schorle et al., 1996). Brie¯y, exon 5 was targeted for deletion in the homozygous mutant mice (Schorle et al., 1996). ES lines were generated. Chimeric males were bred to BALB/c and 129/Sv wild-type females to generate heterozygotes for intercrossing. Homozygous mutant mice die perinatally (Schorle et al., 1996). Mutant and wild-type embryos, E12.5±15.5, were used in these studies. 4.2. Single- and double-label immunocytochemistry Antibodies. ProLHRH antisera (Wray et al., 1988) was used at 1:2500, AP-2 monoclonal antisera speci®c for the alpha form of the protein (generous gift from Dr T. Williams) was used 1:1, AP-2 polyclonal antisera (Santa Cruz, CA) was used at 1:400, Olf-1 polyclonal antisera (generous gift from Dr R. Reed) was used at 1:1000, peripherin polyclonal antisera was used at 1:3000 (Chemicon, Temecula, CA), NCAM was used at 1:1000 (generous gift from Dr U. Rutishauser) and Ki67 polyclonal antisera was used at 1:3000 (Novocastra, UK). Single-label immunocytochemistry on frozen embryonic sections (Wray et al., 1989b) was performed using standard avidin±biotin±horseradish peroxidase (Vector, Burlingame, CA) procedures. Double-label immunocytochemistry on frozen parasagittal sections (16±20 mm) from AP-2a mutant and wild-type embryos was performed using an avidin±biotin complex (Vector Labs) and either two chromagens for horseradish peroxidase ((Wray et al., 1994) nickel-enhanced diaminobenzidine (DAB, blue-black reaction) and DAB (brown reaction)) or one chromagen and one ¯uorescent marker (nickel-enhanced DAB and avidin Texas red). Controls for double-label immunocytochemical experiments consisted of replacement of either the ®rst primary or the second primary with a normal goat serum

incubation. Control sections revealed no cross-reactivity between the ®rst and second labeling procedures (data not shown). Mice were cut into three parallel series. Such series allow adjacent sections to be stained for alternative proteins and directly compared (see Fig. 5). LHRH cells (with visible nuclei) were counted on a single series/mouse and the cell number then multiplied by 3 (number of series/animal) to obtain the total number of LHRH cells/animal. Cell counts are given as the mean ^ SEM. Statistical signi®cance comparing various groups of immunopositive neurons was calculated using one-way analysis of variance followed by Fisher's least signi®cant difference test or Bonferroni's multiple comparison test. 4.3. In situ hybridization histochemistry Fresh, frozen mouse embryo sections (16±20 mm) were cut on a Reichert±Jung 2800-Frigocut-E cryostat and mounted on subbed slides. The sections were processed as previously described (Wray et al., 1989a). Brie¯y, sections were ®xed in 4% formaldehyde, rinsed in phosphatebuffered saline, permeabilized in 0.3% Triton X-100/0.05 M EDTA/0.1 M Tris (pH 8.0) buffer, rinsed in Tris buffer (pH 8.0), washed in 0.25% acetic anhydride/0.1 M triethanolamine hydrochloride±0.9% NaCl, rinsed in 2£ SSC, dehydrated through ethanol, delipidated in chloroform, rinsed in ethanol, and air-dried. Slides were processed for LHRH and AP-2a mRNA using both synthetic deoxynucleotides and riboprobes. Synthetic 48-nucleotide probes (5 pmol), complementary to LHRH (5 0 -TTCAGTGTTTCTCTTTCCCCCAGGGCGCAACCCATAGGACCAGTGCTG-3 0 ) or AP-2a (CAACTACCCTACTAAATCCATTCCACAAGCCCAATGTGGGGAGGCCGC) were 3 0 end-labeled with [ 35S]dATP (speci®c activity 1000±1500 Ci/mmol; DupontNEN), 100 units terminal deoxynucleotidyl transferase (Boehringer Mannheim, Indianapolis, IN), and 5£ tailing buffer (Gibco BRL, Grand Island, NY) to a speci®c activity of 10 000±18 000 Ci/mmol. Slides were hybridized overnight in humid chambers at 378C. The following day, hybridized slides were rinsed in 1£ SSC/65 mM DTT, washed at high stringency in 2£ SSC/50% formamide/20 mM DTT at 408C, and washed in 1£ SSC at room temperature. The AP2a riboprobe and the LHRH riboprobe incorporated dUTP and [ 35S]dCTP to a speci®c activity of 90 000 and 110 000 Ci/mmol, respectively, during reverse transcription. Reverse transcription of plasmid BH500 (sequence speci®c for AP-2a , P. Mitchell) digested with BamHI using T7 polymerase produced AP-2a antisense cDNA, and digestion with HindIII using T3 polymerase produced the sense strand. Slides were hybridized (500 000±1 000 000 cpm/ slide) overnight in humid chambers at 558C. Hybridized slides were rinsed in 4£ SSC/20 mM DTT, digested with RNAse, washed in 2£, 1£, 0:5£ SSC/10 mM DTT solutions as previously described (Wray et al., 1989a). All slides were then dehydrated in ethanol, dried, and placed against

P.R. Kramer et al. / Mechanisms of Development 94 (2000) 79±94

®lm. After X-ray ®lm exposure for 5 days, slides were dipped in NTB3 (Eastman Kodak, Rochester, NY) and exposed for 3.5 weeks, emulsion-covered slides were developed in Dektol (Eastman Kodak) at 15±178C, rinsed in water, and ®xed with Kodak ®xer, then counterstained with 0.5% methyl green, dehydrated in ethanol, cleared in xylene, and mounted with Permount (Fisher Scienti®c, Pittsburgh, PA). Control slides hybridized with the sense strand gave only a background signal (data not shown). Acknowledgements We thank Dr Trevor Williams, Dr Cherie Byars, Sharon Key and Jim Nagle. References Akutsu, S., Takada, M., Ohki-Hamazaki, H., Murakami, S., Arai, Y., 1992. Origin of luteinizing hormone-releasing hormone (LHRH) neurons in the chick embryo: effect of the olfactory placode ablation. Neurosci. Lett. 142, 241±244. Amrauoui, A.E., Dubois, P.M., 1993. Experimental evidence for an early commitment of gonadotropin-releasing hormone neurons, with special regard to their origin from the ectoderm of nasal cavity presumptive territory. Neuroendocrinology 57, 991±1002. Ang, S.L., Jin, O., Rhinn, M., Daigle, N., Stevenson, L., Rossant, J., 1996. A targeted mouse Otx2 mutation leads to severe defects in gastrulation and formation of axial mesoderm and to deletion of rostral brain. Development 122, 243±252. Bisgrove, D.A., Monckton, E.A., Godbout, R., 1997. Involvement of AP-2 in regulation of the R-FABP gene in the developing chick retina. Mol. Cell. Biol. 17, 5935±5945. Bovolenta, P., Mallamaci, A., Puelles, L., Boncinelli, E., 1998. Expression pattern of cSix3, a member of the Six/sine oculis family of transcription factors. Mech. Dev. 70, 201±203. Brunjes, P.C., Frazier, L.L., 1986. Maturation and plasticity in the olfactory system of vertebrates. Brain Res. 396, 1±45. Chazaud, C., Oulad-Abdelghani, M., Bouillet, P., Decimo, D., Chambon, P., Dolle, P., 