- Email: [email protected]
Effect of 1,25(OH)2-vitamin D3 on expression and phosphorylation of progesterone receptor in cultured endometrial stromal cells of patients with repeated implantation failure
Acta Histochemica xxx (xxxx) xxxx
Contents lists available at ScienceDirect
Acta Histochemica journal homepage: www.elsevier.com/locate/acthis
Effect of 1,25(OH)2-vitamin D3 on expression and phosphorylation of progesterone receptor in cultured endometrial stromal cells of patients with repeated implantation failure Hossein Hosseinirada, Marefat Ghaffari Novina, Sedighe Hosseinib, Hamid Nazariana, Fardin Amidic, Shahrokh Paktinata, Elham Azizia, Zahra Shams Mofarahea,* a b c
Department of Biology and Anatomical Sciences, School of Medicine, Shahid Beheshti University of Medical Sciences, Tehran, Iran Preventative Gynecology Research Center (PGRC), Shahid Beheshti University of Medical Sciences, Tehran, Iran Department of Anatomical Sciences, School of Medicine, Tehran University of Medical Science, Tehran, Iran
A R T I C LE I N FO
A B S T R A C T
Keywords: Embryo implantation Stromal cells Endometrium Progesterone receptor Vitamin D
Repeated implantation failure (RIF) occurs in a condition when good quality embryos fail to implant in the endometrium following several in vitro fertilization (IVF) cycles. Suboptimal endometrial receptivity is one of the main underlying factors that causes this failure. Progesterone is the key regulator of endometrial receptivity which regulates gene expression through binding to its receptors in the endometrial stromal cells (eSC). The aim of this study was to evaluate the effect of 1,25(OH)2-vitamin D3 on progesterone receptor (PR) expression level and its phosphorylation on Ser294 residues in eSC of RIF patients and healthy fertile women. After isolation of the eSC from biopsy samples of RIF patients and healthy fertile women and their characterization, the cells were incubated with vitamin D3 and the expression level of PR mRNA, PR protein and phospho-Ser294 PR protein were evaluated after treatment. The results showed that vitamin D3 treatment increases PR mRNA and protein level and phospho-Ser294 PR protein level in the isolated eSC of both RIF patients and the control group. These results suggest that vitamin D3 may possibly play a key role during the embryo implantation process by affecting the expression pattern and regulatory modifications of the PR in the eSC.
1. Introduction Recurrent implantation failure (RIF) occurs in approximately 10% of intracytoplasmic sperm injection (ICSI) cycles (Magdi et al., 2017). There is no widely accepted definition for this clinical problem, though Coughlan et al. suggested that RIF refers to a status when a couple, with a woman under the age of 40, fail to achieve a clinical pregnancy after transfer of at least four good-quality embryos in a minimum of three fresh or frozen cycles (Coughlan et al., 2014). Embryonic and uterine factors are involved in the pathophysiology of RIF (Coughlan et al., 2014). However, the main limiting factor of the implantation is the disruption of endometrial receptivity rate in assisted reproductive technology (ART) (Timeva et al., 2014). The ovarian steroids, estrogen and progesterone, are the most important factors which control endometrial receptivity by regulation of gene expression mechanisms (Zhang et al., 2013). For instance, structural and functional changes of endometrium are all mediated by synchronized
secretion of estrogen and progesterone which then leads to blastocyst attachment and initiation of implantation process (Zhang et al., 2013). The expression level of progesterone receptor (PR) is low in epithelial cells through mid to late secretory phase of the endometrium (Giudice et al., 1993; Young, 2013) While the expression is significantly higher in stromal cells throughout this period (Young, 2013). By binding to and activating its receptor in stromal cells, progesterone regulates epithelial function through paracrine mechanisms and this makes the progesterone a key regulator of endometrial receptivity (Bhurke et al., 2016; Wetendorf and DeMayo, 2014). There are different isoforms of PR which are highly regulated by post-translational modifications on serine residues located at the Nterminal region of the protein, especially by phosphorylation on Ser294 (Hagan et al., 2012, 2011). These modifications in PR are often ligand dependent, but may also occur independently of progesterone-binding, for instance by binding to growth factors (Hagan et al., 2012). These regulatory processes modify stability of the receptor, its localization
⁎ Corresponding author at: Department of Biology and Anatomical Sciences, School of Medicine, Shahid Beheshti University of Medical Sciences, Arabi Ave, Daneshjoo Blvd, Velenjak, Tehran, Iran. E-mail address: [email protected] (Z.S. Mofarahe).
https://doi.org/10.1016/j.acthis.2019.151489 Received 15 September 2019; Received in revised form 8 December 2019; Accepted 10 December 2019 0065-1281/ © 2019 Elsevier GmbH. All rights reserved.
Please cite this article as: Hossein Hosseinirad, et al., Acta Histochemica, https://doi.org/10.1016/j.acthis.2019.151489
Acta Histochemica xxx (xxxx) xxxx
H. Hosseinirad, et al.
myomas, adhesions, polyps, and difficult previous embryo transfers were all excluded. No chromosomal abnormalities were observed during the karyotyping of the selected women and their spouses. In addition, couples with male factor infertility were excluded from the study. After considering the exclusion criteria, 15 out of 45 unexplained RIF patients were enrolled in this study. Three patients were excluded because of pathologies in their endometrial specimens or contamination during cell isolation process. The remaining 12 included as RIF group. A total of 13 cases of tubal ligation participated as the control group after signing informed consents. They had proven fertility (with at least one healthy live birth during last three years) and all had regular menstrual cycles (25–35 days). Individuals with previous infertility, abortion, ART treatment or preeclampsia were excluded from the control group. Two samples were excluded due to the insufficient number of the isolated cells, then 11 samples were used in experiments.
and interactions, transcriptional activity, and promoter selectivity (Daniel et al., 2009; Hagan et al., 2012). Therefore, modifications in PR play a pivotal role in mediating the impacts of progesterone on the endometrial tissue. The active form of vitamin D, 1,25-dihydroxyvitamin D3 or 1,25(OH)2D3, has proven effects on mineral homeostasis and bone metabolism (Bikle, 2014). This active form acts through binding to its nuclear receptor known as vitamin D3 receptor (VDR) (Irani and Merhi, 2014). Localized synthesis of vitamin D3 and presence of VDR and 1αhydroxylase (CYP27B1), the enzyme which is involved in vitamin D3 activation, have been reported in human placenta and decidual tissue (Keane et al., 2017; Zehnder et al., 2002) and these issue indicate a possible role for vitamin D3 in reproductive physiology. Moreover, there are some reports of positive correlation between vitamin D3 and pregnancy rate during IVF cycles (Garbedian et al., 2013; Paffoni et al., 2014; Rudick et al., 2014). However, the mechanism of action and the molecular roles of vitamin D3 signaling in reproductive tissues have not been fully elucidated. Vitamin D3 exerts multiple changes in biological functions of the recipient tissue by affecting gene expression profile via VDR (Pike and Meyer, 2014). In addition, some data demonstrate that fast activation of mitogen-activated protein kinase (MAPK) signaling pathway is involved in regulation of several vitamin D3 dependent responses (Buitrago et al., 2013; Ordóñez-Morán et al., 2008). On the other hand, it has been showed that MAPK pathway have functional roles in human PR phosphorylation on Ser294 residues (Lange et al., 2000; Shen et al., 2001). The aim of this study was to evaluate the effect of vitamin D3 on PR expression (mRNA and protein) and phospho-Ser294 PR level in eSC of RIF in comparison with those in healthy fertile women.
2.1. Sample collection and eSC isolation Endometrial biopsies were collected during early luteal phase of menstrual cycle using biopsy curette (Pipelle® Endometrial Suction Curette, Cooper Surgical, USA). The samples were immediately transferred to the cell culture laboratory in Dulbecco's Modified Eagle Medium/Nutrient Mixture F-12 (DMEM-F12) medium supplemented with 10% fetal bovine serum (FBS) and 1% penicillin-streptomycin. Simultaneously, small fragments of the tissues were sent for pathologic examination. eSC isolation was performed according to previous studies with little modification (Kajihara et al., 2014; Paktinat et al., 2019). Briefly, the sample was minced into small pieces of about 1 × 1 mm and incubated in enzyme cocktail containing collagenase type I (2 mg/ml) and DNase (4 mg/mL) for 1 h at 37°C. Afterwards, the suspension was washed twice in DMEM-F12 containing 10% FBS and 1 % penicillinstreptomycin by centrifugation at 1500 g for 5 min. Then using a 40 μm cell strainer, the dissociated cellular sheets of epithelial cells and glands were separated from single cells. The cells which passed through the strainer were washed and then cultivated in T-25 culture flasks overnight for purification. Thereafter, the adherent cells were allowed to proliferate and the non-adherent cells were discarded. To establish the purity of the isolated stromal cells, immunofluorescence staining of cytokeratin8/vimentin and flow cytometry of CD10 marker was performed.
