- Email: [email protected]
eEF1G interaction with foot-and-mouth disease virus nonstructural protein 2B: Identification by yeast two-hybrid system
Microbial Pathogenesis 112 (2017) 111e116
Contents lists available at ScienceDirect
Microbial Pathogenesis journal homepage: www.elsevier.com/locate/micpath
eEF1G interaction with foot-and-mouth disease virus nonstructural protein 2B: Identification by yeast two-hybrid system Zhongwang Zhang a, b, Li Pan a, b, Yaozhong Ding a, b, Jianliang Lv a, b, Peng Zhou a, b, Yuzhen Fang a, b, Xinsheng Liu a, b, Yongguang Zhang a, b, *, Yonglu Wang a, b, * a
State Key Laboratory of Veterinary Etiological Biology, National Foot and Mouth Diseases Reference Laboratory, Key Laboratory of Animal Virology of Ministry of Agriculture, Lanzhou Veterinary Research Institute, Chinese Academy of Agricultural Sciences, Lanzhou, 730046, PR China Jiangsu Co-innovation Center for Prevention and Control of Important Animal Infectious Diseases and Zoonoses, Yangzhou, 225009, China
b
a r t i c l e i n f o
a b s t r a c t
Article history: Received 31 August 2016 Received in revised form 8 September 2017 Accepted 11 September 2017 Available online 21 September 2017
Foot-and-mouth disease virus (FMDV) is a picornavirus that causes an economically significant disease in cattle and swine. Replication of FMDV is dependent on both viral proteins and cellular factors. Nonstructural protein 2B of FMDV plays multiple roles during viral infection and replication. We investigated the roles of 2B in virusehost interactions by constructing a cDNA library obtained from FMDV-infected swine tissues, and used a split-ubiquitin-based yeast two-hybrid system to identify host proteins that interacted with 2B. We found that 2B interacted with amino acids 208e437 in the C-terminal region of the eEF1G subunit of eukaryotic elongation factor 1, which is essential for protein synthesis. The 2BeeEF1G interaction was confirmed by co-immunoprecipitation of 2B and eEF1G in HEK293T cells. Collectively, our results suggest that eEF1G interacts with the 2B protein of FMDV. The identified 2B interaction partner may help to elucidate the mechanisms of FMDV infection and replication. © 2017 Elsevier Ltd. All rights reserved.
Keywords: Foot-and-mouth disease virus Virusehost interactions 2B Eukaryotic translation elongation factor 1 gamma
1. Introduction Foot-and-mouth disease is one of the most contagious and economically important viral diseases affecting cloven-hoofed animals, including ruminants, swine, and certain wild ungulates [1]. The etiological agent, foot-and-mouth disease virus (FMDV), belongs to the genus Aphthovirus of the family Picornaviridae [2]. The virus has a high mutation rate, and exists as seven genetically discrete serotypes, known as O, A, C, Asia1, South African territories-1, -2 and -3. Each serotype has numerous variants and lineages, known as topotypes [3]. The disease is endemic in the AsiaePacific enzootic area, where serotypes O, A and Asia 1 predominate [4,5]. A single-stranded, positive-sense RNA virus, FMDV contains an 8500 nt genome, which consists of a single open reading frame that is flanked by 50 - and 30 -untranslated regions. The viral genome is processed by cellular and viral proteases into the VP1, VP2, VP3, and
* Corresponding authors. Lanzhou Veterinary Research Institute, Chinese Academy of Agricultural Sciences, Lanzhou, 730046, PR China. E-mail addresses: [email protected] (Y. Zhang), [email protected] (Y. Wang). https://doi.org/10.1016/j.micpath.2017.09.039 0882-4010/© 2017 Elsevier Ltd. All rights reserved.
VP4 structural proteins and the L, 2A, 2B, 2C, 3A, 3B, 3C, and 3D nonstructural proteins [6,7]. The amino acid sequences of the nonstructural proteins of FMDV are highly conserved, compared with those of the structural proteins, among which the 2B coding region is the most conserved across all of the serotypes and subtypes of FMDV [8]. The nonstructural proteins are involved in FMDV replication, and inhibit the host immune response. The L and 3C proteins have protease activity, and are involved in processing the viral polyprotein and cleavage of host proteins [9]. The 3D protein is an RNA-dependent RNA polymerase [10]. The 2B, 2C, and 3A proteins are responsible for cell membrane rearrangements and function in viral RNA replication and capsid assembly [11e13]. The precursor proteins 3AB and 3CD participate in formation of ribonucleoprotein complexes required for poliovirus RNA synthesis, and have a nonspecific RNA-binding activity that is thought to influence both replication and translation [14,15]. Recent results with FMDV indicate that transient expression of 2BC inhibits host protein secretion in Vero cells [16]. During the FMDV life cycle, interactions between viral proteins and an array of host proteins modulate various pathways involved in signal transduction and innate immunity, which usurps the regulation of cellular processes to facilitate virus invasion,
112
Z. Zhang et al. / Microbial Pathogenesis 112 (2017) 111e116
replication of the viral genome, and virion assembly. In previous studies of FMDV infection, Gladue et al. found that FMDV modulates the host autophagosome pathway through an interaction between the viral 2C protein and the cellular protein, Beclin1, which is an important regulator of autophagy [17]. Previous research showed that binding of cellular vimentin by 2C protein contributes to FMDV replication [18], and that the cellular protein, DCTN3, is a specific binding partner for 3A protein, an interaction that is critical for FMDV replication in cattle [19]. The 2C protein of FMDV functions in the induction of apoptosis through an interaction with the N-myc and STAT interactor protein, Nmi [20]. The 3C and L proteins induce the cleavage of host eukaryotic translation initiation factor 4g, which inhibits expression of various host proteins, including interferon, and stimulate viral replication indirectly [21e23]. Furthermore, 3C has been shown to cleave nuclear factor kB essential modulator and karyopherin a1, which inhibits the innate immune response [24,25], and the L protein cleaves various other host proteins, the collective effects of which suppress the expression of interferons a and b and promote FMDV replication [26]. Despite a recent increase in studies of the nonstructural proteins of FMDV, knowledge of their cellular targets and the functions of such interactions remain limited, especially with regard to 2B. To gain insight into the role of the 2B protein in the FMDV life cycle, we constructed a cDNA library derived from various tissues of FMDV-infected swine, and used a split-ubiquitin-based yeast twohybrid system to identify host proteins that interact with 2B. We found that eukaryotic translation elongation factor 1g (eEF1G) interacts with 2B. The results of our study provided important information regarding the interactions between the virus and its host. 2. Materials and methods 2.1. Ethics statement Research animals were reared, challenged, and slaughtered in a secure ABSL-3 laboratory at the Lanzhou Veterinary Research Institute of the Chinese Academy of Agricultural Sciences (Lanzhou, Gansu, China), according to the National Institutes of Health guide for the care and use of Laboratory animals (NIH Publications No. 8023, revised 1978). All experimental procedures were subjected to prior approval by Gansu Provincial Science and Technology Department and Institutional Animals Use and Care Committee of Chinese Academy of Agricultural Sciences. 2.2. Virus, cell cultures, plasmids, and reagents The O/CHN/Mya98 strain of FMDV was obtained from the OIE/ National Foot-and-Mouth Disease Reference Laboratory (Lanzhou, Gansu, China). The virus was serially propagated for 11 passages in BHK-21 cells, and the viral titer in the culture supernatant was determined to be 104.5 50% tissue culture infective dose (TCID50) per 0.1 mL. BHK-21 cells were grown in Dulbecco's modified Eagle's medium (Thermo Scientific, Waltham, MA, USA) supplemented with 10% (v/v) fetal bovine serum (Life Technologies, Carlsbad, CA, USA), 100 mg/mL streptomycin, and 100 IU/mL penicillin. HEK293T cells were maintained in F-12 nutrient mixture (Life Technologies) supplemented with 10% fetal bovine serum. All of the cell lines were incubated at 37 C in a 5% CO2 atmosphere. The eukaryotic expression vector, pCMV-Myc, was purchased from Clontech (Mountain View, CA, USA). The anti-Myc and anti-FLAG antibodies and the p3 FLAG-CMV-10 plasmid were purchased from SigmaeAldrich (St. Louis, MO, USA). The DUALmembrane starter kit and yeast reporter Saccharomyces cerevisiae strain, NMY51, were purchased from Dualsystems Biotech (Schlieren, Switzerland). The X-
