- Email: [email protected]
Effect of Cryopreservation and Cell Passage Number on Cell Preparations Destined for Autologous Chondrocyte Transplantation
Effect of Cryopreservation and Cell Passage Number on Cell Preparations Destined for Autologous Chondrocyte Transplantation B.M. Nama, B.Y. Kima, Y.H. Joa, S. Leea, J.G. Nemenoa, W. Yanga, K.M. Leea, H. Kima, I.J. Janga, T. Takebeb,c, and J.I. Leea,* a
Regenerative Medicine Laboratory, Center for Stem Cell Research, Department of Biomedical Science and Technology, Institute of Biomedical Science and Technology (IBST), Konkuk University, Seoul, Republic of Korea; bDepartment of Regenerative Medicine, Yokohama City University Graduate School of Medicine, Yokohama, Japan; and cPRESTO, Japan Science and Technology Agency, Kawaguchi, Japan
ABSTRACT Autologous chondrocyte transplantation (ACT) is an effective and safe therapy for repairing articular cartilage defects and requires cell preservation and subculture before transplantation. We compared the effects of cryopreservation and passaging on cell viability, proliferation, and maintenance of the function of chondrocytes and synoviumderived mesenchymal stem cells (MSCs) used as sources for ACT. These cells were isolated from the knee joints of rabbits and were cultured, passaged serially, and divided into 2 groups that were either cryopreserved or not. The morphology, viability, gene expression, and differentiation potential of the 2 groups were compared. Maintenance of the potential to undergo chondrogenic differentiation was determined with the use of a 3-dimensional culture method. Passaging and cryopreservation significantly affected the ability of chondrocytes to maintain their morphology, express chondrogenic genes, and differentiate. In contrast, synovium-derived cells were not affected by passaging and cryopreservation. Our results may serve as the foundation for the application of passaged and cryopreserved chondrocyte or other source cells of MSCs in ACT.
C
ELLS that are obtained from autologous, homologous, or heterologous tissues may undergo phenotypic changes by proliferation or selection methods in vitro. Many clinical studies have focused on the application of cell therapy to the treatment of a variety of diseases affecting systems such as the circulatory, nervous, and musculoskeletal systems [1e3]. One strategy involves injecting the cells directly [4]. This has succeeded in reducing patients’ fears and the inconvenience faced with the use of other modalities. However, cell therapy has a number of limitations that must be addressed, such as preservation and subculture of cells in numbers that are sufficient for transplantation [5]. However, these techniques may cause cells to lose their specific phenotype, including proliferation and viability [5,6]. Defects in articular cartilage are difficult to treat because it has limited ability for self-repair [6,7]. Intensive long-term research designed to overcome these difficulties has failed to establish an effective and safe treatment. Various methods have been used to repair articular cartilage
damage, including arthroscopic debridement, bone marrow stimulation, osteochondral mosaicplasty, and autologous chondrocyte transplantation (ACT) [8]. ACT, as its name implies, uses the patient’s chondrocytes and has generated increasing interest among researchers [5,9]. However, chondrocytes may undergo dedifferentiation and lose their chondrocytic characteristics during monolayer culture and cryopreservation before transplantation [5,8,10], Therefore, mesenchymal stem cells (MSCs) have been commonly used as alternative sources for chondrocytes in a number of cell therapies [11,12]. The synovium-derived MSCs from
Funding: Basic Science Research Program, through the National Research Foundation of Korea (NRF) funded by the Ministry of Education, Science, and Technology (2010-0024188). *Address correspondence to Jeong Ik Lee, DVM, PhD, DVetMedSci, DMed, Konkuk University, 120 Neungdong-ro (Hwayang-dong), Gwangjin-gu, Seoul 143-701, Korea. E-mail: [email protected]
Crown Copyright ª 2014 Published by Elsevier Inc. All rights reserved. 360 Park Avenue South, New York, NY 10010-1710 Transplantation Proceedings, 46, 1145e1149 (2014)
0041-1345/14/$esee front matter http://dx.doi.org/10.1016/j.transproceed.2013.11.117 1145
1146
articular cartilage synovium have high potential to differentiate into mesenchymal lineages of joint components, including cartilages and bones [7,12,13]. The main purpose of the present study was to compare the effects of cryopreservation and passaging on cell viability, proliferation, and maintenance of function on chondrocytes and synovium-derived cells intended for use as sources for ACT (Fig 1).