2. Materials and methods The protocol of this study was approved by the Ethics Committee of Shahid Beheshti University of Medical Sciences, Tehran, Iran, under IR.SBMU.MSP.REC.1397.521 reference number. Written informed consent was obtained from all participants. Endometrial biopsies were obtained from RIF patients and healthy fertile individuals as control group. All the participants were under 40 years old and had no history of vitamin D3 or steroids intake during the last 3 months. The baseline characteristics of two groups are listed in Table 1. RIF patients consisted of women with three failures of ICSI cycle followed by the transfer of high quality grade A embryos who referred to infertility clinic of Taleghani Hospital at Shahid Beheshti University of Medical Sciences, Tehran, Iran. Women with known etiologies of RIF including inflammatory conditions (such as hydrosalpinx), immunological abnormalities (e.g. presence of anti-nuclear, anti-double stranded DNA, anti-phospholipid, antithyroglobulin, and anti-thyroid peroxidase antibodies), anatomical or hormonal disorders, history of ectopic pregnancy or miscarriage, presence of space-occupying lesions,
2.2. Evaluation of VDR and CYP27B1 mRNA expression levels in eSC of study groups After isolation of eSC from biopsy samples of RIF patients and control group, and after their characterization, VDR and CYP27B1 mRNA expression levels were analyzed by quantitative real-time PCR (qRT-PCR).
2.3. Treatment of eSC with vitamin D3 Table 1 .A summary of the baseline characteristics of two groups. Data are presented as mean ± SD. Parameter
RIF group
Control group
P value
Number of patients Age BMI AMH (pmol/l) Serum estradiol (pg/mL) Day 3 Serum FSH (IU/l) Day 3 Serum vitamin D (ng/ml)
12 35 ± 3.8 24.3 ± 3.4 42.3 ± 25.3 47.0 ± 18.9 5.5 ± 1.5 28.6 ± 17.6
11 33 ± 4.7 22.4 ± 2.3 49.6 ± 29.6 56.5 ± 1.5 5.7 ± 1.8 26.5 ± 15.4
NS NS NS NS NS NS
In order to perform immunofluorescent staining and qRT-PCR, the cells were seeded in duplicates on 24-well and 6-well plates, respectively. Experiment was conducted when the cells reached the 70% confluency. Experimental groups included: treatment group (received 10−7 M of 1,25(OH)2-vitamin D3; Sigma-Aldrich, St. Louis, MO, USA), control group (received no treat), and vehicle group (received same quantity of ethanol as the vehicle of 1,25(OH)2-vitamin D3). The dose of the vitamin D3 was selected according to the previous studies(Rajaei et al., 2012; Tavakoli et al., 2011). Then the cells were cultivated at 37 °C in a humidified incubator with 5% CO2. The incubation time for evaluation of PR mRNA and protein was 24 h and for evaluation of phospho-Ser294 PR protein was 30 min.
AMH, anti-Mullerian hormone; BMI, body mass index; FSH, follicle stimulating hormone; NS, non-significant; RIF, repeated implantation failure. 2
Acta Histochemica xxx (xxxx) xxxx
H. Hosseinirad, et al.
Table 2 Characteristics of designed primers for qRT-PCR. Primer
Primer sequence(5′ –3′)
Location
Gene Bank #
PR (PRA+PRB)
F: AGATCCTACAAACACGTCAGTGG R: CTTCTTGGCTAACTTGAAGCTTG F: CACCATAAGACCTACGACCC R: CACCATCATTCACACGAAC F: TTTGGCCCAGATCCTAACACA R: TTGATGCTCCTTTCAGGTACCAG F: TCTGACTTCAACAGCGACACC R: GTTGCTGTAGCCAAATTCGTT
2289/ 2420 (A) 3039/ 3170 (B) 538/ 610
NM_001202474.3 NM_000926.4 NM_000376.3
1441/ 1542
NM_000785.4
1027/ 1143
NM_001256799.3
VDR CYP27B1 GAPDH
Fig. 1. Immunofluorescence staining against cytokeratin8/vimentin in eSC. Green fluorescence represents antibody reactivity and blue fluorescence represents nuclear DAPI reactivity. (A) Vimentin positive eSC. (B) Cytokeratin8 negative eSC. (C & D) Negative reagent controls for vimentin and cytokeratin8, respectively. (For interpretation of the references to colour in this figure legend, the reader is referred to the web version of this article.)
Fig. 2. Flow cytometric analysis for CD10 expression by eSC, which shows 91.9% of the isolated cells are CD10 positive. Cells stained with anti-CD10 (left), and cells with isotype control (right).
drying, the pellet was dissolved in RNase-free water and kept in −20 °C until final assay. The quality of the extracted RNA and its concentration was analyzed by a NanoDrop™ Microvolume Spectrophotometer (Thermo Scientific, Willington, DE, USA). Reverse transcriptase reaction was performed using cDNA synthesis kit (BioFact, Daejeon, Korea) according to the manufacturer’s instruction. Primers were designed using the AlleleID software, version 7.5 (Premier Biosoft International, Palo Alto, CA, USA) (Table 2). GAPDH
2.4. RNA extraction and qRT-PCR The total RNA of the samples was extracted using TRIzol® Reagent (Life Technology, CA, USA). After homogenizing the cells in TRIzol®, the lysate was mixed with chloroform and centrifuged at 12,000 g for 15 min at 4 °C. Then the aqueous phase was isolated and precipitation of the RNA was performed using isopropyl alcohol by centrifugation. After washing the isolated RNA with ethanol (75%) followed by air3
Acta Histochemica xxx (xxxx) xxxx
H. Hosseinirad, et al.
water with cDNA or without cDNA (as non-template control). The reactions were performed using a StepOne RT-PCR system (Applied Biosystems, Foster City, CA, USA). Each real-time PCR reaction was performed in triplicate,as technical replicates, per subject.
2.5. Immunofluorescence staining The level of PR protein and phospho-Ser294 PR protein were established by immunofluorescence staining on the eSC. The Specificity of the primary antibodies for PR and phospho-Ser294 PR was asserted by MCF-7 cell line as positive control. In addition, the specificity of the secondary antibodies was validated in the absence of primary antibodies. As the detection of phosphorylation by immunofluorescence requires prevention of dephosphorylation of phosphorylated proteins during the fixation procedure (Molgaard et al., 2016), a preparation step was used according to the method described by Molgaard et al. (Molgaard et al., 2016). Briefly, the cells were placed on ice to reduce the dephosphorylation rate catalysed by internal phosphatases. Then the medium was discarded and the cells were washed once in ice-cold phosphate buffered saline (PBS). Afterwards, 0.5 mL of ice-cold paraformaldehyde (4%) containing phosphatase inhibitor (PhosSTOP™, Roche, Manheim, Germany) was added to the cells for preventing dephosphorylation during fixation step of immunofluorescent staining. After 20 min of fixation with paraformaldehyde (4%), permeabilization of cell membrane and blocking was performed by adding Triton X100 (0.5%) and goat serum (10%), respectively. Then the cells were incubated with mouse anti-PR (STJ97365, St John's Laboratory Ltd, London, UK) or rabbit anti-phospho-PR (S294) (STJ90691, St John's Laboratory Ltd, London, UK) antibodies for 2 h. After three times washing with PBS, secondary antibodies including goat anti-mouse-PE (ab5881, Abcam, Cambridge, UK) or goat anti-rabbit-FITC (ab6717, Abcam, Cambridge, UK) were applied for 3 h. Finally, the nuclei were stained with 5 μg/ml of 4′,6-diamidino-2-phenylindole (DAPI) (SigmaAldrich, St. Louis, MO, USA) and the cells were immediately observed under a fluorescence microscope (Nikon, Tokyo, Japan), where five random fields in 200X magnification were captured by Digital camera (DS Fi1c, Nikon, Tokyo, Japan) for each experiment. The percent of the stained cells was quantified manually using ImageJ software (V1.48, NIH, USA). A total of 200 cells were counted in each subject (n = 12 for RIF group, n = 11 for Control group) using this order in the software: plugins → analysis → cell counter.
Fig. 3. qRT-PCR analysis of VDR (A) and CYP27B1 (B) mRNA expression levels in eSC of RIF patients and control group. The results show no significant difference in VDR and CYP27B1 mRNA expression levels between two groups. Each real-time PCR reaction was performed in triplicate, as technical replicates, per subject (n = 12 for RIF group, n = 11 for Control group).
2.6. Data analysis The obtained results were analyzed by SPSS v.19 software (Chicago, IL, USA). The normality test was done by Kolmogorov Smirnov method. Comparisons were conducted using one-way ANOVA. Tukey Post-hoc test was used for pairwise comparisons. Differences were considered significant at P value < 0.05. Data are represented as mean ± standard deviation (SD).
3. Results Fig. 4. Analysis of PR mRNA level of eSC after vitamin D3 treatment was performed by qRT-PCR. The results show an increase in PR mRNA expression in the eSC of RIF patients after vitamin D3 treatment. Each real-time PCR reaction was performed in triplicate, as technical replicates, per subject (n = 12 for RIF group, n = 11 for Control group). (**) P < 0.01.