tremeGENE HP DNA Transfection Reagent was purchased from Roche Applied Science (Penzberg, Germany). 2.3. Tissue collection and cDNA library construction Two healthy Landrace X Large White pigs weighing 25e30 kg were obtained from a local farm in Gansu, China with no history of FMD. They were maintained under clean-air conditions with pathogen-free food and water, sharing an area of 12 m2. Pigs were confirmed to be seronegative for FMDV using a liquid-phase blocking-sandwich enzyme-linked immunosorbent assay. Both pigs were intradermally injected with 104.5 TCID50 FMDV O/CHN/ Mya98 strain into the heel bulb of the left rear foot. The animals were monitored daily for any sign of distress, and all efforts were made to minimize animal suffering. Euthanasia was performed humanely at 7 days post-inoculation. Tissue samples, including snout, nares, lips, tongue, spleen, and soft tissues of the feet were collected from the pigs. The samples were immediately frozen in liquid nitrogen, and stored at 80 C until RNA extraction. Total RNA was extracted from the pooled samples using the Trizol reagent (Life Technologies). The FastTrack MAG mRNA Isolation Kit (Life Technologies) was used to isolate mRNA from total RNA. The concentration and integrity of the purified total RNA and mRNA were assessed using a NanoDrop 2000 spectrophotometer (Thermo Scientific) and agarose gel electrophoresis, respectively. Double-stranded cDNA was synthesized and cloned into each of the three reading frames of the pDONR222 plasmid (Life Technologies) using the CloneMiner II cDNA Library Construction Kit (Life Technologies), according to the manufacturer's protocol. Competent Escherichia coli DH10B (Life Technologies) were transformed by electroporation with the ligation mixture in a GenePulser II electroporator (Bio-Rad Laboratories, Hercules, CA, USA), and the transformants were cultured in SOC medium. The transformed cells were harvested to serve as the entry cDNA library. The transformation efficiency was estimated, and the cells were stored at 80 C. Twenty-four colonies were randomly selected to identify the size and recombination efficiency of the inserted fragments in the library by colony polymerase chain reaction (PCR) screening. The entry cDNA library was extracted using the PureLink HiPure Plasmid Filter Midiprep Kit (Life Technologies), and recombination into the pPR3-N vector (Dualsystems Biotech) was initiated using the LR Clonase II Enzyme Mix (Life Technologies). Competent E. coli DH10B were transformed with the recombination constructs, yielding the expressed three-frame cDNA library. The titer and recombination ratio of the expressed library were calculated as described above. A single 1 mL aliquot was used for each library screening. 2.4. Plasmid construction The complete coding sequence for 2B was amplified by reverse transcription PCR (RT-PCR) using the genomic RNA of the O/CHN/ Mya98 strain of FMDV as the template. The PCR products were initially cloned into the pMD18-T plasmid (Takara-Bio, Shiga, Japan). The cDNAs were subsequently cloned into the yeast fusion vector pBT3-N (Dualsystems Biotech) through the SfiI sites to generate the pBT3-N-2B bait plasmid, or the cDNAs were cloned into the pCMV-Myc plasmid to generate the pMyc-2B expression plasmid. The potential eEF1G binding domain of 2B, encoding amino acids 208e437, was subcloned from the pPR3-N yeast twohybrid screening plasmid into p3 FLAG-CMV-10 plasmid through the HindIII and XbaI sites to generate the pFLAG-eEF1G expression plasmids, which encoded the hit-FLAG fusion peptide. All of the primers used for plasmid construction (Table 1) were synthesized by Sangon (Shanghai, China). All of the constructs were
Z. Zhang et al. / Microbial Pathogenesis 112 (2017) 111e116
113
Table 1 Primers used in this study. Primers
Sequence (50 e30 )
2B-F 2B-R pBT3-N-2B-F pBT3-N-2B-R pMyc-2B-F pMyc-2B-R FLAG-eEF1G-F FLAG-eEF1G-R
GGGACGTGGAGTCCAACC ATGTCACGTGCTTTGAGCTG ATTAACAAGGCCATTACGGCCATGCCCTTCTTCTTCTCT AACTGATTGGCCGAGGCGGCCTTACTGTTTCTCTGCTCT CGGAATTCCCCTTCTTCTTCTCTGACGTC ATCTCGAGTTACTGTTTCTCTGCTCTCTCG CGGAAGCTTAAGCTCTGTGAGAAGATGGCC CGGTCTAGATTACTTGAAGATCTTGCCCTG
Restriction enzyme
Usage pMD18-T-2B
Sfi I Sfi I EcoR I Xho I Hind III Xba I
pBT3-N-2B pMyc-2B pFLAG-eEF1G
(Restriction sites are underlined).
identified by restriction enzyme digestion and DNA sequence analysis. 2.5. Yeast two-hybrid screening The DUALmembrane system (Dualsystems Biotech) was used to identify host proteins that interact with 2B, which detects protein interaction based on the split-ubiquitin system. According to the manufacturer's protocol, the pBT3-N-2B plasmid was used as bait, and the swine cDNAs in the pPR3-N plasmids were used as prey. Correct expression of the bait was tested using the DUALmembrane functional assay (Dualsystems Biotech). Self-activation of the bait protein was detected by co-transforming with an aliquot of the empty library vector into the NMY51 yeast strain [MATa his3D200 trp1-901 leu2-3, 112 ade2 LYS2:(lexAop)4-HIS3 ura3:(lexAop)8lacZ ade2:(lexAop)8-ADE2 GAL4] and assayed on selective plates of increasing stringency. After no self-activation of the bait protein was confirmed and the basic screening conditions were optimized, the NMY51 yeast strain expressing the bait protein was transformed with the cDNA library plasmids using the lithium acetate method (Dualsystems Biotech). Transformants in which the bait and prey interacted were identified for two rounds of selection on synthetic dropout nutrient medium (SD/-Leu/-Trp/-His-Ade) plates, and were subjected to the HTX b-galactosidase assay (Dualsystems Biotech). Colonies with prominent b-galactosidase activity were considered to be transformants. The plasmids were isolated from the transformant colonies using a yeast plasmid purification kit (Omega Bio-Tek, Norcross, GA, USA), and competent E. coli were transformed with the plasmids. Transformants were grown on LuriaeBertani agar plates, and colonies were subsequently propagated in LuriaeBertani broth containing 100 mg/mL ampicillin. The cDNA inserts were analyzed by restriction enzyme digestion and DNA sequencing in Huada Gene Research Center (Beijing, China). The DNA sequence of each cDNA insert was imported into the SeqMan II program (DNAstar, Madison, WI, USA), and the cDNAs were identified by comparison to the GenBank nonredundant protein database using the Basic Local Alignment Search Tool. For eliminating false-positive interactions, the bait and the respective pPR3-N-prey clones of each of the hits (pPR3-N-hits) were cotransformed into the NMY51 yeast strain again. Cotransformations with pBT3-N/pPR3-N-hits and pTSU2-APP/pPR3-N served as negative controls. Only the prey clones that displayed an HISþ/ ADEþ/lacZ þ phenotype when coexpressed with the original bait were considered true positives. The true positives were analyzed further, according to the protocol described in the handbook for the DUALMembrane Kit. 2.6. Coimmunoprecipitation and western blotting A coimmunoprecipitation assay was used to confirm the interaction between 2B and eEF1G. The full-length coding sequence for 2B was cloned into the pCMV-Myc plasmid to generate the pMyc-
2B, which expressed 2B and the Myc peptide as a fusion protein. The eEF1G cDNA insert (amino acids 208e437) was cloned into p3xFLAG-CMV-10 to generate pFLAG-eEF1G, which expressed eEF1G and the FLAG peptide as a fusion protein. After seeding the HEK293T cells in 10-cm dishes, monolayers were grown to 70%e 80% confluence, and the cells were cotransfected using the XtremeGENE HP DNA transfection reagent with 5 mg pMyc-2B and 5 mg pFLAG-eEF1G for 48 h. After transfection, coimmunoprecipitation was performed using the Pierce Co-Immunoprecipitation Kit (Thermo Scientific), with normal rabbit or mouse IgG included as negative controls. The immunoprecipitates were subjected to sodium dodecyl sulfate-polyacrylamide gel electrophoresis and western blotting, as previously described [27]. Prey proteins were immunoprecipitated using a mouse anti-Myc antibody, and detected by western blotting using a rabbit anti-FLAG antibody and an IRDye 680-labeled goat anti-rabbit IgG antibody (LI-COR BioSciences, Lincoln, NE, USA). Bait protein was immunoprecipitated using a rabbit anti-FLAG antibody, and detected by western blotting using a mouse anti-Myc antibody and an IRDye 800CW-labeled goat anti-mouse IgG antibody (LI-COR BioSciences). Immunoreactive bands were visualized using the Odyssey Infrared Imaging System (LI-COR BioSciences). 3. Results 3.1. cDNA library construction A cDNA library was constructed from FMDV-infected swine tissues. The titer of the primary cDNA library was 6.7 106 cfu/mL, and the titer of the expressed yeast cDNA library was 107 cfu/mL. The mean size of the inserts was ~1.2 kb, and most inserts were 0.9 kb in size. The percent of recombinants was 100% (Fig. 1). 3.2. Yeast two-hybrid assay To identify potential cellular targets of 2B, we used a splitubiquitin-based yeast two-hybrid system to screen the swine cDNA library using full-length 2B as the bait protein. After having carried out the DUALmembrane functional assay, we verified that the pBT3-N-2B bait was functionally well expressed in the assay without nonspecific background, and we had the synthetic quadrupledropout medium(SD/Ade/His/Leu/Trp) as the optimal selection stringency for carrying out a library screen (Fig. 2A). The library screening yielded 128 colonies on the SD/-Leu/-Trp/His-Ade medium after 3 days of growth at 30 C. The number was reduced to 32 by eliminating false-positive interactors after an additional round of selection on nutritional selective media and an HTX b-galactosidase assay. The sequences of the 32 prey inserts were used for BLAST searches of the NCBI database, which showed that the prey sequences corresponded to those of immunoglobulin l-like polypeptide 5, ribosomal protein S20, and eEF1G. False positives were eliminated by repeating the cotransformation using the
114
Z. Zhang et al. / Microbial Pathogenesis 112 (2017) 111e116
Fig. 1. Insert-check PCR of randomly selected colonies from the expressed yeast cDNA library. Lanes 1e24, recombinant individual colonies; Lane M, 1 kb Plus DNA Ladder (Invitrogen).