1996. AP-2.2, a novel gene related to AP-2, is expressed in the forebrain, limbs and face during mouse embryogenesis. Mech. Dev. 54, 83±94. Chen, T.T., Wu, R.L., Castro-Munozledo, F., Sun, T.T., 1997. Regulation of K3 keratin gene transcription by Sp1 and AP-2 in differentiating rabbit corneal epithelial cells. Mol. Cell. Biol. 17, 3056±3064. Couly, G.F., Le Douarin, N.M., 1985. Mapping of the early neural primordium in quail-chick chimeras. I. Developmental relationships between placodes, facial ectoderm, and prosencephalon. Dev. Biol. 110, 422±439. Crews, L., Hunter, D., 1994. Neurogenesis in the olfactory epithelium. Perspect. Dev. Neurobiol. 2, 151±161. Croucher, S.J., Tickle, C., 1989. Characterization of epithelial domains in the nasal passages of chick embryos: spatial and temporal mapping of a range of extracellular matrix and cell surface molecules during development of the nasal placode. Development 106, 493±509. Daikoku-Ishido, H., Okamura, Y., Yanaihara, N., Daikoku, S., 1990. Development of the hypothalamic luteinizing hormone-releasing hormonecontaining neuron system in the rat: in vivo and in transplantation studies. Dev. Biol. 140, 374±387. Davis, J.A., Reed, R.R., 1996. Role of Olf-1 and Pax-6 transcription factors in neurodevelopment. J. Neurosci. 16, 5082±5094. Farbman, A.I., 1992. Cell Biology of Olfaction, Cambridge University Press, New York. Fini, M.E., Bartlett, J.D., Matsubara, M., Rinehart, W.B., Mody, M.K.,

93

Girard, M.T., Rainville, M., 1994. The rabbit gene for 92-kDa matrix metalloproteinase. Role of AP1 and AP2 in cell type-speci®c transcription. J. Biol. Chem. 269, 28620±28628. Fueshko, S., Wray, S., 1994. LHRH cells migrate on peripherin ®bers in embryonic olfactory explant cultures: an in vitro model for neurophilic neuronal migration. Dev. Biol. 166, 331±348. Gaubatz, S., Imhof, A., Dosch, R., Werner, O., Mitchell, P., Buettner, R., Eilers, M., 1995. Transcriptional activation by Myc is under negative control by the transcription factor AP-2. EMBO J. 14, 1508±1519. Gorham, J.D., Ziff, E.B., Baker, H., 1991. Differential spatial and temporal expression of two type III intermediate ®lament proteins in olfactory receptor neurons. Neuron 7, 485±497. Greco, D., Zellmer, E., Zhang, Z., Lewis, E., 1995. Transcription factor AP2 regulates expression of the dopamine beta- hydroxylase gene. J. Neurochem. 65, 510±516. Grindley, J.C., Davidson, D.R., Hill, R.E., 1995. The role of Pax-6 in eye and nasal development. Development 121, 1433±1442. Halpern, M., 1987. The organization and function of the vomeronasal system. Annu. Rev. Neurosci. 10 (325-62), 325±362. Hennig, G., Lowrick, O., Birchmeier, W., Behrens, J., 1996. Mechanisms identi®ed in the transcriptional control of epithelial gene expression. J. Biol. Chem. 271, 595±602. Hilal, E.M., Chen, J.H., Silverman, A.J., 1996. Joint migration of gonadotropin-releasing hormone (GnRH) and neuropeptide Y (NPY) neurons from olfactory placode to central nervous system. J. Neurobiol. 