3.1. eSC characterization Characterization of the isolated cells was established by immunofluorescence staining for cytokeratin8/vimentin and flow cytometry for CD10. The results demonstrated that more than 90% of the cells were positive for vimentin, and almost all were negative for cytokeratin18 (Fig. 1). Meanwhile, 91.9% of the purified cells were positive for CD10 in flow cytometric analysis (Fig. 2).
was used as housekeeping gene. Each qRT-PCR reaction consisted of RealQ Plus 2x Master Mix Green High ROX™ (Ampliqon, Denmark), specific forward and reverse primers for each gene, and RNase-free 4
Acta Histochemica xxx (xxxx) xxxx
H. Hosseinirad, et al.
Fig. 5. Immunofluorescence staining against PR protein in cultured eSC of RIF patients for evaluating the effect of vitamin D3 on PR protein expression. Red fluorescence represents antibody reactivity against PR at the cytoplasm and somewhere in the nucleus of the cells. Blue fluorescence represents nuclear DAPI reactivity. (For interpretation of the references to colour in this figure legend, the reader is referred to the web version of this article.)
method to determine whether vitamin D3 affects PR protein level (Fig. 5). The results showed significant upregulation of PR protein in both RIF and control groups after treatment with vitamin D3 (P < 0.01) (Fig. 6). 3.5. Effect of vitamin D3 on phospho-Ser294 PR protein level in eSC The level of phospho-Ser294 PR protein level in eSC was analyzed by immunofluorescence method to determine whether vitamin D3 affects phospho-Ser294 PR protein level (Fig. 7). The results showed that the level of phospho-Ser294 PR protein was significantly upregulated in both RIF and control groups after treatment with vitamin D3 (P < 0.01.) (Fig. 8). 4. Discussion
Fig. 6. The percent of the fluorescence positive cells was analyzed to determine the differences in the expression level of PR protein. As shown here, the results revealed a significant upregulation of PR protein in both RIF and control groups after vitamin D3 treatment. Each immunofluorescence staining was performed in triplicate, as technical replicates, per subject (n = 12 for RIF group, n = 11 for Control group). (**) P < 0.01.
The present study is the first report which shows that vitamin D3 significantly increase the expression of PR mRNA in eSC of RIF patients and PR protein in eSC of both RIF patients and healthy fertile individuals. There are several reports of vitamin D3 activity and metabolism in eSC. Tavakoli et al. demonstrated that eSC are the target cells for vitamin D3 as they express high levels of VDR and CYP27B1, the enzyme which is involved in vitamin D3 activation (Tavakoli et al., 2011). Rajaei et al. showed VDR expression and comparable capacity of active vitamin D3 production in the endometrial cells isolated from both RIF patients and healthy women (Rajaei et al., 2012). Similar to the studies of Tavakoli et al. (Tavakoli et al., 2011) and Rajaei et al. (Rajaei et al., 2012), we also showed that VDR and CYP27B1 were expressed in eSC of RIF patients and control group and there were no significant difference in VDR and CYP27B1 mRNA expression levels between both groups. Although there are some evidence of vitamin D3 function in the endometrium (Cermisoni et al., 2018; Rajaei et al., 2012; Tavakoli et al., 2011; Zehnder et al., 2002), the exact mechanism by which vitamin D3 may potentially affect the initial events of pregnancy remains unknown. Rajaei et al. investigated the effect of vitamin D3 on cytokine secretion by endometrial cells of RIF patients and healthy women and revealed no beneficial impact on implantation related cytokines (Rajaei et al., 2012). This was the only study in this field. Similar to other steroid hormones, it is known that the active form of vitamin D acts via binding to an intracellular VDR, which results in the concentration of the ligand-receptor complex in the target cell’s
3.2. VDR and CYP27B1 mRNA expression levels in eSC of RIF patients and control group Differences of VDR and CYP27B1 mRNA expression levels in eSC of RIF patients and control group were analyzed using qRT-PCR method. The results showed no significant difference between two groups (Fig. 3). 3.3. Effect of vitamin D3 on PR mRNA expression in eSC The PR mRNA level in eSC was analyzed by qRT-PCR to determine whether vitamin D3 affects PR mRNA expression. The results demonstrated that mRNA level of PR was significantly increased by vitamin D3 treatment in the eSC of RIF patients (P < 0.01). However, vitamin D3 had no effect on the expression level of PR in the control group (Fig. 4). 3.4. Effect of vitamin D3 on PR protein level in eSC The PR protein level of eSC was analyzed by immunofluorescence 5
Acta Histochemica xxx (xxxx) xxxx
H. Hosseinirad, et al.
Fig. 7. Immunofluorescence staining against phospho-Ser294 PR protein in cultured eSC of RIF patients for evaluating the effect of vitamin D3 on phospho-Ser294 PR protein expression. Green fluorescence represents antibody reactivity against phospho-Ser294 PR at the nucleus and somewhere in the cytoplasm of the cells. Blue fluorescence represents nuclear DAPI reactivity. (For interpretation of the references to colour in this figure legend, the reader is referred to the web version of this article.)
could affect embryo implantation process or not. We also investigated phosphorylation of PR in eSC of RIF patients and healthy fertile women after treatment with vitamin D3 and showed that vitamin D3 significantly increase phosphorylation of PR in both groups. It has been revealed that PR activity is directly regulated by intercellular signaling pathways which lead to phosphorylation of the receptor on Ser294 residues. (Faivre et al., 2008; Lange et al., 2000). This modification occurs immediately after ligand binding and results in vigorous transcriptional activation of the PR by ensuring its retention inside the cell’s nucleus (Dressing et al., 2009; Qiu et al., 2003), in close association with the DNA (Daniel et al., 2007), and purging the inhibitory modification by sumoylation (Daniel et al., 2007). In addition, transcriptional activity of the Ser294-phosphorylated receptors is hypersensitive to low concentrations of the ligand on specific promoters (Lange et al., 2000). Therefore, it seems that phosphorylation of PR after treatment with vitamin D3 may be due to the non-transcriptional responses which are mediated by vitamin D3 and lead to stimulation of different protein kinases that participate in signal transduction (Bikle, 2014). It has been demonstrated that PR phosphorylation is hormone dependent and elevates upon progesterone stimulation (Dressing et al., 2009; Labriola et al., 2003). Many functional roles have been attributed to the phosphorylation of Ser294 residues on PR by MAPK (Lange et al., 2000; Shen et al., 2001). Besides, it has been revealed that multiple vitamin D3-dependent responses are regulated by fast activation of MAPK signaling pathway (Buitrago et al., 2013; Ordóñez-Morán et al., 2008). Consequently, vitamin D3 is likely to stimulate PR phosphorylation through activation of MAPK pathway in eSC, a hypothesis which needs to be evaluated. Altogether, these results support the idea that vitamin D3 may play a key role during pregnancy, potentially during implantation process, by exerting multiple effects on PR production and function in eSC. Of note, our study was conducted on an in vitro design with limited number of samples, and on single type of endometrial cells. Therefore,
Fig. 8. The percent of the fluorescence positive cells was analyzed to determine the differences in the expression level of phospho-Ser294 PR protein. The results showed a significant upregulation of phospho-Ser294 PR protein in both RIF and control groups after vitamin D3 treatment. Each immunofluorescence staining was performed in triplicate, as technical replicates, per subject (n = 12 for RIF group, n = 11 for Control group). (**) P < 0.01.
nucleus and the activation or inhibition of the transcription of multiple target genes (Pike and Meyer, 2014). Due to localized synthesis of vitamin D3 and presence of VDR and CYP27B1 in human endometrial cells (Keane et al., 2017; Zehnder et al., 2002), and positive correlation between vitamin D3 and pregnancy rate (Paffoni et al., 2014; Rudick et al., 2014), and based on the results of our study, it seems that one of the possible pathways which is targeted by the vitamin D3 in human endometrial cells and may participate in pregnancy, especially the implantation phase, is through the PR gene. Further studies are required to investigate these results thoroughly and verify whether this 6
Acta Histochemica xxx (xxxx) xxxx
H. Hosseinirad, et al.
in vivo studies are required to evaluate the effect of vitamin D3 on PR in RIF patients with known PR insufficiency. This may help to develop a potential therapeutic application for vitamin D3 for improving fertility outcome in RIF patients.