Fig. 2. Yeast two-hybrid interaction analysis. (A): DUALmembrane functional assay. pBT3-N-2B bait plasmid was cotransformed with control plasmid pOst1-NubI or empty library vector pPR3-N and grown on selective plates of increasing stringency. Cotransformation of the bait construct with the empty library vector pPR3-N to exclude self-activation. Cotransformation of pTSU2-APP/pNubG-Fe65 and pTSU2-APP/pPR3-N was used as a positive and negative control, respectively. pBT3-N-2B bait interacted with Ost1-NubI control prey, but not with pPR3-N- derived NubG-nonsense-peptide prey, indicating that pBT3-N-2B bait was functionally well expressed in the assay without nonspecific background. (B) Confirmation of interaction between 2B and eEF1G in a yeast two-hybrid system. Yeast NMY51 strain was cotransformed with pBT3-N-2B bait plasmid and pPR3-eEF1G prey plasmid. Cotransformations with pBT3-N/pPR3-eEF1G and pTSU2-APP/pPR3-N were used as negative controls. Transformants were grown on SD/AHLW plates. Growth of colonies in the SD/AHLW plates indicated an interaction between 2B and eEF1G. SD/LW: SD/-Leu/-Trp, SD agar medium without leucine and tryptophan. SD/HLW: SD/-Leu/-Trp/-His, SD agar medium without leucine, tryptophan and histidine. SD/AHLW: SD/-Leu/-Trp/-His-Ade, SD agar medium without leucine, tryptophan, histidine and adenine.
isolated prey plasmid and the original bait plasmid. Only the inserts with eEF1G sequences yielded an HISþ/ADEþ/lacZþ phenotype when coexpressed with the 2B bait protein, but not when coexpressed with the empty bait plasmid (Fig. 2B). Therefore, eEF1G was considered to be a potential 2B cellular target, and was chosen for further characterization. The eEF1G cDNA fragment isolated in this yeast two-hybrid screen spanned amino acids 208e437 in the C-terminal region of the protein.
3.3. eEF1G interacts with 2B in mammalian cells The interaction of 2B with eEF1G in mammalian cells was examined by coimmunoprecipitation. Myc-tagged 2B and FLAGtagged eEF1G expression plasmids were transfected into HEK293T cells in combination. The cell lysates were immunoprecipitated using mouse anti-Myc antibody, and rabbit anti-FLAG antibody was used for western blotting to detect the presence of FLAG-eEF1G in the immunoprecipitates. As shown in Fig. 3, FLAGtagged eEF1G coprecipitated with the Myc-tagged 2B, whereas no FLAG-tagged protein was present in immunoprecipitates generated using mouse normal IgG. A rabbit anti-FLAG antibody was used for reciprocal coimmunoprecipitation, and immunoblotting was performed using a mouse anti-Myc antibody. Western blotting showed that Myc-2B precipitated with FLAG-eEF1G. These results suggest that eEF1G interacts with 2B in mammalian cells. 4. Discussion
Fig. 3. Co-immunoprecipitation demonstrated an interaction between 2B and eEF1G. HEK293T cells were cotransfected with pMyc-2B and pFLAG-eEF1G for 48 h. Whole cell lysates were subjected to immunoprecipitation using anti-Myc or anti-FLAG antibodies, and the immunoprecipitates were subjected to western blotting using antiFLAG or anti-Myc for detection of FLAG-eEF1G and Myc-2B proteins, respectively. Normal mouse or rabbit IgG was used as negative control. In the left portion of the blot, whole cell extracts were also analyzed.
Picornaviruses use multiple RNAeprotein interactions to complete their life cycle, including internal ribosome entry sitemediated translation, circularization of the genome, and RNA replication [28]. As a member of Picornaviridae, FMDV replication is dependent on both virus-encoded proteins and numerous cellular factors. During infection, FMDV uses various strategies to inhibit the host immune response and cellular gene expression, alter cellular proteineprotein interactions, and rearrange intracellular membranes to induce conditions that are favorable to virus replication and virion assembly [29,30].
Z. Zhang et al. / Microbial Pathogenesis 112 (2017) 111e116
The 2B gene of FMDV is 462 nucleotides in size, and encodes 154 amino acids. Previous studies have shown that the 2B protein contains two hydrophobic regions, and localizes primarily to the endoplasmic reticulum. The 2B protein exhibits viroporin-like properties, and may play an important role in FMDV infection [28,31,32]. The 2B protein increases membrane permeability and blocks protein secretory pathways [16,33,34]. The 2B protein also increases the level of Ca2þ in virus-infected cells, and induces autophagy [35e37]. Given the wide range of roles that 2B plays in the FMDV life cycle, we aimed to identify cellular targets of 2B using a high-throughput yeast two-hybrid screening system and a cDNA library constructed from FMDV-infected swine tissues. Recent developments in siRNA screening, affinity purification, mass spectrometry, and high-throughput genomic, transcriptomic, and proteomic approaches have facilitated progress in investigations of interactions between viral and host proteins. Yeast two-hybrid screening has been widely used to identify direct proteineprotein interactions on a genomic scale. To date, many interaction partners of FMDV proteins have been identified using classical yeast two-hybrid screening methods. In our current study, a dual membrane system was used to identify novel interaction partners of FMDV 2B. As opposed to the most popular yeast-based screening system, the dual membrane system can identify proteineprotein interactions between full-length integral membrane proteins, membrane-associated proteins, and soluble proteins in situ at cellular membranes. A well-characterized, high-quality cDNA library expressing host proteins is crucial for studying hostevirus interactions using a yeast two-hybrid system. To this end, several cDNA libraries constructed from pathogen-susceptible cell lines and tissues have been reported previously [17e20]. In our current study, we constructed a high-quality yeast two-hybrid cDNA library using RNA from multiple types of FMDV-infected swine tissues to investigate FMDV-induced processes in swine. We found that a molecular interaction occurred between the 2B protein of FMDV and a domain of cellular eEF1G within amino acids 208 and 437 in mammalian cells. eEF1G is a subunit of eEF1 complex, and functions in the transport of aminoacyl tRNAs to the ribosome for protein synthesis. The open reading frame in the eEF1G cDNA encodes a polypeptide that is 437 amino acids in length, with a molecular mass of 50 kDa. The N-terminal region of the eEF1G protein contains a glutathione transferase domain, which may be involved in regulating the assembly of multisubunit complexes containing eEF1G and aminoacyl-tRNA synthetases [38,39]. The eEF1G protein is involved in regulating vimentin gene by interacting with the RNA polymerase II and binding the vimentin promoter region and shuttling or nursing vimentin mRNA [40]. The eEF1G and eEF1A subunits of the eEF1 complex play crucial roles in reverse transcription of the human immunodeficiency virus-1 [41], and play synergistic roles in the replication of tomato bushy stunt virus [42]. Previous studies have also shown that overexpression of eEF1G influences tumor aggressiveness presumably by altering the redox balance of tumor cells [43,44]. Mislocalization of eEF1G has previously been shown to decrease the synthesis of membrane proteins. And in the absence of eEF1G, synthesis of certain membrane proteins essential for vesicle formation is severely affected [45]. FMDV protein 2B is suggested to be responsible for membranous alteration and increases membrane permeability in infected cells [13,16,33]. We therefore to speculate that eEF1G has a potential role in assisting protein 2B to produce virus-induced vesicles and induce cell lysis. The virus may hijack cellular eEF1G to facilitate its own transcription, localization, and translation. However, identifying the precise mechanism requires further study.
115