MATERIALS AND METHODS Tissue Harvest and Cell Isolation The animal experiments were approved by Konkuk University and performed according to its guidelines on animal use (KU13003). Cartilage and synovium were harvested from the knee joints of 7week-old male New Zealand white rabbits (Samtako, Osan, Korea). The harvested tissues were minced and digested with 3 mg/mL type 1 collagenase (Worthington Biochemical Co, USA) in Dulbecco Modified Eagle Medium:eNutrient Mixture F-12 (DMEM/ F12; 1:1, Ham, Gibco, USA) containing 1% antibiotics-antimycotics (AA; Gibco), and were subsequently incubated at 37 C for 5 hours in a shaking water bath in an atmosphere containing 5% CO2. The chondrocytes from the digested tissues were cultured in DMEM/ F12 containing 1% AA, 10% fetal bovine serum (FBS; Gibco), and 1% ascorbic acid (50 mg/mL; Sigma-Aldrich, USA) at 37 C in an
Fig 1. Experimental design.
NAM, KIM, JO ET AL atmosphere containing 5% CO2, and the synovium-derived cells were cultured in DMEM/F12 containing 1% AA and 10% FBS at 37 C in an atmosphere containing 5% CO2. Each cell culture was passaged at a density of 2 104 cells/cm2.
Three-Dimensional (3D) Culture and Differentiation Pellets were obtained from a 3D culture system with the use of serially passaged fresh or cryopreserved cells. The pellets were prepared by seeding 5 105 cells in a 15-mL tube and centrifuging them at 1,600 rpm for 5 minutes. The supernates were discarded and replaced with chondrogenesis differentiation media (DMEMHG, FBS, 100 mmol/L dexamethasone, 50 mmol/L ascorbate-2phosphate [Sigma-Aldrich], insulin-transferrin-selenium [Gibco], and 5 ng/mL transforming growth factor b1 [Sigma-Aldrich]) for 3 weeks.
Cryopreservation Cells were cultured in 150-mm-diameter dishes at an initial density of 2 104 cells/cm2. The cells were treated with 0.25% trypsinEDTA (Gibco), and harvested twice with the use of complete media and phosphate-buffered saline solution (PBS) and then washed with PBS. The cells were then preserved in 1 mL of a commercial preservation solution, Cell Banker (Zenoaq, Fukushima, Japan), in cryogenic vials. Cryovials were placed in a cryofreezing container and then transferred to a 80 C freezer for 1 week.
CRYOPRESERVATION AND CELL PASSAGE NUMBER
Cell Viability and Proliferation Cell viability and proliferation rates were evaluated with the use of 1-(4,5-dimethylthiazol-2-yl)-3,5-diphenyl-formazan (MTT formazan) solution (5 mg/mL in PBS; Sigma-Aldrich). After 3 days, the cells were seeded; then, MTT formazan solution was added to each well and the mixture incubated for 30 minutes. The optical density of the cells was measured at 540 nm with the use of a spectrophotometer, Spectra Max 190 (Molecular Devices, USA). Cells were counted with the use of a hemocytometer with trypan blue (Gibco).
1147
RESULTS Cell Viability
Our data showed that serial passaging and cryopreservation did not affect the viabilities of chondrocytes and synoviumderived cells as determined by the results of MTT assay and a trypan blue cell counting assay (Fig 2). Although the number of cells decreased after passaging, the difference was not statistically significant (data not shown). Similarly, cryopreservation did not affect cell viability (Fig 2).