progesterone receptor signaling and specificity. Mol. Cell. Endocrinol. 357, 43–49. https://doi.org/10.1016/j.mce.2011.09.017. Hagan, C.R., Regan, T.M., Dressing, G.E., Lange, C.A., 2011. ck2-dependent phosphorylation of progesterone receptors (PR) on Ser81 regulates PR-B isoform-specific target gene expression in breast Cancer cells. Mol. Cell. Biol. 31, 2439–2452. https://doi. org/10.1128/MCB.01246-10. Irani, M., Merhi, Z., 2014. Role of vitamin D in ovarian physiology and its implication in reproduction: a systematic review. Fertil. Steril. 102https://doi.org/10.1016/j. fertnstert.2014.04.046. 460-468.e3. Kajihara, T., Tanaka, K., Oguro, T., Tochigi, H., Prechapanich, J., Uchino, S., Itakura, A., Šućurović, S., Murakami, K., Brosens, J.J., Ishihara, O., 2014. Androgens modulate the morphological characteristics of human endometrial stromal cells decidualized in vitro. Reprod. Sci. 21, 372–380. https://doi.org/10.1177/1933719113497280. Keane, K.N., Cruzat, V.F., Calton, E.K., Hart, P.H., Soares, M.J., Newsholme, P., Yovich, J.L., 2017. Molecular actions of vitamin D in reproductive cell biology. Reproduction 153https://doi.org/10.1530/REP-16-0386. R29–R42. Labriola, L., Salatino, M., Proietti, C.J., Pecci, A., Coso, O.A., Kornblihtt, A.R., Charreau, E.H., Elizalde, P.V., 2003. Heregulin induces transcriptional activation of the progesterone receptor by a mechanism that requires functional ErbB-2 and mitogenactivated protein kinase activation in breast Cancer cells. Mol. Cell. Biol. 23, 1095–1111. https://doi.org/10.1128/MCB.23.3.1095-1111.2003. Lange, C.A., Shen, T., Horwitz, K.B., 2000. Phosphorylation of human progesterone receptors at serine-294 by mitogen-activated protein kinase signals their degradation by the 26S proteasome. Proc. Natl. Acad. Sci. 97, 1032–1037. https://doi.org/10. 1073/pnas.97.3.1032. Magdi, Y., El-Damen, A., Fathi, A.M., Abdelaziz, A.M., Abd-Elfatah Youssef, M., AbdAllah, A.A.-E., Ahmed Elawady, M., Ahmed Ibrahim, M., Edris, Y., 2017. Revisiting the management of recurrent implantation failure through freeze-all policy. Fertil. Steril. 108, 72–77. https://doi.org/10.1016/j.fertnstert.2017.04.020. Molgaard, S., Ulrichsen, M., Olsen, D., Glerup, S., 2016. Detection of phosphorylated Akt and MAPK in cell culture assays. MethodsX 3, 386–398. https://doi.org/10.1016/j. mex.2016.04.009. Ordóñez-Morán, P., Larriba, M.J., Pálmer, H.G., Valero, R.A., Barbáchano, A., Duñach, M., de Herreros, A.G., Villalobos, C., Berciano, M.T., Lafarga, M., Muñoz, A., 2008. RhoA–ROCK and p38MAPK-MSK1 mediate vitamin D effects on gene expression, phenotype, and Wnt pathway in colon cancer cells. J. Cell Biol. 183, 697–710. https://doi.org/10.1083/jcb.200803020. Paffoni, A., Ferrari, S., Viganò, P., Pagliardini, L., Papaleo, E., Candiani, M., Tirelli, A., Fedele, L., Somigliana, E., 2014. Vitamin d deficiency and infertility: insights from in vitro fertilization cycles. J. Clin. Endocrinol. Metab. 99, E2372–E2376. https://doi. org/10.1210/jc.2014-1802. Paktinat, S., Hashemi, S.M., Ghaffari Novin, M., Mohammadi-Yeganeh, S., Salehpour, S., Karamian, A., Nazarian, H., 2019. Seminal exosomes induce interleukin-6 and interleukin-8 secretion by human endometrial stromal cells. Eur. J. Obstet. Gynecol. Reprod. Biol. 235, 71–76. https://doi.org/10.1016/j.ejogrb.2019.02.010. Pike, J.W., Meyer, M.B., 2014. Fundamentals of vitamin D hormone-regulated gene expression. J. Steroid Biochem. Mol. Biol. 144, 5–11. https://doi.org/10.1016/j.jsbmb. 2013.11.004. Qiu, M., Olsen, A., Faivre, E., Horwitz, K.B., Lange, C.A., 2003. Mitogen-activated protein kinase regulates nuclear association of human progesterone receptors. Mol. Endocrinol. 17, 628–642. https://doi.org/10.1210/me.2002-0378. Rajaei, S., Mirahmadian, M., Jeddi-Tehrani, M., Tavakoli, M., Zonoobi, M., Dabbagh, A., Zarnani, A.H., 2012. Effect of 1,25(OH) 2 vitamin D 3 on cytokine production by endometrial cells of women with repeated implantation failure. Gynecol. Endocrinol. 28, 906–911. https://doi.org/10.3109/09513590.2012.683062. Rudick, B.J., Ingles, S.A., Chung, K., Stanczyk, F.Z., Paulson, R.J., Bendikson, K.A., 2014. Influence of vitamin D levels on in vitro fertilization outcomes in donor-recipient cycles. Fertil. Steril. 101, 447–452. https://doi.org/10.1016/j.fertnstert.2013.10. 008. Shen, T., Horwitz, K.B., Lange, C.A., 2001. Transcriptional hyperactivity of human progesterone receptors is coupled to their ligand-dependent down-regulation by mitogen-activated protein kinase-dependent phosphorylation of serine 294. Mol. Cell. Biol. 21, 6122–6131. https://doi.org/10.1128/MCB.21.18.6122-6131.2001. Tavakoli, M., Jeddi-Tehrani, M., Salek-Moghaddam, A., Rajaei, S., Mohammadzadeh, A., Sheikhhasani, S., Kazemi-Sefat, G.-E., Zarnani, A.H., 2011. Effects of 1,25(OH)2 vitamin D3 on cytokine production by endometrial cells of women with recurrent spontaneous abortion. Fertil. Steril. 96, 751–757. https://doi.org/10.1016/j. fertnstert.2011.06.075. Timeva, T., Shterev, A., Kyurkchiev, S., 2014. Recurrent implantation failure: the role of the endometrium. J. Reprod. Infertil. 15, 173–183. Wetendorf, M., DeMayo, F.J., 2014. Progesterone receptor signaling in the initiation of pregnancy and preservation of a healthy uterus. Int. J. Dev. Biol. 58, 95–106. https:// doi.org/10.1387/ijdb.140069mw. Young, S.L., 2013. Oestrogen and progesterone action on endometrium: a translational approach to understanding endometrial receptivity. Reprod. Biomed. Online 27, 497–505. Zehnder, D., Evans, K.N., Kilby, M.D., Bulmer, J.N., Innes, B.A., Stewart, P.M., Hewison, M., 2002. The ontogeny of 25-Hydroxyvitamin D3 1α-Hydroxylase expression in human placenta and decidua. Am. J. Pathol. 161, 105–114. Zhang, S., Lin, H., Kong, S., Wang, S., Wang, H., Wang, H., Armant, D.R., 2013. Physiological and molecular determinants of embryo implantation. Mol. Aspects Med. 34, 939–980. https://doi.org/10.1016/j.mam.2012.12.011.
AUTHORSHIP Category 1 Conceptualization; Methodology, Software: H. Hosseinirad, Z. Shams Mofarahe. F. Amidi, Acquisition of data: H. Hosseinirad. S. Hosseini, E. Azizi, H. Nazarian. Analysis of data: H. Hosseinirad, F. Amidi, M. Ghaffari Novin, S. Paktinat. Category 2 Drafting the manuscript: H. Hosseinirad, Z. Shams Mofarahe, S. Paktinat. Revising the manuscript critically for important intellectual content: H. Hosseinirad, Z. Shams Mofarahe. Declaration of Competing Interest The authors report no declarations of interest. Acknowledgments This article has been extracted from the thesis written by Mr. H Hosseinirad in School of Medicine, Shahid Beheshti University of Medical Sciences, Tehran, Iran (Registration No:9). The study was funded by Shahid Beheshti University of Medical Sciences (Project No: 14934). References Bhurke, A.S., Bagchi, I.C., Bagchi, M.K., 2016. Progesterone-regulated endometrial factors controlling implantation. Am. J. Reprod. Immunol. 75, 237–245. https://doi.org/10. 1111/aji.12473. Bikle, D.D., 2014. Vitamin d metabolism, mechanism of action, and clinical applications. Chem. Biol. 21, 319–329. https://doi.org/10.1016/j.chembiol.2013.12.016. Buitrago, C., Pardo, V.G., Boland, R., 2013. Role of VDR in 1α,25-dihydroxyvitamin D3dependent non-genomic activation of MAPKs, Src and Akt in skeletal muscle cells. J. Steroid Biochem. Mol. Biol. 136, 125–130. https://doi.org/10.1016/j.jsbmb.2013. 02.013. Cermisoni, G.C., Alteri, A., Corti, L., Rabellotti, E., Papaleo, E., Viganò, P., Sanchez, A.M., 2018. Vitamin d and endometrium: a systematic review of a neglected area of research. Int. J. Mol. Sci. 19, 2320. https://doi.org/10.3390/ijms19082320. Coughlan, C., Ledger, W., Wang, Q., Liu, F., Demirol, A., Gurgan, T., Cutting, R., Ong, K., Sallam, H., Li, T.C., 2014. Recurrent implantation failure: definition and management. Reprod. Biomed. Online 28, 14–38. https://doi.org/10.1016/j.rbmo.2013.08. 011. Daniel, A.R., Knutson, T.P., Lange, C.A., 2009. Signaling inputs to progesterone receptor gene regulation and promoter selectivity. Mol. Cell. Endocrinol. 308, 47–52. https:// doi.org/10.1016/j.mce.2009.01.004. Daniel, A.R., Qiu, M., Faivre, E.J., Ostrander, J.H., Skildum, A., Lange, C.A., 2007. Linkage of progestin and epidermal growth factor signaling: phosphorylation of progesterone receptors mediates transcriptional hypersensitivity and increased ligand-independent breast cancer cell growth. Steroids 72, 188–201. https://doi.org/ 10.1016/j.steroids.2006.11.009. Dressing, G.E., Hagan, C.R., Knutson, T.P., Daniel, A.R., Lange, C.A., 2009. Progesterone receptors act as sensors for mitogenic protein kinases in breast cancer models. Endocr. Relat. Cancer 16, 351–361. https://doi.org/10.1677/ERC-08-0281. Faivre, E.J., Daniel, A.R., Hillard, C.J., Lange, C.A., 2008. Progesterone receptor rapid signaling mediates serine 345 phosphorylation and tethering to specificity protein 1 transcription factors. Mol. Endocrinol. 22, 823–837. https://doi.org/10.1210/me. 2007-0437. Garbedian, K., Boggild, M., Moody, J., Liu, K.E., 2013. Effect of vitamin D status on clinical pregnancy rates following in vitro fertilization. CMAJ Open 1, E77–E82. https://doi.org/10.9778/cmajo.20120032. Giudice, L.C., Dsupin, B.A., Jin, I.H., Vu, T.H., Hoffman, A.R., 1993. Differential expression of messenger ribonucleic acids encoding insulin-like growth factors and their receptors in human uterine endometrium and decidua. J. Clin. Endocrinol. Metab. 76, 1115–1122. Hagan, C.R., Daniel, A.R., Dressing, G.E., Lange, C.A., 2012. Role of phosphorylation in
7
Contents lists available at ScienceDirect
Acta Histochemica journal homepage: www.elsevier.com/locate/acthis
Effect of 1,25(OH)2-vitamin D3 on expression and phosphorylation of progesterone receptor in cultured endometrial stromal cells of patients with repeated implantation failure Hossein Hosseinirada, Marefat Ghaffari Novina, Sedighe Hosseinib, Hamid Nazariana, Fardin Amidic, Shahrokh Paktinata, Elham Azizia, Zahra Shams Mofarahea,* a b c
Department of Biology and Anatomical Sciences, School of Medicine, Shahid Beheshti University of Medical Sciences, Tehran, Iran Preventative Gynecology Research Center (PGRC), Shahid Beheshti University of Medical Sciences, Tehran, Iran Department of Anatomical Sciences, School of Medicine, Tehran University of Medical Science, Tehran, Iran
A R T I C LE I N FO
A B S T R A C T
Keywords: Embryo implantation Stromal cells Endometrium Progesterone receptor Vitamin D
Repeated implantation failure (RIF) occurs in a condition when good quality embryos fail to implant in the endometrium following several in vitro fertilization (IVF) cycles. Suboptimal endometrial receptivity is one of the main underlying factors that causes this failure. Progesterone is the key regulator of endometrial receptivity which regulates gene expression through binding to its receptors in the endometrial stromal cells (eSC). The aim of this study was to evaluate the effect of 1,25(OH)2-vitamin D3 on progesterone receptor (PR) expression level and its phosphorylation on Ser294 residues in eSC of RIF patients and healthy fertile women. After isolation of the eSC from biopsy samples of RIF patients and healthy fertile women and their characterization, the cells were incubated with vitamin D3 and the expression level of PR mRNA, PR protein and phospho-Ser294 PR protein were evaluated after treatment. The results showed that vitamin D3 treatment increases PR mRNA and protein level and phospho-Ser294 PR protein level in the isolated eSC of both RIF patients and the control group. These results suggest that vitamin D3 may possibly play a key role during the embryo implantation process by affecting the expression pattern and regulatory modifications of the PR in the eSC.