Author contributions ZWZ, YGZ and YLW conceived and designed the experiments; ZWZ, JLL and PZ performed the experiments; ZWZ, LP and YZD analyzed the data; XSL and YZF contributed reagents/materials/ analysis tools; ZWZ wrote the paper. Conflicts of interest The authors declare no conflict of interest. Acknowledgments This work was supported by grants from the National Key Research and Development Program of China (grant number 2016YFD0501503, 2017YFD0501100 and 2017YFD0501804), the Key Technology R&D Program of Gansu Province of China (grant number 1604NKCA045-2), and the National Pig Industrial System (CARS-36-06B). References [1] S. Alexandersen, N. Mowat, Foot-and-mouth disease: host range and pathogenesis, Curr. Top. Microbiol. Immunol. 288 (2005) 9e42. [2] E. Domingo, E. Baranowski, C. Escarmis, F. Sobrino, Foot-and-mouth disease virus, Comp. Immunol. Microbiol. Infect. Dis. 25 (2002) 297e308. [3] E. Domingo, C. Escarmis, E. Baranowski, C.M. Ruiz-Jarabo, E. Carrillo, J.I. Nunez, F. Sobrino, Evolution of foot-and-mouth disease virus, Virus Res. 91 (2003) 47e63. [4] J. Klein, Understanding the molecular epidemiology of foot-and-mouthdisease virus, Infect. Genet. Evol. 9 (2009) 153e161. [5] N.F. Abdul-Hamid, N.M. Hussein, J. Wadsworth, A.D. Radford, N.J. Knowles, D.P. King, Phylogeography of foot-and-mouth disease virus types O and A in Malaysia and surrounding countries, Infect. Genet. Evol. 11 (2011) 320e328. [6] M.J. Grubman, B. Baxt, Translation of foot-and-mouth disease virion RNA and processing of the primary cleavage products in a rabbit reticulocyte lysate, Virology 116 (1982) 19e30. [7] M.J. Grubman, B. Baxt, Foot-and-mouth disease, Clin. Microbiol. Rev. 17 (2004) 465e493. [8] T.D.L. Santos, Q.H. Wu, S.D. Botton, M.J. Grubman, Short hairpin RNA targeted to the highly conserved 2B nonstructural protein coding region inhibits replication of multiple serotypes of foot-and-mouth disease virus, Virology 335 (2005) 222e231. [9] H. van Rensburg, D. Haydon, F. Joubert, A. Bastos, L. Heath, L. Nel, Genetic heterogeneity in the foot-and-mouth disease virus Leader and 3C proteinases, Gene 289 (2001) 19e29. [10] J.F.E. Newman, B. Cartwright, T.R. Doel, F. Brown, Purification and identification of the RNA-dependent RNA polymerase of foot-and-mouth disease virus, J. Gen. Virol. 45 (1979) 497e507. [11] R. Andino, N. Boddeker, D. Silvera, A.V. Gamarnik, Intracellular determinants of picornavirus replication, Trends Microbiol. 7 (1999) 76e82. [12] J.S. Towner, T.V. Ho, B.L. Semler, Determinants of membrane association for poliovirus protein 3AB, J. Biol. Chem. 271 (1996) 26810e26818. [13] M.W. Cho, N. Teterina, D. Egger, K. Bienz, E. Ehrenfeld, Membrane rearrangement and vesicle induction by recombinant poliovirus 2C and 2BC in human cells, Virology 202 (1994) 129e145. [14] D.A. Hope, S.E. Diamond, K. Kirkegaard, Genetic dissection of interaction between poliovirus 3D polymerase and viral protein 3AB, J. Virol. 71 (1997) 9490e9498. [15] W.K. Xiang, K.S. Harris, L. Alexander, E. Wimmer, Interaction between the 50 terminal cloverleaf and 3AB/3CDpro of poliovirus is essential for RNA replication, J. Virol. 69 (1995) 3658e3667. [16] K. Moffat, G. Howell, C. Knox, G.J. Belsham, P. Monaghan, M.D. Ryan, T. Wileman, Effects of foot-and-mouth disease virus nonstructural proteins on the structure and function of the early secretory pathway: 2BC but not 3A blocks endoplasmic reticulum-to-Golgi transport, J. Virol. 79 (2005) 4382e4395. [17] D.P. Gladue, V. O'Donnell, R. Baker-Branstetter, L.G. Holinka, J.M. Pacheco, I. Fernandez-Sainz, Z. Lu, E. Brocchi, B. Baxt, M.E. Piccone, Foot-and-mouth disease virus nonstructural protein 2C interacts with Beclin1, modulating virus replication, J. Virol. 86 (2012) 12080e12090. [18] D.P. Gladue, V. O'Donnell, R. Baker-Branstetter, L.G. Holinka, J.M. Pacheco, I.F. Sainz, Z. Lu, X. Ambroggio, L. Rodriguez, M.V. Borca, Foot-and-mouth disease virus modulates cellular vimentin for virus survival, J. Virol. 87 (2013) 6794e6803. [19] D.P. Gladue, V. O'Donnell, R. Baker-Branstetter, J.M. Pacheco, L.G. Holinka, J. Arzt, S. Pauszek, I. Fernandez-Sainz, P. Fletcher, E. Brocchi, Interaction of foot-and-mouth disease virus nonstructural protein 3A with host protein
116
Z. Zhang et al. / Microbial Pathogenesis 112 (2017) 111e116
DCTN3 is important for viral virulence in cattle, J. Virol. 88 (2014) 2737e2747. [20] J.C. Wang, Y.Q. Wang, J. Liu, L. Ding, Q.H. Zhang, X.Q. Li, H. Cao, J. Tang, S.J.J. Zheng, A critical role of N-myc and STAT interactor (Nmi) in foot-andmouth disease virus (FMDV) 2C-induced apoptosis, Virus Res. 170 (2012) 59e65. [21] M.A. Devaney, V.N. Vakharia, R.E. Lloyd, E. Ehrenfeld, M.J. Grubman, Leader protein of foot-and-mouth disease virus is required for cleavage of the p220 component of the cap-binding protein complex, J. Virol. 62 (1988) 4407e4409. [22] T. de Los Santos, S.D. Botton, R. Weiblen, M.J. Grubman, The leader proteinase of foot-and-mouth disease virus inhibits the induction of beta interferon mRNA and blocks the host innate immune response, J. Virol. 80 (2006) 1906e1914. [23] G.J. Belsham, G.M. Mclnerney, N. Ross-Smith, Foot-and-mouth disease virus 3C protease induces cleavage of translation initiation factors eIF4A and eIF4G within infected cells, J. Virol. 74 (2000) 272e280. [24] D. Wang, L.R. Fang, K. Li, H.J. Zhong, J.X. Fan, C. Ouyang, H. Zhang, E.Z. Duan, R. Luo, Z.M. Zhang, X.T. Liu, H.C. Chen, S.B. Xiao, Foot-and-Mouth disease virus 3C protease cleaves NEMO to impair innate immune signaling, J. Virol. 86 (2012) 9311e9322. [25] Y.J. Du, J.S. Bi, J.Y. Liu, X. Liu, X.J. Wu, P. Jiang, D.W. Yoo, Y.G. Zhang, J.Q. Wu, R.Z. Wan, 3C(pro) of foot-and-mouth disease virus antagonizes the interferon signaling pathway by blocking STAT1/STAT2 nuclear translocation, J. Virol. 88 (2014) 4908e4920. [26] D. Wang, L.R. Fang, P. Li, L. Sun, J.X. Fan, Q.Y. Zhang, R. Luo, X.T. Liu, K. Li, H.C. Chen, The leader proteinase of foot-and-mouth disease virus negatively regulates the type I interferon pathway by acting as a viral deubiquitinase, J. Virol. 85 (2011) 3758e3766. [27] Z. Yang, Z.X. Shi, H.C. Guo, H. Qu, Y. Zhang, C.C. Tu, Annexin 2 is a host protein binding to classical swine fever virus E2 glycoprotein and promoting viral growth in PK-15 cells, Virus Res. 201 (2015) 16e23. [28] J.Y. Lin, T.C. Chen, K.F. Weng, S.C. Chang, L.L. Chen, S.R. Shih, Viral and host proteins involved in picornavirus life cycle, J. Biomed. Sci. 16 (2009) 103. [29] M.J. Grubman, M.P. Moraes, F.D.S. Segundo, L. Pena, T. de los Santos, Evading the host immune response: how foot-and-mouth disease virus has become an effective pathogen, FEMS. Immunol. Med. Microbiol. 53 (2008) 8e17. [30] P. Lawrence, E. Rieder, Identification of RNA helicase A as a new host factor in the replication cycle of foot-and-mouth disease virus, J. Virol. 83 (2009) 11356e11366. [31] S. Forss, K. Strebel, E. Beck, H. Schaller, Nucleotide sequence and genome organization of foot-and-mouth disease virus, Nucleic. Acids. Res. 12 (1984) 6587e6601. [32] D. Ao, H.C. Guo, S.Q. Sun, D.H. Sun, T.S. Fung, Y.Q. Wei, S.C. Han, X.P. Yao, S.Z. Cao, D.X. Liu, Viroporin activity of the foot-and-mouth disease virus nonstructural 2B protein, PloS One 10 (2015) e0125828.
[33] K. Bienz, D. Egger, L. Pasamontes, Association of polioviral proteins of the P2 genomic region with the viral replication complex and virus-induced membrane synthesis as visualized by electron microscopic immunocytochemistry and autoradiography, Virology 160 (1987) 220e226. [34] K. Moffat, C. Knox, G. Howell, S.J. Clark, H. Yang, G.J. Belsham, M. Ryan, T. Wileman, Inhibition of the secretory pathway by foot-and-mouth disease virus 2BC protein is reproduced by coexpression of 2B with 2C, and the site of inhibition is determined by the subcellular location of 2C, J. Virol. 81 (2007) 1129e1139. [35] R. Aldabe, A. Irurzun, L. Carrasco, Poliovirus protein 2BC increases cytosolic free calcium concentrations, J. Virol. 71 (1997) 6214e6217. [36] F.J.M. van Kuppeveld, A.S. de Jong, W.J.G. Melchers, P.H.G.M. Willems, Enterovirus protein 2B po(u)res out the calcium: a viral strategy to survive? Trends. Microbiol. 13 (2005) 41e44. [37] V. O'Donnell, J.M. Pacheco, M. LaRocco, T. Burrage, W. Jackson, L.L. Rodriguez, M.V. Borca, B. Baxt, Foot-and-mouth disease virus utilizes an autophagic pathway during viral replication, Virology 410 (2011) 142e150. [38] E.V. Koonin, A.R. Mushegian, R.L. Tatusov, S.F. Altschul, S.H. Bryant, P. Bork, A. Valencia, Eukaryotic translation elongation factor lg contains a glutathione transferase domain - study of a diverse, ancient protein superfamily using motif search and structural modeling, Protein Sci. 3 (1994) 2045e2054. [39] J. Sanders, J.A. Maassen, W. Moller, Elongation factor-1 messenger-RNA levels in cultured cells are high compared to tissue and are not drastically affected further by oncogenic transformation, Nucleic Acids Res. 20 (1992) 5907e5910. [40] N. Corbi, E.M. Batassa, C. Pisani, A. Onori, M.G. Di Certo, G. Strimpakos, M. Fanciulli, E. Mattei, C. Passananti, The eEF1 gamma subunit contacts RNA polymerase II and binds vimentin promoter region, PLoS One 5 (2010) e14481. [41] K. Warren, T. Wei, D.S. Li, F.Y. Qin, D. Warrilow, M.H. Lin, H. Sivakumaran, A. Apolloni, C.M. Abbott, A. Jones, J. Anderson, D. Harrich, Eukaryotic elongation factor 1 complex subunits are critical HIV-1 reverse transcription cofactors, PNAS 24 (2012) 9587e9592. [42] Z. Sasvari, L. Izotova, T.G. Kinzy, P.D. Nagy, Synergistic roles of eukaryotic translation elongation factors 1Bg and 1A in stimulation of tombusvirus minus-strand synthesis, PLoS Pathog. 7 (2011) e1002438. [43] F. Le Sourd, S. Boulben, R. Le Bouffant, P. Cormier, J. Morales, R. Belle, O. Mulner-Lorillon, eEF1B: at the dawn of the 21st century, Biochimica Biophysica Acta-Gene Struct. Expr. 1759 (2006) 13e31. [44] K. Mimori, M. Mori, H. Inoue, H. Ueo, K. Mafune, T. Akiyoshi, K. Sugimachi, Elongation factor 1 gamma mRNA expression in oesophageal carcinoma, Gut 38 (1996) 66e70. [45] L.L. Ong, P.C. Lin, X. Zhang, S.M. Chia, H. Yu, Kinectin-dependent assembly of translation elongation factor-1 complex on endoplasmic reticulum regulates protein synthesis, J. Biol. Chem. 281 (2006) 33621e33634.