31, 487±502. Hill, R.E., Favor, J., Hogan, B.L., Ton, C.C., Saunders, G.F., Hanson, I.M., Prosser, J., Jordan, T., Hastie, N.D., van Heyninger, V., 1991. Mouse small eye results from mutations in a paired-like homeobox-containing gene published erratum appears in Nature 355 (1992) 750. Nature 354, 522±525. Hogan, B.L., Horsburgh, G., Cohen, J., Hetherington, C.M., Fisher, G., Lyon, M.F., 1986. Small eyes (Sey): a homozygous lethal mutation on chromosome 2 which affects the differentiation of both lens and nasal placodes in the mouse. J. Embryol. Exp. Morphol. 97, 95±110. Imagawa, M., Chiu, R., Karin, M., 1987. Transcription factor AP-2 mediates induction by two different signal-transduction pathways: protein kinase C and cAMP. Cell 51, 251±260. Johnson, W., Albanese, C., Handwerger, S., Williams, T., Pestell, R.G., Jameson, J.L., 1997. Regulation of the human chorionic gonadotropin alphaand beta- subunit promoters by AP-2. J. Biol. Chem. 272, 15405±15412. Kannan, P., Buettner, R., Chiao, P.J., Yim, S.O., Sarkiss, M., Tainsky, M.A., 1994. N-ras oncogene causes AP-2 transcriptional self-interference, which leads to transformation. Genes Dev. 8, 1258±1269. Kramer, P.R., Krishnamurthy, R., Mitchell, P.J., Wray, S., 2000. Transcription factor AP-2 is required for continued luteinizing hormone releasing hormone (LHRH) expression in the forebrain of developing mice. Endocrinology 141, 1823±1838. Kuratani, S., Matsuo, I., Aizawa, S., 1997. Developmental patterning and evolution of the mammalian viscerocranium: genetic insights into comparative morphology. Dev. Dyn. 209, 139±155. Leask, A., Byrne, C., Fuchs, E., 1991. Transcription factor AP2 and its role in epidermal-speci®c gene expression. Proc. Natl. Acad. Sci. USA 88, 7948±7952. Luscher, B., Mitchell, P.J., Williams, T., Tjian, R., 1989. Regulation of transcription factor AP-2 by the morphogen retinoic acid and by second messengers. Genes Dev. 3, 1507±1517. Medcalf, R.L., Ruegg, M., Schleuning, W.D., 1990. A DNA motif related to the cAMP-responsive element and an exon- located activator protein-2 binding site in the human tissue-type plasminogen activator gene promoter cooperate in basal expression and convey activation by phorbol ester and cAMP. J. Biol. Chem. 265, 14618±14626. Meier, P., Koedood, M., Philipp, J., Fontana, A., Mitchell, P.J., 1995. Alternative mRNAs encode multiple isoforms of transcription factor AP-2 during murine embryogenesis. Dev. Biol. 169, 1±14. Minkoff, R., 1984. Cell cycle analysis of facial mesenchyme in the chick

94

P.R. Kramer et al. / Mechanisms of Development 94 (2000) 79±94

embryo. I. Labelled mitoses and continuous labelling studies. J. Embryol. Exp. Morphol. 81 (49-59), 49±59. Mitchell, P.J., Wang, C., Tjian, R., 1987. Positive and negative regulation of transcription in vitro: enhancer-binding protein AP-2 is inhibited by SV40 T antigen. Cell 50, 847±861. Mitchell, P.J., Timmons, P.M., Hebert, J.M., Rigby, P.W., Tjian, R., 1991. Transcription factor AP-2 is expressed in neural crest cell lineages during mouse embryogenesis. Genes Dev. 5, 105±119. Moser, M., Imhof, A., Pscherer, A., Bauer, R., Amselgruber, W., Sinowatz, F., Hofstadter, F., Schule, R., Buettner, R., 1995. Cloning and characterization of a second AP-2 transcription factor: AP-2 beta. Development 121, 2779±2788. Moser, M., Ruschoff, J., Buettner, R., 1997. Comparative analysis of AP-2 alpha and AP-2 beta gene expression during murine embryogenesis. Dev. Dyn. 