1. Introduction Recurrent implantation failure (RIF) occurs in approximately 10% of intracytoplasmic sperm injection (ICSI) cycles (Magdi et al., 2017). There is no widely accepted definition for this clinical problem, though Coughlan et al. suggested that RIF refers to a status when a couple, with a woman under the age of 40, fail to achieve a clinical pregnancy after transfer of at least four good-quality embryos in a minimum of three fresh or frozen cycles (Coughlan et al., 2014). Embryonic and uterine factors are involved in the pathophysiology of RIF (Coughlan et al., 2014). However, the main limiting factor of the implantation is the disruption of endometrial receptivity rate in assisted reproductive technology (ART) (Timeva et al., 2014). The ovarian steroids, estrogen and progesterone, are the most important factors which control endometrial receptivity by regulation of gene expression mechanisms (Zhang et al., 2013). For instance, structural and functional changes of endometrium are all mediated by synchronized
secretion of estrogen and progesterone which then leads to blastocyst attachment and initiation of implantation process (Zhang et al., 2013). The expression level of progesterone receptor (PR) is low in epithelial cells through mid to late secretory phase of the endometrium (Giudice et al., 1993; Young, 2013) While the expression is significantly higher in stromal cells throughout this period (Young, 2013). By binding to and activating its receptor in stromal cells, progesterone regulates epithelial function through paracrine mechanisms and this makes the progesterone a key regulator of endometrial receptivity (Bhurke et al., 2016; Wetendorf and DeMayo, 2014). There are different isoforms of PR which are highly regulated by post-translational modifications on serine residues located at the Nterminal region of the protein, especially by phosphorylation on Ser294 (Hagan et al., 2012, 2011). These modifications in PR are often ligand dependent, but may also occur independently of progesterone-binding, for instance by binding to growth factors (Hagan et al., 2012). These regulatory processes modify stability of the receptor, its localization
⁎ Corresponding author at: Department of Biology and Anatomical Sciences, School of Medicine, Shahid Beheshti University of Medical Sciences, Arabi Ave, Daneshjoo Blvd, Velenjak, Tehran, Iran. E-mail address: [email protected] (Z.S. Mofarahe).
https://doi.org/10.1016/j.acthis.2019.151489 Received 15 September 2019; Received in revised form 8 December 2019; Accepted 10 December 2019 0065-1281/ © 2019 Elsevier GmbH. All rights reserved.
Please cite this article as: Hossein Hosseinirad, et al., Acta Histochemica, https://doi.org/10.1016/j.acthis.2019.151489
Acta Histochemica xxx (xxxx) xxxx
H. Hosseinirad, et al.
myomas, adhesions, polyps, and difficult previous embryo transfers were all excluded. No chromosomal abnormalities were observed during the karyotyping of the selected women and their spouses. In addition, couples with male factor infertility were excluded from the study. After considering the exclusion criteria, 15 out of 45 unexplained RIF patients were enrolled in this study. Three patients were excluded because of pathologies in their endometrial specimens or contamination during cell isolation process. The remaining 12 included as RIF group. A total of 13 cases of tubal ligation participated as the control group after signing informed consents. They had proven fertility (with at least one healthy live birth during last three years) and all had regular menstrual cycles (25–35 days). Individuals with previous infertility, abortion, ART treatment or preeclampsia were excluded from the control group. Two samples were excluded due to the insufficient number of the isolated cells, then 11 samples were used in experiments.
and interactions, transcriptional activity, and promoter selectivity (Daniel et al., 2009; Hagan et al., 2012). Therefore, modifications in PR play a pivotal role in mediating the impacts of progesterone on the endometrial tissue. The active form of vitamin D, 1,25-dihydroxyvitamin D3 or 1,25(OH)2D3, has proven effects on mineral homeostasis and bone metabolism (Bikle, 2014). This active form acts through binding to its nuclear receptor known as vitamin D3 receptor (VDR) (Irani and Merhi, 2014). Localized synthesis of vitamin D3 and presence of VDR and 1αhydroxylase (CYP27B1), the enzyme which is involved in vitamin D3 activation, have been reported in human placenta and decidual tissue (Keane et al., 2017; Zehnder et al., 2002) and these issue indicate a possible role for vitamin D3 in reproductive physiology. Moreover, there are some reports of positive correlation between vitamin D3 and pregnancy rate during IVF cycles (Garbedian et al., 2013; Paffoni et al., 2014; Rudick et al., 2014). However, the mechanism of action and the molecular roles of vitamin D3 signaling in reproductive tissues have not been fully elucidated. Vitamin D3 exerts multiple changes in biological functions of the recipient tissue by affecting gene expression profile via VDR (Pike and Meyer, 2014). In addition, some data demonstrate that fast activation of mitogen-activated protein kinase (MAPK) signaling pathway is involved in regulation of several vitamin D3 dependent responses (Buitrago et al., 2013; Ordóñez-Morán et al., 2008). On the other hand, it has been showed that MAPK pathway have functional roles in human PR phosphorylation on Ser294 residues (Lange et al., 2000; Shen et al., 2001). The aim of this study was to evaluate the effect of vitamin D3 on PR expression (mRNA and protein) and phospho-Ser294 PR level in eSC of RIF in comparison with those in healthy fertile women.
2.1. Sample collection and eSC isolation Endometrial biopsies were collected during early luteal phase of menstrual cycle using biopsy curette (Pipelle® Endometrial Suction Curette, Cooper Surgical, USA). The samples were immediately transferred to the cell culture laboratory in Dulbecco's Modified Eagle Medium/Nutrient Mixture F-12 (DMEM-F12) medium supplemented with 10% fetal bovine serum (FBS) and 1% penicillin-streptomycin. Simultaneously, small fragments of the tissues were sent for pathologic examination. eSC isolation was performed according to previous studies with little modification (Kajihara et al., 2014; Paktinat et al., 2019). Briefly, the sample was minced into small pieces of about 1 × 1 mm and incubated in enzyme cocktail containing collagenase type I (2 mg/ml) and DNase (4 mg/mL) for 1 h at 37°C. Afterwards, the suspension was washed twice in DMEM-F12 containing 10% FBS and 1 % penicillinstreptomycin by centrifugation at 1500 g for 5 min. Then using a 40 μm cell strainer, the dissociated cellular sheets of epithelial cells and glands were separated from single cells. The cells which passed through the strainer were washed and then cultivated in T-25 culture flasks overnight for purification. Thereafter, the adherent cells were allowed to proliferate and the non-adherent cells were discarded. To establish the purity of the isolated stromal cells, immunofluorescence staining of cytokeratin8/vimentin and flow cytometry of CD10 marker was performed.
2. Materials and methods The protocol of this study was approved by the Ethics Committee of Shahid Beheshti University of Medical Sciences, Tehran, Iran, under IR.SBMU.MSP.REC.1397.521 reference number. Written informed consent was obtained from all participants. Endometrial biopsies were obtained from RIF patients and healthy fertile individuals as control group. All the participants were under 40 years old and had no history of vitamin D3 or steroids intake during the last 3 months. The baseline characteristics of two groups are listed in Table 1. RIF patients consisted of women with three failures of ICSI cycle followed by the transfer of high quality grade A embryos who referred to infertility clinic of Taleghani Hospital at Shahid Beheshti University of Medical Sciences, Tehran, Iran. Women with known etiologies of RIF including inflammatory conditions (such as hydrosalpinx), immunological abnormalities (e.g. presence of anti-nuclear, anti-double stranded DNA, anti-phospholipid, antithyroglobulin, and anti-thyroid peroxidase antibodies), anatomical or hormonal disorders, history of ectopic pregnancy or miscarriage, presence of space-occupying lesions,
2.2. Evaluation of VDR and CYP27B1 mRNA expression levels in eSC of study groups After isolation of eSC from biopsy samples of RIF patients and control group, and after their characterization, VDR and CYP27B1 mRNA expression levels were analyzed by quantitative real-time PCR (qRT-PCR).