Contents lists available at ScienceDirect
Microbial Pathogenesis journal homepage: www.elsevier.com/locate/micpath
eEF1G interaction with foot-and-mouth disease virus nonstructural protein 2B: Identification by yeast two-hybrid system Zhongwang Zhang a, b, Li Pan a, b, Yaozhong Ding a, b, Jianliang Lv a, b, Peng Zhou a, b, Yuzhen Fang a, b, Xinsheng Liu a, b, Yongguang Zhang a, b, *, Yonglu Wang a, b, * a
State Key Laboratory of Veterinary Etiological Biology, National Foot and Mouth Diseases Reference Laboratory, Key Laboratory of Animal Virology of Ministry of Agriculture, Lanzhou Veterinary Research Institute, Chinese Academy of Agricultural Sciences, Lanzhou, 730046, PR China Jiangsu Co-innovation Center for Prevention and Control of Important Animal Infectious Diseases and Zoonoses, Yangzhou, 225009, China
b
a r t i c l e i n f o
a b s t r a c t
Article history: Received 31 August 2016 Received in revised form 8 September 2017 Accepted 11 September 2017 Available online 21 September 2017
Foot-and-mouth disease virus (FMDV) is a picornavirus that causes an economically significant disease in cattle and swine. Replication of FMDV is dependent on both viral proteins and cellular factors. Nonstructural protein 2B of FMDV plays multiple roles during viral infection and replication. We investigated the roles of 2B in virusehost interactions by constructing a cDNA library obtained from FMDV-infected swine tissues, and used a split-ubiquitin-based yeast two-hybrid system to identify host proteins that interacted with 2B. We found that 2B interacted with amino acids 208e437 in the C-terminal region of the eEF1G subunit of eukaryotic elongation factor 1, which is essential for protein synthesis. The 2BeeEF1G interaction was confirmed by co-immunoprecipitation of 2B and eEF1G in HEK293T cells. Collectively, our results suggest that eEF1G interacts with the 2B protein of FMDV. The identified 2B interaction partner may help to elucidate the mechanisms of FMDV infection and replication. © 2017 Elsevier Ltd. All rights reserved.
Keywords: Foot-and-mouth disease virus Virusehost interactions 2B Eukaryotic translation elongation factor 1 gamma
1. Introduction Foot-and-mouth disease is one of the most contagious and economically important viral diseases affecting cloven-hoofed animals, including ruminants, swine, and certain wild ungulates [1]. The etiological agent, foot-and-mouth disease virus (FMDV), belongs to the genus Aphthovirus of the family Picornaviridae [2]. The virus has a high mutation rate, and exists as seven genetically discrete serotypes, known as O, A, C, Asia1, South African territories-1, -2 and -3. Each serotype has numerous variants and lineages, known as topotypes [3]. The disease is endemic in the AsiaePacific enzootic area, where serotypes O, A and Asia 1 predominate [4,5]. A single-stranded, positive-sense RNA virus, FMDV contains an 8500 nt genome, which consists of a single open reading frame that is flanked by 50 - and 30 -untranslated regions. The viral genome is processed by cellular and viral proteases into the VP1, VP2, VP3, and
* Corresponding authors. Lanzhou Veterinary Research Institute, Chinese Academy of Agricultural Sciences, Lanzhou, 730046, PR China. E-mail addresses: [email protected] (Y. Zhang), [email protected] (Y. Wang). https://doi.org/10.1016/j.micpath.2017.09.039 0882-4010/© 2017 Elsevier Ltd. All rights reserved.
VP4 structural proteins and the L, 2A, 2B, 2C, 3A, 3B, 3C, and 3D nonstructural proteins [6,7]. The amino acid sequences of the nonstructural proteins of FMDV are highly conserved, compared with those of the structural proteins, among which the 2B coding region is the most conserved across all of the serotypes and subtypes of FMDV [8]. The nonstructural proteins are involved in FMDV replication, and inhibit the host immune response. The L and 3C proteins have protease activity, and are involved in processing the viral polyprotein and cleavage of host proteins [9]. The 3D protein is an RNA-dependent RNA polymerase [10]. The 2B, 2C, and 3A proteins are responsible for cell membrane rearrangements and function in viral RNA replication and capsid assembly [11e13]. The precursor proteins 3AB and 3CD participate in formation of ribonucleoprotein complexes required for poliovirus RNA synthesis, and have a nonspecific RNA-binding activity that is thought to influence both replication and translation [14,15]. Recent results with FMDV indicate that transient expression of 2BC inhibits host protein secretion in Vero cells [16]. During the FMDV life cycle, interactions between viral proteins and an array of host proteins modulate various pathways involved in signal transduction and innate immunity, which usurps the regulation of cellular processes to facilitate virus invasion,
112
Z. Zhang et al. / Microbial Pathogenesis 112 (2017) 111e116
replication of the viral genome, and virion assembly. In previous studies of FMDV infection, Gladue et al. found that FMDV modulates the host autophagosome pathway through an interaction between the viral 2C protein and the cellular protein, Beclin1, which is an important regulator of autophagy [17]. Previous research showed that binding of cellular vimentin by 2C protein contributes to FMDV replication [18], and that the cellular protein, DCTN3, is a specific binding partner for 3A protein, an interaction that is critical for FMDV replication in cattle [19]. The 2C protein of FMDV functions in the induction of apoptosis through an interaction with the N-myc and STAT interactor protein, Nmi [20]. The 3C and L proteins induce the cleavage of host eukaryotic translation initiation factor 4g, which inhibits expression of various host proteins, including interferon, and stimulate viral replication indirectly [21e23]. Furthermore, 3C has been shown to cleave nuclear factor kB essential modulator and karyopherin a1, which inhibits the innate immune response [24,25], and the L protein cleaves various other host proteins, the collective effects of which suppress the expression of interferons a and b and promote FMDV replication [26]. Despite a recent increase in studies of the nonstructural proteins of FMDV, knowledge of their cellular targets and the functions of such interactions remain limited, especially with regard to 2B. To gain insight into the role of the 2B protein in the FMDV life cycle, we constructed a cDNA library derived from various tissues of FMDV-infected swine, and used a split-ubiquitin-based yeast twohybrid system to identify host proteins that interact with 2B. We found that eukaryotic translation elongation factor 1g (eEF1G) interacts with 2B. The results of our study provided important information regarding the interactions between the virus and its host. 2. Materials and methods 2.1. Ethics statement Research animals were reared, challenged, and slaughtered in a secure ABSL-3 laboratory at the Lanzhou Veterinary Research Institute of the Chinese Academy of Agricultural Sciences (Lanzhou, Gansu, China), according to the National Institutes of Health guide for the care and use of Laboratory animals (NIH Publications No. 8023, revised 1978). All experimental procedures were subjected to prior approval by Gansu Provincial Science and Technology Department and Institutional Animals Use and Care Committee of Chinese Academy of Agricultural Sciences. 2.2. Virus, cell cultures, plasmids, and reagents The O/CHN/Mya98 strain of FMDV was obtained from the OIE/ National Foot-and-Mouth Disease Reference Laboratory (Lanzhou, Gansu, China). The virus was serially propagated for 11 passages in BHK-21 cells, and the viral titer in the culture supernatant was determined to be 104.5 50% tissue culture infective dose (TCID50) per 0.1 mL. BHK-21 cells were grown in Dulbecco's modified Eagle's medium (Thermo Scientific, Waltham, MA, USA) supplemented with 10% (v/v) fetal bovine serum (Life Technologies, Carlsbad, CA, USA), 100 mg/mL streptomycin, and 100 IU/mL penicillin. HEK293T cells were maintained in F-12 nutrient mixture (Life Technologies) supplemented with 10% fetal bovine serum. All of the cell lines were incubated at 37 C in a 5% CO2 atmosphere. The eukaryotic expression vector, pCMV-Myc, was purchased from Clontech (Mountain View, CA, USA). The anti-Myc and anti-FLAG antibodies and the p3 FLAG-CMV-10 plasmid were purchased from SigmaeAldrich (St. Louis, MO, USA). The DUALmembrane starter kit and yeast reporter Saccharomyces cerevisiae strain, NMY51, were purchased from Dualsystems Biotech (Schlieren, Switzerland). The X-