208, 115±124. Murakami, S., Seki, T., Wakabayashi, K., Arai, Y., 1991. The ontogeny of luteinizing hormone-releasing hormone (LHRH) producing neurons in the chick embryo: possible evidence for migrating LHRH neurons from the olfactory epithelium expressing a highly polysialylated neural cell adhesion molecule. Neurosci. Res. 12, 421±431. Norgren, R.B.J., Gao, C., 1994. LHRH neuronal subtypes have multiple origins in chickens. Dev. Biol. 165, 735±738. Norgren, R.B.J., Lehman, M.N., 1991. Neurons that migrate from the olfactory epithelium in the chick express luteinizing hormone-releasing hormone. Endocrinology 128, 1676±1678. Nottoli, T., Hagopian-Donaldson, S., Zhang, J., Perkins, A., Williams, T., 1998. AP-2-null cells disrupt morphogenesis of the eye, face, and limbs in chimeric mice. Proc. Natl. Acad. Sci. USA 95, 13714±13719. Ohtaka-Maruyama, C., Hanaoka, F., Chepelinsky, A.B., 1998. A novel alternative spliced variant of the transcription factor AP2alpha is expressed in the murine ocular lens. Dev. Biol. 202, 125±135. Sawhney, N., Hall, P.A., 1992. Ki67 ± structure, function, and new antibodies (editorial). J. Pathol. 168, 161±162. Schorle, H., Meier, P., Buchert, M., Jaenisch, R., Mitchell, P.J., 1996. Transcription factor AP-2 essential for cranial closure and craniofacial development. Nature 381, 235±238. Schwanzel-Fukuda, M., Pfaff, D.W., 1989. Origin of luteinizing hormonereleasing hormone neurons. Nature 338, 161±164. Schwanzel-Fukuda, M., Reinhard, G.R., Abraham, S., Crossin, K.L., Edelman, G.M., Pfaff, D.W., 1994. Antibody to neural cell adhesion molecule can disrupt the migration of luteinizing hormone-releasing hormone neurons into the mouse brain. J. Comp. Neurol. 342, 174±185. Shen, H., Wilke, T., Ashique, A.M., Narvey, M., Zerucha, T., Savino, E., Williams, T., Richman, J.M., 1997. Chicken transcription factor AP-2: cloning, expression and its role in outgrowth of facial prominences and limb buds. Dev. Biol. 188, 248±266. Simeone, A., Acampora, D., Mallamaci, A., Stornaiuolo, A., D'Apice, M.R., Nigro, V., Boncinelli, E., 1993. A vertebrate gene related to orthodenticle contains a homeodomain of the bicoid class and demarcates anterior neuroectoderm in the gastrulating mouse embryo. EMBO J. 12, 2735±2747. Smith, M.D., Healy, E., Thompson, V., Morley, A., Rees, J.L., 1995. Use of in situ detection of histone mRNA in the assessment of epidermal proliferation: comparison with the Ki67 antigen and BrdU incorporation. Br. J. Dermatol. 132, 359±366. Somasundaram, K., Jayaraman, G., Williams, T., Moran, E., Frisch, S., Thimmapaya, B., 1996. Repression of a matrix metalloprotease gene by E1A correlates with its ability to bind to cell type-speci®c transcription factor AP-2. Proc. Natl. Acad. Sci. USA 93, 3088±3093. Suda, Y., Nakabayashi, J., Matsuo, I., Aizawa, S., 1999. Functional equivalency between Otx2 and Otx1 in development of the rostral head. Development 126, 743±757. Tarozzo, G., Peretto, P., Fasolo, A., 1995. Cell migration from the olfactory placode and the ontogeny of the neuroendocrine compartments. Zool. Sci. 12, 367±383. Terkelsen, O.B., Bock, E., Mollgard, K., 1989. NCAM and Thy-1 in special sense organs of the developing mouse. Anat. Embryol. (Berl). 179, 311±318.