2.3. Treatment of eSC with vitamin D3 Table 1 .A summary of the baseline characteristics of two groups. Data are presented as mean ± SD. Parameter
RIF group
Control group
P value
Number of patients Age BMI AMH (pmol/l) Serum estradiol (pg/mL) Day 3 Serum FSH (IU/l) Day 3 Serum vitamin D (ng/ml)
12 35 ± 3.8 24.3 ± 3.4 42.3 ± 25.3 47.0 ± 18.9 5.5 ± 1.5 28.6 ± 17.6
11 33 ± 4.7 22.4 ± 2.3 49.6 ± 29.6 56.5 ± 1.5 5.7 ± 1.8 26.5 ± 15.4
NS NS NS NS NS NS
In order to perform immunofluorescent staining and qRT-PCR, the cells were seeded in duplicates on 24-well and 6-well plates, respectively. Experiment was conducted when the cells reached the 70% confluency. Experimental groups included: treatment group (received 10−7 M of 1,25(OH)2-vitamin D3; Sigma-Aldrich, St. Louis, MO, USA), control group (received no treat), and vehicle group (received same quantity of ethanol as the vehicle of 1,25(OH)2-vitamin D3). The dose of the vitamin D3 was selected according to the previous studies(Rajaei et al., 2012; Tavakoli et al., 2011). Then the cells were cultivated at 37 °C in a humidified incubator with 5% CO2. The incubation time for evaluation of PR mRNA and protein was 24 h and for evaluation of phospho-Ser294 PR protein was 30 min.
AMH, anti-Mullerian hormone; BMI, body mass index; FSH, follicle stimulating hormone; NS, non-significant; RIF, repeated implantation failure. 2
Acta Histochemica xxx (xxxx) xxxx
H. Hosseinirad, et al.
Table 2 Characteristics of designed primers for qRT-PCR. Primer
Primer sequence(5′ –3′)
Location
Gene Bank #
PR (PRA+PRB)
F: AGATCCTACAAACACGTCAGTGG R: CTTCTTGGCTAACTTGAAGCTTG F: CACCATAAGACCTACGACCC R: CACCATCATTCACACGAAC F: TTTGGCCCAGATCCTAACACA R: TTGATGCTCCTTTCAGGTACCAG F: TCTGACTTCAACAGCGACACC R: GTTGCTGTAGCCAAATTCGTT
2289/ 2420 (A) 3039/ 3170 (B) 538/ 610
NM_001202474.3 NM_000926.4 NM_000376.3
1441/ 1542
NM_000785.4
1027/ 1143
NM_001256799.3
VDR CYP27B1 GAPDH
Fig. 1. Immunofluorescence staining against cytokeratin8/vimentin in eSC. Green fluorescence represents antibody reactivity and blue fluorescence represents nuclear DAPI reactivity. (A) Vimentin positive eSC. (B) Cytokeratin8 negative eSC. (C & D) Negative reagent controls for vimentin and cytokeratin8, respectively. (For interpretation of the references to colour in this figure legend, the reader is referred to the web version of this article.)
Fig. 2. Flow cytometric analysis for CD10 expression by eSC, which shows 91.9% of the isolated cells are CD10 positive. Cells stained with anti-CD10 (left), and cells with isotype control (right).
drying, the pellet was dissolved in RNase-free water and kept in −20 °C until final assay. The quality of the extracted RNA and its concentration was analyzed by a NanoDrop™ Microvolume Spectrophotometer (Thermo Scientific, Willington, DE, USA). Reverse transcriptase reaction was performed using cDNA synthesis kit (BioFact, Daejeon, Korea) according to the manufacturer’s instruction. Primers were designed using the AlleleID software, version 7.5 (Premier Biosoft International, Palo Alto, CA, USA) (Table 2). GAPDH
2.4. RNA extraction and qRT-PCR The total RNA of the samples was extracted using TRIzol® Reagent (Life Technology, CA, USA). After homogenizing the cells in TRIzol®, the lysate was mixed with chloroform and centrifuged at 12,000 g for 15 min at 4 °C. Then the aqueous phase was isolated and precipitation of the RNA was performed using isopropyl alcohol by centrifugation. After washing the isolated RNA with ethanol (75%) followed by air3
Acta Histochemica xxx (xxxx) xxxx
H. Hosseinirad, et al.
water with cDNA or without cDNA (as non-template control). The reactions were performed using a StepOne RT-PCR system (Applied Biosystems, Foster City, CA, USA). Each real-time PCR reaction was performed in triplicate,as technical replicates, per subject.
2.5. Immunofluorescence staining The level of PR protein and phospho-Ser294 PR protein were established by immunofluorescence staining on the eSC. The Specificity of the primary antibodies for PR and phospho-Ser294 PR was asserted by MCF-7 cell line as positive control. In addition, the specificity of the secondary antibodies was validated in the absence of primary antibodies. As the detection of phosphorylation by immunofluorescence requires prevention of dephosphorylation of phosphorylated proteins during the fixation procedure (Molgaard et al., 2016), a preparation step was used according to the method described by Molgaard et al. (Molgaard et al., 2016). Briefly, the cells were placed on ice to reduce the dephosphorylation rate catalysed by internal phosphatases. Then the medium was discarded and the cells were washed once in ice-cold phosphate buffered saline (PBS). Afterwards, 0.5 mL of ice-cold paraformaldehyde (4%) containing phosphatase inhibitor (PhosSTOP™, Roche, Manheim, Germany) was added to the cells for preventing dephosphorylation during fixation step of immunofluorescent staining. After 20 min of fixation with paraformaldehyde (4%), permeabilization of cell membrane and blocking was performed by adding Triton X100 (0.5%) and goat serum (10%), respectively. Then the cells were incubated with mouse anti-PR (STJ97365, St John's Laboratory Ltd, London, UK) or rabbit anti-phospho-PR (S294) (STJ90691, St John's Laboratory Ltd, London, UK) antibodies for 2 h. After three times washing with PBS, secondary antibodies including goat anti-mouse-PE (ab5881, Abcam, Cambridge, UK) or goat anti-rabbit-FITC (ab6717, Abcam, Cambridge, UK) were applied for 3 h. Finally, the nuclei were stained with 5 μg/ml of 4′,6-diamidino-2-phenylindole (DAPI) (SigmaAldrich, St. Louis, MO, USA) and the cells were immediately observed under a fluorescence microscope (Nikon, Tokyo, Japan), where five random fields in 200X magnification were captured by Digital camera (DS Fi1c, Nikon, Tokyo, Japan) for each experiment. The percent of the stained cells was quantified manually using ImageJ software (V1.48, NIH, USA). A total of 200 cells were counted in each subject (n = 12 for RIF group, n = 11 for Control group) using this order in the software: plugins → analysis → cell counter.
Fig. 3. qRT-PCR analysis of VDR (A) and CYP27B1 (B) mRNA expression levels in eSC of RIF patients and control group. The results show no significant difference in VDR and CYP27B1 mRNA expression levels between two groups. Each real-time PCR reaction was performed in triplicate, as technical replicates, per subject (n = 12 for RIF group, n = 11 for Control group).
2.6. Data analysis The obtained results were analyzed by SPSS v.19 software (Chicago, IL, USA). The normality test was done by Kolmogorov Smirnov method. Comparisons were conducted using one-way ANOVA. Tukey Post-hoc test was used for pairwise comparisons. Differences were considered significant at P value < 0.05. Data are represented as mean ± standard deviation (SD).
3. Results Fig. 4. Analysis of PR mRNA level of eSC after vitamin D3 treatment was performed by qRT-PCR. The results show an increase in PR mRNA expression in the eSC of RIF patients after vitamin D3 treatment. Each real-time PCR reaction was performed in triplicate, as technical replicates, per subject (n = 12 for RIF group, n = 11 for Control group). (**) P < 0.01.
3.1. eSC characterization Characterization of the isolated cells was established by immunofluorescence staining for cytokeratin8/vimentin and flow cytometry for CD10. The results demonstrated that more than 90% of the cells were positive for vimentin, and almost all were negative for cytokeratin18 (Fig. 1). Meanwhile, 91.9% of the purified cells were positive for CD10 in flow cytometric analysis (Fig. 2).
was used as housekeeping gene. Each qRT-PCR reaction consisted of RealQ Plus 2x Master Mix Green High ROX™ (Ampliqon, Denmark), specific forward and reverse primers for each gene, and RNase-free 4
Acta Histochemica xxx (xxxx) xxxx
H. Hosseinirad, et al.
Fig. 5. Immunofluorescence staining against PR protein in cultured eSC of RIF patients for evaluating the effect of vitamin D3 on PR protein expression. Red fluorescence represents antibody reactivity against PR at the cytoplasm and somewhere in the nucleus of the cells. Blue fluorescence represents nuclear DAPI reactivity. (For interpretation of the references to colour in this figure legend, the reader is referred to the web version of this article.)
method to determine whether vitamin D3 affects PR protein level (Fig. 5). The results showed significant upregulation of PR protein in both RIF and control groups after treatment with vitamin D3 (P < 0.01) (Fig. 6). 3.5. Effect of vitamin D3 on phospho-Ser294 PR protein level in eSC The level of phospho-Ser294 PR protein level in eSC was analyzed by immunofluorescence method to determine whether vitamin D3 affects phospho-Ser294 PR protein level (Fig. 7). The results showed that the level of phospho-Ser294 PR protein was significantly upregulated in both RIF and control groups after treatment with vitamin D3 (P < 0.01.) (Fig. 8). 4. Discussion
Fig. 6. The percent of the fluorescence positive cells was analyzed to determine the differences in the expression level of PR protein. As shown here, the results revealed a significant upregulation of PR protein in both RIF and control groups after vitamin D3 treatment. Each immunofluorescence staining was performed in triplicate, as technical replicates, per subject (n = 12 for RIF group, n = 11 for Control group). (**) P < 0.01.