tremeGENE HP DNA Transfection Reagent was purchased from Roche Applied Science (Penzberg, Germany). 2.3. Tissue collection and cDNA library construction Two healthy Landrace X Large White pigs weighing 25e30 kg were obtained from a local farm in Gansu, China with no history of FMD. They were maintained under clean-air conditions with pathogen-free food and water, sharing an area of 12 m2. Pigs were confirmed to be seronegative for FMDV using a liquid-phase blocking-sandwich enzyme-linked immunosorbent assay. Both pigs were intradermally injected with 104.5 TCID50 FMDV O/CHN/ Mya98 strain into the heel bulb of the left rear foot. The animals were monitored daily for any sign of distress, and all efforts were made to minimize animal suffering. Euthanasia was performed humanely at 7 days post-inoculation. Tissue samples, including snout, nares, lips, tongue, spleen, and soft tissues of the feet were collected from the pigs. The samples were immediately frozen in liquid nitrogen, and stored at 80 C until RNA extraction. Total RNA was extracted from the pooled samples using the Trizol reagent (Life Technologies). The FastTrack MAG mRNA Isolation Kit (Life Technologies) was used to isolate mRNA from total RNA. The concentration and integrity of the purified total RNA and mRNA were assessed using a NanoDrop 2000 spectrophotometer (Thermo Scientific) and agarose gel electrophoresis, respectively. Double-stranded cDNA was synthesized and cloned into each of the three reading frames of the pDONR222 plasmid (Life Technologies) using the CloneMiner II cDNA Library Construction Kit (Life Technologies), according to the manufacturer's protocol. Competent Escherichia coli DH10B (Life Technologies) were transformed by electroporation with the ligation mixture in a GenePulser II electroporator (Bio-Rad Laboratories, Hercules, CA, USA), and the transformants were cultured in SOC medium. The transformed cells were harvested to serve as the entry cDNA library. The transformation efficiency was estimated, and the cells were stored at 80 C. Twenty-four colonies were randomly selected to identify the size and recombination efficiency of the inserted fragments in the library by colony polymerase chain reaction (PCR) screening. The entry cDNA library was extracted using the PureLink HiPure Plasmid Filter Midiprep Kit (Life Technologies), and recombination into the pPR3-N vector (Dualsystems Biotech) was initiated using the LR Clonase II Enzyme Mix (Life Technologies). Competent E. coli DH10B were transformed with the recombination constructs, yielding the expressed three-frame cDNA library. The titer and recombination ratio of the expressed library were calculated as described above. A single 1 mL aliquot was used for each library screening. 2.4. Plasmid construction The complete coding sequence for 2B was amplified by reverse transcription PCR (RT-PCR) using the genomic RNA of the O/CHN/ Mya98 strain of FMDV as the template. The PCR products were initially cloned into the pMD18-T plasmid (Takara-Bio, Shiga, Japan). The cDNAs were subsequently cloned into the yeast fusion vector pBT3-N (Dualsystems Biotech) through the SfiI sites to generate the pBT3-N-2B bait plasmid, or the cDNAs were cloned into the pCMV-Myc plasmid to generate the pMyc-2B expression plasmid. The potential eEF1G binding domain of 2B, encoding amino acids 208e437, was subcloned from the pPR3-N yeast twohybrid screening plasmid into p3 FLAG-CMV-10 plasmid through the HindIII and XbaI sites to generate the pFLAG-eEF1G expression plasmids, which encoded the hit-FLAG fusion peptide. All of the primers used for plasmid construction (Table 1) were synthesized by Sangon (Shanghai, China). All of the constructs were
Z. Zhang et al. / Microbial Pathogenesis 112 (2017) 111e116
113
Table 1 Primers used in this study. Primers
Sequence (50 e30 )
2B-F 2B-R pBT3-N-2B-F pBT3-N-2B-R pMyc-2B-F pMyc-2B-R FLAG-eEF1G-F FLAG-eEF1G-R
GGGACGTGGAGTCCAACC ATGTCACGTGCTTTGAGCTG ATTAACAAGGCCATTACGGCCATGCCCTTCTTCTTCTCT AACTGATTGGCCGAGGCGGCCTTACTGTTTCTCTGCTCT CGGAATTCCCCTTCTTCTTCTCTGACGTC ATCTCGAGTTACTGTTTCTCTGCTCTCTCG CGGAAGCTTAAGCTCTGTGAGAAGATGGCC CGGTCTAGATTACTTGAAGATCTTGCCCTG
Restriction enzyme
Usage pMD18-T-2B
Sfi I Sfi I EcoR I Xho I Hind III Xba I
pBT3-N-2B pMyc-2B pFLAG-eEF1G
(Restriction sites are underlined).
identified by restriction enzyme digestion and DNA sequence analysis. 2.5. Yeast two-hybrid screening The DUALmembrane system (Dualsystems Biotech) was used to identify host proteins that interact with 2B, which detects protein interaction based on the split-ubiquitin system. According to the manufacturer's protocol, the pBT3-N-2B plasmid was used as bait, and the swine cDNAs in the pPR3-N plasmids were used as prey. Correct expression of the bait was tested using the DUALmembrane functional assay (Dualsystems Biotech). Self-activation of the bait protein was detected by co-transforming with an aliquot of the empty library vector into the NMY51 yeast strain [MATa his3D200 trp1-901 leu2-3, 112 ade2 LYS2:(lexAop)4-HIS3 ura3:(lexAop)8lacZ ade2:(lexAop)8-ADE2 GAL4] and assayed on selective plates of increasing stringency. After no self-activation of the bait protein was confirmed and the basic screening conditions were optimized, the NMY51 yeast strain expressing the bait protein was transformed with the cDNA library plasmids using the lithium acetate method (Dualsystems Biotech). Transformants in which the bait and prey interacted were identified for two rounds of selection on synthetic dropout nutrient medium (SD/-Leu/-Trp/-His-Ade) plates, and were subjected to the HTX b-galactosidase assay (Dualsystems Biotech). Colonies with prominent b-galactosidase activity were considered to be transformants. The plasmids were isolated from the transformant colonies using a yeast plasmid purification kit (Omega Bio-Tek, Norcross, GA, USA), and competent E. coli were transformed with the plasmids. Transformants were grown on LuriaeBertani agar plates, and colonies were subsequently propagated in LuriaeBertani broth containing 100 mg/mL ampicillin. The cDNA inserts were analyzed by restriction enzyme digestion and DNA sequencing in Huada Gene Research Center (Beijing, China). The DNA sequence of each cDNA insert was imported into the SeqMan II program (DNAstar, Madison, WI, USA), and the cDNAs were identified by comparison to the GenBank nonredundant protein database using the Basic Local Alignment Search Tool. For eliminating false-positive interactions, the bait and the respective pPR3-N-prey clones of each of the hits (pPR3-N-hits) were cotransformed into the NMY51 yeast strain again. Cotransformations with pBT3-N/pPR3-N-hits and pTSU2-APP/pPR3-N served as negative controls. Only the prey clones that displayed an HISþ/ ADEþ/lacZ þ phenotype when coexpressed with the original bait were considered true positives. The true positives were analyzed further, according to the protocol described in the handbook for the DUALMembrane Kit. 2.6. Coimmunoprecipitation and western blotting A coimmunoprecipitation assay was used to confirm the interaction between 2B and eEF1G. The full-length coding sequence for 2B was cloned into the pCMV-Myc plasmid to generate the pMyc-
2B, which expressed 2B and the Myc peptide as a fusion protein. The eEF1G cDNA insert (amino acids 208e437) was cloned into p3xFLAG-CMV-10 to generate pFLAG-eEF1G, which expressed eEF1G and the FLAG peptide as a fusion protein. After seeding the HEK293T cells in 10-cm dishes, monolayers were grown to 70%e 80% confluence, and the cells were cotransfected using the XtremeGENE HP DNA transfection reagent with 5 mg pMyc-2B and 5 mg pFLAG-eEF1G for 48 h. After transfection, coimmunoprecipitation was performed using the Pierce Co-Immunoprecipitation Kit (Thermo Scientific), with normal rabbit or mouse IgG included as negative controls. The immunoprecipitates were subjected to sodium dodecyl sulfate-polyacrylamide gel electrophoresis and western blotting, as previously described [27]. Prey proteins were immunoprecipitated using a mouse anti-Myc antibody, and detected by western blotting using a rabbit anti-FLAG antibody and an IRDye 680-labeled goat anti-rabbit IgG antibody (LI-COR BioSciences, Lincoln, NE, USA). Bait protein was immunoprecipitated using a rabbit anti-FLAG antibody, and detected by western blotting using a mouse anti-Myc antibody and an IRDye 800CW-labeled goat anti-mouse IgG antibody (LI-COR BioSciences). Immunoreactive bands were visualized using the Odyssey Infrared Imaging System (LI-COR BioSciences). 3. Results 3.1. cDNA library construction A cDNA library was constructed from FMDV-infected swine tissues. The titer of the primary cDNA library was 6.7 106 cfu/mL, and the titer of the expressed yeast cDNA library was 107 cfu/mL. The mean size of the inserts was ~1.2 kb, and most inserts were 0.9 kb in size. The percent of recombinants was 100% (Fig. 1). 3.2. Yeast two-hybrid assay To identify potential cellular targets of 2B, we used a splitubiquitin-based yeast two-hybrid system to screen the swine cDNA library using full-length 2B as the bait protein. After having carried out the DUALmembrane functional assay, we verified that the pBT3-N-2B bait was functionally well expressed in the assay without nonspecific background, and we had the synthetic quadrupledropout medium(SD/Ade/His/Leu/Trp) as the optimal selection stringency for carrying out a library screen (Fig. 2A). The library screening yielded 128 colonies on the SD/-Leu/-Trp/His-Ade medium after 3 days of growth at 30 C. The number was reduced to 32 by eliminating false-positive interactors after an additional round of selection on nutritional selective media and an HTX b-galactosidase assay. The sequences of the 32 prey inserts were used for BLAST searches of the NCBI database, which showed that the prey sequences corresponded to those of immunoglobulin l-like polypeptide 5, ribosomal protein S20, and eEF1G. False positives were eliminated by repeating the cotransformation using the
114
Z. Zhang et al. / Microbial Pathogenesis 112 (2017) 111e116
Fig. 1. Insert-check PCR of randomly selected colonies from the expressed yeast cDNA library. Lanes 1e24, recombinant individual colonies; Lane M, 1 kb Plus DNA Ladder (Invitrogen).