DNA Quantification and Glycosaminoglycan (GAG) Assay Pellets were used for GAG determination with the use of the Blyscan sulfated glycosaminoglycan assay (Biocolor, United Kingdom) following the manufacturer’s protocol. The remaining contents were used for quantification of DNA. The DNA (mg/mL) content was measured with the use of a Nanodrop ND-1000 Spectrophotometer (Nanodrop Technologies, USA). The final concentration of GAG in each sample was determined by dividing the GAG level in the supernate by the corresponding DNA concentration.
Levels of Chondrogenic Gene Expression in Passaged and Cryopreserved Cells
We determined whether the cells maintained their chondrocytic potential by determining the levels of mRNA encoding the chondrocyte markers Aggrecan (ACAN), collagen type II alpha 1 (COL2A1), and sex-determining region box 9 (SOX-9). Their mRNA expression levels decreased as the cells were passaged. However, no
RNA Isolation and Reverse-Transcription Polymerase Chain Reaction (RT-PCR) Total RNA was isolated from passaged fresh and cryopreserved chondrocyte and synovium-derived cells with the use of TRI reagent TR118 (Molecular Research Center, USA). Complementary DNA (cDNA) was synthesized with the use of M-MLV reverse transcriptase (Elpis Biotech, Daejeon, Korea) according to the manufacturer’s protocols. Template cDNA, w100 pg total RNA, was mixed with Accupower Taq PCR Premix (Bioneer, Daejeon, Korea) and 5 pmol each of the forward and reverse primers in a final volume of 20 mL. Amplification was performed with the use of a 7500 PCR system (Applied Biosystems, USA) with the following protocol and the primers listed in Table 1: denaturation at 95 C for 7 minutes and 25 cycles each of 95 C for 30 seconds, 60 C for 30 seconds, and 72 C for 30 seconds.
Statistical Analysis One-way analysis of variance (Graphpad Prism 5 for Windows; Graphpad, USA) was used to assess the correlations between the fresh and cryopreserved groups. P values of <.05 were considered to be statistically significant. Table 1. Reverse-Transcription Polymerase Chain Reaction Primers Primers
Aggrecan Forward Reverse COL2A1 Forward Reverse SOX9 Forward Reverse GAPDH Forward Reverse
Sequence
Amplicon Size
GCTACGGAGACAAGGATGAGTTC CGTAAAAGACCTCACCCTCCAT
114 bp
CCTGTGCGACGACATAATCTGT GGTCCTTTAGGTCCTACGATATCCT
177 bp
GGCTCCGACACCGAGAATAC TCCGGGTGGTCTTTCTTGTG
395 bp
TCACCATCTTCCAGGAGCGA CACAATGCCGAAGTGGTCGT
304 bp
Fig 2. Evaluation of the cell viability of (A) chondrocytes and (B) synovium-derived cells that were passaged and cryopreserved. P, passage.
1148
significant differences were detected between the levels of these mRNAs in fresh and cryopreserved cells (Fig 3). Quantification of GAG Content
Chondrocytes that were not cryopreserved had a higher GAG expression level than those that were cryopreserved (Fig 4A). Furthermore, GAG secretion by chondrocytes decreased during serial passage. However, GAG secretion by synovium-derived cells was not affected by cryopreservation and passaging (Fig 4B). DISCUSSION
Articular cartilage is normally exposed to exogenous physical and mechanical stress. Forces exerted on joints can exceed the limits of cartilage structures, causing their corrosion and loss of components from solid surfaces [6]. Most efforts to repair an articular cartilage injury have been aimed at overcoming the limitations of the use of this tissue for healing by the introduction of new cells with chondrogenic potential [8,12,14]. However, none of these treatments efficiently regenerated the damaged hyaline cartilage. Cell therapy is a promising clinical approach to regenerate damaged tissues. ACT is an effective and safe cell-based therapy for repairing articular cartilage defects [8]. However, this therapeutic strategy requires preservation and subculture of cells for the secondary injection [5]. Chondrocytes and MSCs are used as sources for ACT [11,12], These stem cells can either be continuously cultured in vitro or cryopreserved, which decreases the proliferative potential and phenotypic stability [9]. Therefore, in the present study, we investigated the effects of cryopreservation and culturing on cell viability, proliferation, and maintenance of function of chondrocyte and synoviumderived cells as sources for ACT. We confirmed that synovium-derived cells are MSCs that have a higher proliferation and the ability to differentiate into osteoblasts, adipocytes, and chondrocytes. These cells strongly expressed MSC markers (data not shown). Our data show that culturing, but not cryopreservation, significantly affected the expression of chondrogenic genes, including those encoding AGGRECAN, COL2A1, and
Fig 3. Effects of passage (P) number and cryopreservation on the mRNA expression levels of chondrogenic genes of chondrocytes cultured as monolayers.