The present study is the first report which shows that vitamin D3 significantly increase the expression of PR mRNA in eSC of RIF patients and PR protein in eSC of both RIF patients and healthy fertile individuals. There are several reports of vitamin D3 activity and metabolism in eSC. Tavakoli et al. demonstrated that eSC are the target cells for vitamin D3 as they express high levels of VDR and CYP27B1, the enzyme which is involved in vitamin D3 activation (Tavakoli et al., 2011). Rajaei et al. showed VDR expression and comparable capacity of active vitamin D3 production in the endometrial cells isolated from both RIF patients and healthy women (Rajaei et al., 2012). Similar to the studies of Tavakoli et al. (Tavakoli et al., 2011) and Rajaei et al. (Rajaei et al., 2012), we also showed that VDR and CYP27B1 were expressed in eSC of RIF patients and control group and there were no significant difference in VDR and CYP27B1 mRNA expression levels between both groups. Although there are some evidence of vitamin D3 function in the endometrium (Cermisoni et al., 2018; Rajaei et al., 2012; Tavakoli et al., 2011; Zehnder et al., 2002), the exact mechanism by which vitamin D3 may potentially affect the initial events of pregnancy remains unknown. Rajaei et al. investigated the effect of vitamin D3 on cytokine secretion by endometrial cells of RIF patients and healthy women and revealed no beneficial impact on implantation related cytokines (Rajaei et al., 2012). This was the only study in this field. Similar to other steroid hormones, it is known that the active form of vitamin D acts via binding to an intracellular VDR, which results in the concentration of the ligand-receptor complex in the target cell’s
3.2. VDR and CYP27B1 mRNA expression levels in eSC of RIF patients and control group Differences of VDR and CYP27B1 mRNA expression levels in eSC of RIF patients and control group were analyzed using qRT-PCR method. The results showed no significant difference between two groups (Fig. 3). 3.3. Effect of vitamin D3 on PR mRNA expression in eSC The PR mRNA level in eSC was analyzed by qRT-PCR to determine whether vitamin D3 affects PR mRNA expression. The results demonstrated that mRNA level of PR was significantly increased by vitamin D3 treatment in the eSC of RIF patients (P < 0.01). However, vitamin D3 had no effect on the expression level of PR in the control group (Fig. 4). 3.4. Effect of vitamin D3 on PR protein level in eSC The PR protein level of eSC was analyzed by immunofluorescence 5
Acta Histochemica xxx (xxxx) xxxx
H. Hosseinirad, et al.
Fig. 7. Immunofluorescence staining against phospho-Ser294 PR protein in cultured eSC of RIF patients for evaluating the effect of vitamin D3 on phospho-Ser294 PR protein expression. Green fluorescence represents antibody reactivity against phospho-Ser294 PR at the nucleus and somewhere in the cytoplasm of the cells. Blue fluorescence represents nuclear DAPI reactivity. (For interpretation of the references to colour in this figure legend, the reader is referred to the web version of this article.)
could affect embryo implantation process or not. We also investigated phosphorylation of PR in eSC of RIF patients and healthy fertile women after treatment with vitamin D3 and showed that vitamin D3 significantly increase phosphorylation of PR in both groups. It has been revealed that PR activity is directly regulated by intercellular signaling pathways which lead to phosphorylation of the receptor on Ser294 residues. (Faivre et al., 2008; Lange et al., 2000). This modification occurs immediately after ligand binding and results in vigorous transcriptional activation of the PR by ensuring its retention inside the cell’s nucleus (Dressing et al., 2009; Qiu et al., 2003), in close association with the DNA (Daniel et al., 2007), and purging the inhibitory modification by sumoylation (Daniel et al., 2007). In addition, transcriptional activity of the Ser294-phosphorylated receptors is hypersensitive to low concentrations of the ligand on specific promoters (Lange et al., 2000). Therefore, it seems that phosphorylation of PR after treatment with vitamin D3 may be due to the non-transcriptional responses which are mediated by vitamin D3 and lead to stimulation of different protein kinases that participate in signal transduction (Bikle, 2014). It has been demonstrated that PR phosphorylation is hormone dependent and elevates upon progesterone stimulation (Dressing et al., 2009; Labriola et al., 2003). Many functional roles have been attributed to the phosphorylation of Ser294 residues on PR by MAPK (Lange et al., 2000; Shen et al., 2001). Besides, it has been revealed that multiple vitamin D3-dependent responses are regulated by fast activation of MAPK signaling pathway (Buitrago et al., 2013; Ordóñez-Morán et al., 2008). Consequently, vitamin D3 is likely to stimulate PR phosphorylation through activation of MAPK pathway in eSC, a hypothesis which needs to be evaluated. Altogether, these results support the idea that vitamin D3 may play a key role during pregnancy, potentially during implantation process, by exerting multiple effects on PR production and function in eSC. Of note, our study was conducted on an in vitro design with limited number of samples, and on single type of endometrial cells. Therefore,
Fig. 8. The percent of the fluorescence positive cells was analyzed to determine the differences in the expression level of phospho-Ser294 PR protein. The results showed a significant upregulation of phospho-Ser294 PR protein in both RIF and control groups after vitamin D3 treatment. Each immunofluorescence staining was performed in triplicate, as technical replicates, per subject (n = 12 for RIF group, n = 11 for Control group). (**) P < 0.01.
nucleus and the activation or inhibition of the transcription of multiple target genes (Pike and Meyer, 2014). Due to localized synthesis of vitamin D3 and presence of VDR and CYP27B1 in human endometrial cells (Keane et al., 2017; Zehnder et al., 2002), and positive correlation between vitamin D3 and pregnancy rate (Paffoni et al., 2014; Rudick et al., 2014), and based on the results of our study, it seems that one of the possible pathways which is targeted by the vitamin D3 in human endometrial cells and may participate in pregnancy, especially the implantation phase, is through the PR gene. Further studies are required to investigate these results thoroughly and verify whether this 6
Acta Histochemica xxx (xxxx) xxxx
H. Hosseinirad, et al.
in vivo studies are required to evaluate the effect of vitamin D3 on PR in RIF patients with known PR insufficiency. This may help to develop a potential therapeutic application for vitamin D3 for improving fertility outcome in RIF patients.