Tobet, S.A., Chickering, T.W., King, J.C., Stopa, E.G., Kim, K., KuoLeblank, V., Schwarting, G.A., 1996. Expression of gamma-aminobutyric acid and gonadotropin-releasing hormone during neuronal migration through the olfactory system. Endocrinology 137, 5415±5420. Tsai-Morris, C.H., Geng, Y., Xie, X.Z., Buczko, E., Dufau, M.L., 1994. Transcriptional protein binding domains governing basal expression of the rat luteinizing hormone receptor gene. J. Biol. Chem. 269, 15868±15875. Voyron, S., Giacobini, P., Tarozzo, G., Cappello, P., Perroteau, I., Fasolo, A., 1999. Apoptosis in the development of the mouse olfactory epithelium. Brain Res. Dev. Brain Res. 115, 49±55. Wang, S.M., Phillips, P.D., Sierra, F., Cristofalo, V.J., 1996. Altered expression of the twist gene in young versus senescent human diploid ®broblasts. Exp. Cell Res. 228, 138±145. West-Mays, J.A., Zhang, J., Nottoli, T., Hagopian-Donaldson, S., Libby, D., Strissel, K.J., Williams, T., 1999. AP-2alpha transcription factor is required for early morphogenesis of the lens vesicle. Dev. Biol. 206, 46±62. Williams, T., Tjian, R., 1991a. Analysis of the DNA-binding and activation properties of the human transcription factor AP-2. Genes Dev. 5, 670±682. Williams, T., Tjian, R., 1991b. Characterization of a dimerization motif in AP-2 and its function in heterologous DNA-binding proteins. Science 251, 1067±1071. Williams, T., Admon, A., Luscher, B., Tjian, R., 1988. Cloning and expression of AP-2, a cell-type-speci®c transcription factor that activates inducible enhancer elements. Genes Dev. 2, 1557±1569. Wray, S., Gahwiler, B.H., Gainer, H., 1988. Slice cultures of LHRH neurons in the presence and absence of brainstem and pituitary. Peptides 9, 1151±1175. Wray, S., Grant, P., Gainer, H., 1989a. Evidence that cells expressing luteinizing hormone-releasing hormone mRNA in the mouse are derived from progenitor cells in the olfactory placode. Proc. Natl. Acad. Sci. USA 86, 8132±8136. Wray, S., Nieburgs, A., Elkabes, S., 1989b. Spatiotemporal cell expression of luteinizing hormone-releasing hormone in the prenatal mouse: evidence for an embryonic origin in the olfactory placode. Brain Res. Dev. Brain Res. 46, 309±318. Wray, S., Key, S., Qualls, R., Fueshko, S.M., 1994. A subset of peripherin positive olfactory axons delineates the luteinizing hormone releasing hormone neuronal migratory pathway in developing mouse. Dev. Biol. 166, 349±354. Wray, S., Fueshko, S.M., Kusano, K., Gainer, H., 1996. GABAergic neurons in the embryonic olfactory pit/vomeronasal organ: maintenance of functional GABAergic synapses in olfactory explants. Dev. Biol. 180, 631±645. Wu, T.J., Gibson, M.J., Silverman, A.J., 1995. Gonadotropin-releasing hormone (GnRH) neurons of the developing tectum of the mouse. J. Neuroendocrinol. 7, 899±902. Wu, T.J., Gibson, M.J., Rogers, M.C., Silverman, A.J., 1997. New observations on the development of the gonadotropin-releasing hormone system in the mouse. J. Neurobiol. 33, 983±998. Xu, P.X., Woo, I., Her, H., Beier, D.R., Maas, R.L., 1997. Mouse Eya homologues of the Drosophila eyes absent gene require Pax6 for expression in lens and nasal placode. Development 124, 219±231. Yoshida, K., Rutishauser, U., Crandall, J.E., Schwarting, G.A., 1999. Polysialic acid facilitates migration of luteinizing hormone-releasing hormone neurons on vomeronasal axons. J. Neurosci. 19, 794±801. Zeng, Y.X., Somasundaram, K., el-Deiry, W.S., 1997. AP2 inhibits cancer cell growth and activates p21WAF1/CIP1 expression. Nat. Genet. 15, 78±82. Zhang, J., Hagopian-Donaldson, S., Serbedzija, G., Elsemore, J., PlehnDujowich, D., McMahon, A.P., Flavell, R.A., Williams, T., 1996. Neural tube, skeletal and body wall defects in mice lacking transcription factor AP-2. Nature 381, 238±241. Zutter, M.M., Santoro, S.A., Painter, A.S., Tsung, Y.L., Gafford, A., 1994. The human alpha 2 integrin gene promoter. Identi®cation of positive and negative regulatory elements important for cell-type and developmentally restricted gene expression. J. Biol. Chem. 269, 463±469.