Fig. 2. Yeast two-hybrid interaction analysis. (A): DUALmembrane functional assay. pBT3-N-2B bait plasmid was cotransformed with control plasmid pOst1-NubI or empty library vector pPR3-N and grown on selective plates of increasing stringency. Cotransformation of the bait construct with the empty library vector pPR3-N to exclude self-activation. Cotransformation of pTSU2-APP/pNubG-Fe65 and pTSU2-APP/pPR3-N was used as a positive and negative control, respectively. pBT3-N-2B bait interacted with Ost1-NubI control prey, but not with pPR3-N- derived NubG-nonsense-peptide prey, indicating that pBT3-N-2B bait was functionally well expressed in the assay without nonspecific background. (B) Confirmation of interaction between 2B and eEF1G in a yeast two-hybrid system. Yeast NMY51 strain was cotransformed with pBT3-N-2B bait plasmid and pPR3-eEF1G prey plasmid. Cotransformations with pBT3-N/pPR3-eEF1G and pTSU2-APP/pPR3-N were used as negative controls. Transformants were grown on SD/AHLW plates. Growth of colonies in the SD/AHLW plates indicated an interaction between 2B and eEF1G. SD/LW: SD/-Leu/-Trp, SD agar medium without leucine and tryptophan. SD/HLW: SD/-Leu/-Trp/-His, SD agar medium without leucine, tryptophan and histidine. SD/AHLW: SD/-Leu/-Trp/-His-Ade, SD agar medium without leucine, tryptophan, histidine and adenine.
isolated prey plasmid and the original bait plasmid. Only the inserts with eEF1G sequences yielded an HISþ/ADEþ/lacZþ phenotype when coexpressed with the 2B bait protein, but not when coexpressed with the empty bait plasmid (Fig. 2B). Therefore, eEF1G was considered to be a potential 2B cellular target, and was chosen for further characterization. The eEF1G cDNA fragment isolated in this yeast two-hybrid screen spanned amino acids 208e437 in the C-terminal region of the protein.
3.3. eEF1G interacts with 2B in mammalian cells The interaction of 2B with eEF1G in mammalian cells was examined by coimmunoprecipitation. Myc-tagged 2B and FLAGtagged eEF1G expression plasmids were transfected into HEK293T cells in combination. The cell lysates were immunoprecipitated using mouse anti-Myc antibody, and rabbit anti-FLAG antibody was used for western blotting to detect the presence of FLAG-eEF1G in the immunoprecipitates. As shown in Fig. 3, FLAGtagged eEF1G coprecipitated with the Myc-tagged 2B, whereas no FLAG-tagged protein was present in immunoprecipitates generated using mouse normal IgG. A rabbit anti-FLAG antibody was used for reciprocal coimmunoprecipitation, and immunoblotting was performed using a mouse anti-Myc antibody. Western blotting showed that Myc-2B precipitated with FLAG-eEF1G. These results suggest that eEF1G interacts with 2B in mammalian cells. 4. Discussion
Fig. 3. Co-immunoprecipitation demonstrated an interaction between 2B and eEF1G. HEK293T cells were cotransfected with pMyc-2B and pFLAG-eEF1G for 48 h. Whole cell lysates were subjected to immunoprecipitation using anti-Myc or anti-FLAG antibodies, and the immunoprecipitates were subjected to western blotting using antiFLAG or anti-Myc for detection of FLAG-eEF1G and Myc-2B proteins, respectively. Normal mouse or rabbit IgG was used as negative control. In the left portion of the blot, whole cell extracts were also analyzed.
Picornaviruses use multiple RNAeprotein interactions to complete their life cycle, including internal ribosome entry sitemediated translation, circularization of the genome, and RNA replication [28]. As a member of Picornaviridae, FMDV replication is dependent on both virus-encoded proteins and numerous cellular factors. During infection, FMDV uses various strategies to inhibit the host immune response and cellular gene expression, alter cellular proteineprotein interactions, and rearrange intracellular membranes to induce conditions that are favorable to virus replication and virion assembly [29,30].
Z. Zhang et al. / Microbial Pathogenesis 112 (2017) 111e116
The 2B gene of FMDV is 462 nucleotides in size, and encodes 154 amino acids. Previous studies have shown that the 2B protein contains two hydrophobic regions, and localizes primarily to the endoplasmic reticulum. The 2B protein exhibits viroporin-like properties, and may play an important role in FMDV infection [28,31,32]. The 2B protein increases membrane permeability and blocks protein secretory pathways [16,33,34]. The 2B protein also increases the level of Ca2þ in virus-infected cells, and induces autophagy [35e37]. Given the wide range of roles that 2B plays in the FMDV life cycle, we aimed to identify cellular targets of 2B using a high-throughput yeast two-hybrid screening system and a cDNA library constructed from FMDV-infected swine tissues. Recent developments in siRNA screening, affinity purification, mass spectrometry, and high-throughput genomic, transcriptomic, and proteomic approaches have facilitated progress in investigations of interactions between viral and host proteins. Yeast two-hybrid screening has been widely used to identify direct proteineprotein interactions on a genomic scale. To date, many interaction partners of FMDV proteins have been identified using classical yeast two-hybrid screening methods. In our current study, a dual membrane system was used to identify novel interaction partners of FMDV 2B. As opposed to the most popular yeast-based screening system, the dual membrane system can identify proteineprotein interactions between full-length integral membrane proteins, membrane-associated proteins, and soluble proteins in situ at cellular membranes. A well-characterized, high-quality cDNA library expressing host proteins is crucial for studying hostevirus interactions using a yeast two-hybrid system. To this end, several cDNA libraries constructed from pathogen-susceptible cell lines and tissues have been reported previously [17e20]. In our current study, we constructed a high-quality yeast two-hybrid cDNA library using RNA from multiple types of FMDV-infected swine tissues to investigate FMDV-induced processes in swine. We found that a molecular interaction occurred between the 2B protein of FMDV and a domain of cellular eEF1G within amino acids 208 and 437 in mammalian cells. eEF1G is a subunit of eEF1 complex, and functions in the transport of aminoacyl tRNAs to the ribosome for protein synthesis. The open reading frame in the eEF1G cDNA encodes a polypeptide that is 437 amino acids in length, with a molecular mass of 50 kDa. The N-terminal region of the eEF1G protein contains a glutathione transferase domain, which may be involved in regulating the assembly of multisubunit complexes containing eEF1G and aminoacyl-tRNA synthetases [38,39]. The eEF1G protein is involved in regulating vimentin gene by interacting with the RNA polymerase II and binding the vimentin promoter region and shuttling or nursing vimentin mRNA [40]. The eEF1G and eEF1A subunits of the eEF1 complex play crucial roles in reverse transcription of the human immunodeficiency virus-1 [41], and play synergistic roles in the replication of tomato bushy stunt virus [42]. Previous studies have also shown that overexpression of eEF1G influences tumor aggressiveness presumably by altering the redox balance of tumor cells [43,44]. Mislocalization of eEF1G has previously been shown to decrease the synthesis of membrane proteins. And in the absence of eEF1G, synthesis of certain membrane proteins essential for vesicle formation is severely affected [45]. FMDV protein 2B is suggested to be responsible for membranous alteration and increases membrane permeability in infected cells [13,16,33]. We therefore to speculate that eEF1G has a potential role in assisting protein 2B to produce virus-induced vesicles and induce cell lysis. The virus may hijack cellular eEF1G to facilitate its own transcription, localization, and translation. However, identifying the precise mechanism requires further study.
115