progesterone receptor signaling and specificity. Mol. Cell. Endocrinol. 357, 43–49. https://doi.org/10.1016/j.mce.2011.09.017. Hagan, C.R., Regan, T.M., Dressing, G.E., Lange, C.A., 2011. ck2-dependent phosphorylation of progesterone receptors (PR) on Ser81 regulates PR-B isoform-specific target gene expression in breast Cancer cells. Mol. Cell. Biol. 31, 2439–2452. https://doi. org/10.1128/MCB.01246-10. Irani, M., Merhi, Z., 2014. Role of vitamin D in ovarian physiology and its implication in reproduction: a systematic review. Fertil. Steril. 102https://doi.org/10.1016/j. fertnstert.2014.04.046. 460-468.e3. Kajihara, T., Tanaka, K., Oguro, T., Tochigi, H., Prechapanich, J., Uchino, S., Itakura, A., Šućurović, S., Murakami, K., Brosens, J.J., Ishihara, O., 2014. Androgens modulate the morphological characteristics of human endometrial stromal cells decidualized in vitro. Reprod. Sci. 21, 372–380. https://doi.org/10.1177/1933719113497280. Keane, K.N., Cruzat, V.F., Calton, E.K., Hart, P.H., Soares, M.J., Newsholme, P., Yovich, J.L., 2017. Molecular actions of vitamin D in reproductive cell biology. Reproduction 153https://doi.org/10.1530/REP-16-0386. R29–R42. Labriola, L., Salatino, M., Proietti, C.J., Pecci, A., Coso, O.A., Kornblihtt, A.R., Charreau, E.H., Elizalde, P.V., 2003. Heregulin induces transcriptional activation of the progesterone receptor by a mechanism that requires functional ErbB-2 and mitogenactivated protein kinase activation in breast Cancer cells. Mol. Cell. Biol. 23, 1095–1111. https://doi.org/10.1128/MCB.23.3.1095-1111.2003. Lange, C.A., Shen, T., Horwitz, K.B., 2000. Phosphorylation of human progesterone receptors at serine-294 by mitogen-activated protein kinase signals their degradation by the 26S proteasome. Proc. Natl. Acad. Sci. 97, 1032–1037. https://doi.org/10. 1073/pnas.97.3.1032. Magdi, Y., El-Damen, A., Fathi, A.M., Abdelaziz, A.M., Abd-Elfatah Youssef, M., AbdAllah, A.A.-E., Ahmed Elawady, M., Ahmed Ibrahim, M., Edris, Y., 2017. Revisiting the management of recurrent implantation failure through freeze-all policy. Fertil. Steril. 108, 72–77. https://doi.org/10.1016/j.fertnstert.2017.04.020. Molgaard, S., Ulrichsen, M., Olsen, D., Glerup, S., 2016. Detection of phosphorylated Akt and MAPK in cell culture assays. MethodsX 3, 386–398. https://doi.org/10.1016/j. mex.2016.04.009. Ordóñez-Morán, P., Larriba, M.J., Pálmer, H.G., Valero, R.A., Barbáchano, A., Duñach, M., de Herreros, A.G., Villalobos, C., Berciano, M.T., Lafarga, M., Muñoz, A., 2008. RhoA–ROCK and p38MAPK-MSK1 mediate vitamin D effects on gene expression, phenotype, and Wnt pathway in colon cancer cells. J. Cell Biol. 183, 697–710. https://doi.org/10.1083/jcb.200803020. Paffoni, A., Ferrari, S., Viganò, P., Pagliardini, L., Papaleo, E., Candiani, M., Tirelli, A., Fedele, L., Somigliana, E., 2014. Vitamin d deficiency and infertility: insights from in vitro fertilization cycles. J. Clin. Endocrinol. Metab. 99, E2372–E2376. https://doi. org/10.1210/jc.2014-1802. Paktinat, S., Hashemi, S.M., Ghaffari Novin, M., Mohammadi-Yeganeh, S., Salehpour, S., Karamian, A., Nazarian, H., 2019. Seminal exosomes induce interleukin-6 and interleukin-8 secretion by human endometrial stromal cells. Eur. J. Obstet. Gynecol. Reprod. Biol. 235, 71–76. https://doi.org/10.1016/j.ejogrb.2019.02.010. Pike, J.W., Meyer, M.B., 2014. Fundamentals of vitamin D hormone-regulated gene expression. J. Steroid Biochem. Mol. Biol. 144, 5–11. https://doi.org/10.1016/j.jsbmb. 2013.11.004. Qiu, M., Olsen, A., Faivre, E., Horwitz, K.B., Lange, C.A., 2003. Mitogen-activated protein kinase regulates nuclear association of human progesterone receptors. Mol. Endocrinol. 17, 628–642. https://doi.org/10.1210/me.2002-0378. Rajaei, S., Mirahmadian, M., Jeddi-Tehrani, M., Tavakoli, M., Zonoobi, M., Dabbagh, A., Zarnani, A.H., 2012. Effect of 1,25(OH) 2 vitamin D 3 on cytokine production by endometrial cells of women with repeated implantation failure. Gynecol. Endocrinol. 28, 906–911. https://doi.org/10.3109/09513590.2012.683062. Rudick, B.J., Ingles, S.A., Chung, K., Stanczyk, F.Z., Paulson, R.J., Bendikson, K.A., 2014. Influence of vitamin D levels on in vitro fertilization outcomes in donor-recipient cycles. Fertil. Steril. 101, 447–452. https://doi.org/10.1016/j.fertnstert.2013.10. 008. Shen, T., Horwitz, K.B., Lange, C.A., 2001. Transcriptional hyperactivity of human progesterone receptors is coupled to their ligand-dependent down-regulation by mitogen-activated protein kinase-dependent phosphorylation of serine 294. Mol. Cell. Biol. 21, 6122–6131. https://doi.org/10.1128/MCB.21.18.6122-6131.2001. Tavakoli, M., Jeddi-Tehrani, M., Salek-Moghaddam, A., Rajaei, S., Mohammadzadeh, A., Sheikhhasani, S., Kazemi-Sefat, G.-E., Zarnani, A.H., 2011. Effects of 1,25(OH)2 vitamin D3 on cytokine production by endometrial cells of women with recurrent spontaneous abortion. Fertil. Steril. 96, 751–757. https://doi.org/10.1016/j. fertnstert.2011.06.075. Timeva, T., Shterev, A., Kyurkchiev, S., 2014. Recurrent implantation failure: the role of the endometrium. J. Reprod. Infertil. 15, 173–183. Wetendorf, M., DeMayo, F.J., 2014. Progesterone receptor signaling in the initiation of pregnancy and preservation of a healthy uterus. Int. J. Dev. Biol. 58, 95–106. https:// doi.org/10.1387/ijdb.140069mw. Young, S.L., 2013. Oestrogen and progesterone action on endometrium: a translational approach to understanding endometrial receptivity. Reprod. Biomed. Online 27, 497–505. Zehnder, D., Evans, K.N., Kilby, M.D., Bulmer, J.N., Innes, B.A., Stewart, P.M., Hewison, M., 2002. The ontogeny of 25-Hydroxyvitamin D3 1α-Hydroxylase expression in human placenta and decidua. Am. J. Pathol. 161, 105–114. Zhang, S., Lin, H., Kong, S., Wang, S., Wang, H., Wang, H., Armant, D.R., 2013. Physiological and molecular determinants of embryo implantation. Mol. Aspects Med. 34, 939–980. https://doi.org/10.1016/j.mam.2012.12.011.
AUTHORSHIP Category 1 Conceptualization; Methodology, Software: H. Hosseinirad, Z. Shams Mofarahe. F. Amidi, Acquisition of data: H. Hosseinirad. S. Hosseini, E. Azizi, H. Nazarian. Analysis of data: H. Hosseinirad, F. Amidi, M. Ghaffari Novin, S. Paktinat. Category 2 Drafting the manuscript: H. Hosseinirad, Z. Shams Mofarahe, S. Paktinat. Revising the manuscript critically for important intellectual content: H. Hosseinirad, Z. Shams Mofarahe. Declaration of Competing Interest The authors report no declarations of interest. Acknowledgments This article has been extracted from the thesis written by Mr. H Hosseinirad in School of Medicine, Shahid Beheshti University of Medical Sciences, Tehran, Iran (Registration No:9). The study was funded by Shahid Beheshti University of Medical Sciences (Project No: 14934). References Bhurke, A.S., Bagchi, I.C., Bagchi, M.K., 2016. Progesterone-regulated endometrial factors controlling implantation. Am. J. Reprod. Immunol. 75, 237–245. https://doi.org/10. 1111/aji.12473. Bikle, D.D., 2014. Vitamin d metabolism, mechanism of action, and clinical applications. Chem. Biol. 21, 319–329. https://doi.org/10.1016/j.chembiol.2013.12.016. Buitrago, C., Pardo, V.G., Boland, R., 2013. Role of VDR in 1α,25-dihydroxyvitamin D3dependent non-genomic activation of MAPKs, Src and Akt in skeletal muscle cells. J. Steroid Biochem. Mol. Biol. 136, 125–130. https://doi.org/10.1016/j.jsbmb.2013. 02.013. Cermisoni, G.C., Alteri, A., Corti, L., Rabellotti, E., Papaleo, E., Viganò, P., Sanchez, A.M., 2018. Vitamin d and endometrium: a systematic review of a neglected area of research. Int. J. Mol. Sci. 19, 2320. https://doi.org/10.3390/ijms19082320. Coughlan, C., Ledger, W., Wang, Q., Liu, F., Demirol, A., Gurgan, T., Cutting, R., Ong, K., Sallam, H., Li, T.C., 2014. Recurrent implantation failure: definition and management. Reprod. Biomed. Online 28, 14–38. https://doi.org/10.1016/j.rbmo.2013.08. 011. Daniel, A.R., Knutson, T.P., Lange, C.A., 2009. Signaling inputs to progesterone receptor gene regulation and promoter selectivity. Mol. Cell. Endocrinol. 308, 47–52. https:// doi.org/10.1016/j.mce.2009.01.004. Daniel, A.R., Qiu, M., Faivre, E.J., Ostrander, J.H., Skildum, A., Lange, C.A., 2007. Linkage of progestin and epidermal growth factor signaling: phosphorylation of progesterone receptors mediates transcriptional hypersensitivity and increased ligand-independent breast cancer cell growth. Steroids 72, 188–201. https://doi.org/ 10.1016/j.steroids.2006.11.009. Dressing, G.E., Hagan, C.R., Knutson, T.P., Daniel, A.R., Lange, C.A., 2009. Progesterone receptors act as sensors for mitogenic protein kinases in breast cancer models. Endocr. Relat. Cancer 16, 351–361. https://doi.org/10.1677/ERC-08-0281. Faivre, E.J., Daniel, A.R., Hillard, C.J., Lange, C.A., 2008. Progesterone receptor rapid signaling mediates serine 345 phosphorylation and tethering to specificity protein 1 transcription factors. Mol. Endocrinol. 22, 823–837. https://doi.org/10.1210/me. 2007-0437. Garbedian, K., Boggild, M., Moody, J., Liu, K.E., 2013. Effect of vitamin D status on clinical pregnancy rates following in vitro fertilization. CMAJ Open 1, E77–E82. https://doi.org/10.9778/cmajo.20120032. Giudice, L.C., Dsupin, B.A., Jin, I.H., Vu, T.H., Hoffman, A.R., 1993. Differential expression of messenger ribonucleic acids encoding insulin-like growth factors and their receptors in human uterine endometrium and decidua. J. Clin. Endocrinol. Metab. 76, 1115–1122. Hagan, C.R., Daniel, A.R., Dressing, G.E., Lange, C.A., 2012. Role of phosphorylation in
7