Author contributions ZWZ, YGZ and YLW conceived and designed the experiments; ZWZ, JLL and PZ performed the experiments; ZWZ, LP and YZD analyzed the data; XSL and YZF contributed reagents/materials/ analysis tools; ZWZ wrote the paper. Conflicts of interest The authors declare no conflict of interest. Acknowledgments This work was supported by grants from the National Key Research and Development Program of China (grant number 2016YFD0501503, 2017YFD0501100 and 2017YFD0501804), the Key Technology R&D Program of Gansu Province of China (grant number 1604NKCA045-2), and the National Pig Industrial System (CARS-36-06B). References [1] S. Alexandersen, N. Mowat, Foot-and-mouth disease: host range and pathogenesis, Curr. Top. Microbiol. Immunol. 288 (2005) 9e42. [2] E. Domingo, E. Baranowski, C. Escarmis, F. Sobrino, Foot-and-mouth disease virus, Comp. Immunol. Microbiol. Infect. Dis. 25 (2002) 297e308. [3] E. Domingo, C. Escarmis, E. Baranowski, C.M. Ruiz-Jarabo, E. Carrillo, J.I. Nunez, F. Sobrino, Evolution of foot-and-mouth disease virus, Virus Res. 91 (2003) 47e63. [4] J. Klein, Understanding the molecular epidemiology of foot-and-mouthdisease virus, Infect. Genet. Evol. 9 (2009) 153e161. [5] N.F. Abdul-Hamid, N.M. Hussein, J. Wadsworth, A.D. Radford, N.J. Knowles, D.P. King, Phylogeography of foot-and-mouth disease virus types O and A in Malaysia and surrounding countries, Infect. Genet. Evol. 11 (2011) 320e328. [6] M.J. Grubman, B. Baxt, Translation of foot-and-mouth disease virion RNA and processing of the primary cleavage products in a rabbit reticulocyte lysate, Virology 116 (1982) 19e30. [7] M.J. Grubman, B. Baxt, Foot-and-mouth disease, Clin. Microbiol. Rev. 17 (2004) 465e493. [8] T.D.L. Santos, Q.H. Wu, S.D. Botton, M.J. Grubman, Short hairpin RNA targeted to the highly conserved 2B nonstructural protein coding region inhibits replication of multiple serotypes of foot-and-mouth disease virus, Virology 335 (2005) 222e231. [9] H. van Rensburg, D. Haydon, F. Joubert, A. Bastos, L. Heath, L. Nel, Genetic heterogeneity in the foot-and-mouth disease virus Leader and 3C proteinases, Gene 289 (2001) 19e29. [10] J.F.E. Newman, B. Cartwright, T.R. Doel, F. Brown, Purification and identification of the RNA-dependent RNA polymerase of foot-and-mouth disease virus, J. Gen. Virol. 45 (1979) 497e507. [11] R. Andino, N. Boddeker, D. Silvera, A.V. Gamarnik, Intracellular determinants of picornavirus replication, Trends Microbiol. 7 (1999) 76e82. [12] J.S. Towner, T.V. Ho, B.L. Semler, Determinants of membrane association for poliovirus protein 3AB, J. Biol. Chem. 271 (1996) 26810e26818. [13] M.W. Cho, N. Teterina, D. Egger, K. Bienz, E. Ehrenfeld, Membrane rearrangement and vesicle induction by recombinant poliovirus 2C and 2BC in human cells, Virology 202 (1994) 129e145. [14] D.A. Hope, S.E. Diamond, K. Kirkegaard, Genetic dissection of interaction between poliovirus 3D polymerase and viral protein 3AB, J. Virol. 71 (1997) 9490e9498. [15] W.K. Xiang, K.S. Harris, L. Alexander, E. Wimmer, Interaction between the 50 terminal cloverleaf and 3AB/3CDpro of poliovirus is essential for RNA replication, J. Virol. 69 (1995) 3658e3667. [16] K. Moffat, G. Howell, C. Knox, G.J. Belsham, P. Monaghan, M.D. Ryan, T. Wileman, Effects of foot-and-mouth disease virus nonstructural proteins on the structure and function of the early secretory pathway: 2BC but not 3A blocks endoplasmic reticulum-to-Golgi transport, J. Virol. 79 (2005) 4382e4395. [17] D.P. Gladue, V. O'Donnell, R. Baker-Branstetter, L.G. Holinka, J.M. Pacheco, I. Fernandez-Sainz, Z. Lu, E. Brocchi, B. Baxt, M.E. Piccone, Foot-and-mouth disease virus nonstructural protein 2C interacts with Beclin1, modulating virus replication, J. Virol. 86 (2012) 12080e12090. [18] D.P. Gladue, V. O'Donnell, R. Baker-Branstetter, L.G. Holinka, J.M. Pacheco, I.F. Sainz, Z. Lu, X. Ambroggio, L. Rodriguez, M.V. Borca, Foot-and-mouth disease virus modulates cellular vimentin for virus survival, J. Virol. 87 (2013) 6794e6803. [19] D.P. Gladue, V. O'Donnell, R. Baker-Branstetter, J.M. Pacheco, L.G. Holinka, J. Arzt, S. Pauszek, I. Fernandez-Sainz, P. Fletcher, E. Brocchi, Interaction of foot-and-mouth disease virus nonstructural protein 3A with host protein
116
Z. Zhang et al. / Microbial Pathogenesis 112 (2017) 111e116
DCTN3 is important for viral virulence in cattle, J. Virol. 88 (2014) 2737e2747. [20] J.C. Wang, Y.Q. Wang, J. Liu, L. Ding, Q.H. Zhang, X.Q. Li, H. Cao, J. Tang, S.J.J. Zheng, A critical role of N-myc and STAT interactor (Nmi) in foot-andmouth disease virus (FMDV) 2C-induced apoptosis, Virus Res. 170 (2012) 59e65. [21] M.A. Devaney, V.N. Vakharia, R.E. Lloyd, E. Ehrenfeld, M.J. Grubman, Leader protein of foot-and-mouth disease virus is required for cleavage of the p220 component of the cap-binding protein complex, J. Virol. 62 (1988) 4407e4409. [22] T. de Los Santos, S.D. Botton, R. Weiblen, M.J. Grubman, The leader proteinase of foot-and-mouth disease virus inhibits the induction of beta interferon mRNA and blocks the host innate immune response, J. Virol. 80 (2006) 1906e1914. [23] G.J. Belsham, G.M. Mclnerney, N. Ross-Smith, Foot-and-mouth disease virus 3C protease induces cleavage of translation initiation factors eIF4A and eIF4G within infected cells, J. Virol. 74 (2000) 272e280. [24] D. Wang, L.R. Fang, K. Li, H.J. Zhong, J.X. Fan, C. Ouyang, H. Zhang, E.Z. Duan, R. Luo, Z.M. Zhang, X.T. Liu, H.C. Chen, S.B. Xiao, Foot-and-Mouth disease virus 3C protease cleaves NEMO to impair innate immune signaling, J. Virol. 86 (2012) 9311e9322. [25] Y.J. Du, J.S. Bi, J.Y. Liu, X. Liu, X.J. Wu, P. Jiang, D.W. Yoo, Y.G. Zhang, J.Q. Wu, R.Z. Wan, 3C(pro) of foot-and-mouth disease virus antagonizes the interferon signaling pathway by blocking STAT1/STAT2 nuclear translocation, J. Virol. 88 (2014) 4908e4920. [26] D. Wang, L.R. Fang, P. Li, L. Sun, J.X. Fan, Q.Y. Zhang, R. Luo, X.T. Liu, K. Li, H.C. Chen, The leader proteinase of foot-and-mouth disease virus negatively regulates the type I interferon pathway by acting as a viral deubiquitinase, J. Virol. 85 (2011) 3758e3766. [27] Z. Yang, Z.X. Shi, H.C. Guo, H. Qu, Y. Zhang, C.C. Tu, Annexin 2 is a host protein binding to classical swine fever virus E2 glycoprotein and promoting viral growth in PK-15 cells, Virus Res. 201 (2015) 16e23. [28] J.Y. Lin, T.C. Chen, K.F. Weng, S.C. Chang, L.L. Chen, S.R. Shih, Viral and host proteins involved in picornavirus life cycle, J. Biomed. Sci. 16 (2009) 103. [29] M.J. Grubman, M.P. Moraes, F.D.S. Segundo, L. Pena, T. de los Santos, Evading the host immune response: how foot-and-mouth disease virus has become an effective pathogen, FEMS. Immunol. Med. Microbiol. 53 (2008) 8e17. [30] P. Lawrence, E. Rieder, Identification of RNA helicase A as a new host factor in the replication cycle of foot-and-mouth disease virus, J. Virol. 83 (2009) 11356e11366. [31] S. Forss, K. Strebel, E. Beck, H. Schaller, Nucleotide sequence and genome organization of foot-and-mouth disease virus, Nucleic. Acids. Res. 12 (1984) 6587e6601. [32] D. Ao, H.C. Guo, S.Q. Sun, D.H. Sun, T.S. Fung, Y.Q. Wei, S.C. Han, X.P. Yao, S.Z. Cao, D.X. Liu, Viroporin activity of the foot-and-mouth disease virus nonstructural 2B protein, PloS One 10 (2015) e0125828.
[33] K. Bienz, D. Egger, L. Pasamontes, Association of polioviral proteins of the P2 genomic region with the viral replication complex and virus-induced membrane synthesis as visualized by electron microscopic immunocytochemistry and autoradiography, Virology 160 (1987) 220e226. [34] K. Moffat, C. Knox, G. Howell, S.J. Clark, H. Yang, G.J. Belsham, M. Ryan, T. Wileman, Inhibition of the secretory pathway by foot-and-mouth disease virus 2BC protein is reproduced by coexpression of 2B with 2C, and the site of inhibition is determined by the subcellular location of 2C, J. Virol. 81 (2007) 1129e1139. [35] R. Aldabe, A. Irurzun, L. Carrasco, Poliovirus protein 2BC increases cytosolic free calcium concentrations, J. Virol. 71 (1997) 6214e6217. [36] F.J.M. van Kuppeveld, A.S. de Jong, W.J.G. Melchers, P.H.G.M. Willems, Enterovirus protein 2B po(u)res out the calcium: a viral strategy to survive? Trends. Microbiol. 13 (2005) 41e44. [37] V. O'Donnell, J.M. Pacheco, M. LaRocco, T. Burrage, W. Jackson, L.L. Rodriguez, M.V. Borca, B. Baxt, Foot-and-mouth disease virus utilizes an autophagic pathway during viral replication, Virology 410 (2011) 142e150. [38] E.V. Koonin, A.R. Mushegian, R.L. Tatusov, S.F. Altschul, S.H. Bryant, P. Bork, A. Valencia, Eukaryotic translation elongation factor lg contains a glutathione transferase domain - study of a diverse, ancient protein superfamily using motif search and structural modeling, Protein Sci. 3 (1994) 2045e2054. [39] J. Sanders, J.A. Maassen, W. Moller, Elongation factor-1 messenger-RNA levels in cultured cells are high compared to tissue and are not drastically affected further by oncogenic transformation, Nucleic Acids Res. 20 (1992) 5907e5910. [40] N. Corbi, E.M. Batassa, C. Pisani, A. Onori, M.G. Di Certo, G. Strimpakos, M. Fanciulli, E. Mattei, C. Passananti, The eEF1 gamma subunit contacts RNA polymerase II and binds vimentin promoter region, PLoS One 5 (2010) e14481. [41] K. Warren, T. Wei, D.S. Li, F.Y. Qin, D. Warrilow, M.H. Lin, H. Sivakumaran, A. Apolloni, C.M. Abbott, A. Jones, J. Anderson, D. Harrich, Eukaryotic elongation factor 1 complex subunits are critical HIV-1 reverse transcription cofactors, PNAS 24 (2012) 9587e9592. [42] Z. Sasvari, L. Izotova, T.G. Kinzy, P.D. Nagy, Synergistic roles of eukaryotic translation elongation factors 1Bg and 1A in stimulation of tombusvirus minus-strand synthesis, PLoS Pathog. 7 (2011) e1002438. [43] F. Le Sourd, S. Boulben, R. Le Bouffant, P. Cormier, J. Morales, R. Belle, O. Mulner-Lorillon, eEF1B: at the dawn of the 21st century, Biochimica Biophysica Acta-Gene Struct. Expr. 1759 (2006) 13e31. [44] K. Mimori, M. Mori, H. Inoue, H. Ueo, K. Mafune, T. Akiyoshi, K. Sugimachi, Elongation factor 1 gamma mRNA expression in oesophageal carcinoma, Gut 38 (1996) 66e70. [45] L.L. Ong, P.C. Lin, X. Zhang, S.M. Chia, H. Yu, Kinectin-dependent assembly of translation elongation factor-1 complex on endoplasmic reticulum regulates protein synthesis, J. Biol. Chem. 281 (2006) 33621e33634.