NAM, KIM, JO ET AL
SOX9, which mediate the phenotypic stability and the differentiation potential of chondrocytes. We also found that cell culture and cryopreservation significantly changed the morphology of chondrocytes but did not affect their viabilities or proliferation rates. A number of studies have focused on the type and length of cell preservation [8,9,15]. In contrast, we investigated the effects of cryopreservation during a shorter period (1 wk). Our results showed that passage 2 or passage 3 chondrocytes maintained their specific phenotype (Fig 4) and superior viability rates compared with passage 1 cells (Fig 2). These data suggest that cell phenotype stabilized during passages 2 and 3. However, synovium-derived cells were not affected by passaging or cryopreservation. Recent reports have shown that MSCs have a “memory” of proliferation and differentiation that is not affected by cryopreservation [11] and maintain their stem cell characteristics during passaging in an in vitro culture system [16]. In summary, the present study demonstrated that cryopreservation and passaging affects chondrocytes but not
Fig 4. Quantification of glycosaminoglycan expression after passaging fresh and cryopreserved cells. (A) Chondrocytes and (B) synovium-derived cells cultured with the use of a 3D (pellet) method. P, passage.
CRYOPRESERVATION AND CELL PASSAGE NUMBER
synovium-derived cell qualitatively rather than quantitatively. Moreover, in the case of preparation for ACT, passage 2 or passage 3 chondrocytes were determined to be the optimal source for transplantation. REFERENCES [1] Raval Z, Losordo DW. Cell therapy of peripheral arterial disease: from experimental findings to clinical trials. Circ Res 2013;112:1288e302. [2] Miller RH, Bai L. Translating stem cell therapies to the clinic. Neurosci Lett 2012;519:87e92. [3] Shukrimi AB, Afizah MH, Schmitt JF, et al. Mesenchymal stem cell therapy for injured growth plate. Front Biosci (Schol Ed) 2013;5:774e85. [4] de Vries IJ, Lesterhuis WJ, Barentsz JO, et al. Magnetic resonance tracking of dendritic cells in melanoma patients for monitoring of cellular therapy. Nat Biotechnol 2005;23:1407e13. [5] Rajagopal K, Chilbule SK, Madhuri V. Viability, proliferation and phenotype maintenance in cryopreserved human iliac apophyseal chondrocytes. Cell Tissue Bank, 2013. [6] Muinos-Lopez E, Rendal-Vazquez ME, Hermida-Gomez T, et al. Cryopreservation effect on proliferative and chondrogenic potential of human chondrocytes isolated from superficial and deep cartilage. Open Orthop J 2012;6:150e9. [7] Lee JI, Sato M, Kim HW, et al. Transplantatation of scaffoldfree spheroids composed of synovium-derived cells and chondrocytes for the treatment of cartilage defects of the knee. Eur Cells Mater 2011;22:275e90. discussion 290.
1149 [8] Seddighi MR, Griffon DJ, Schaeffer DJ, et al. The effect of chondrocyte cryopreservation on cartilage engineering. Vet J 2008;178:244e50. [9] Rendal-Vazquez ME, Maneiro-Pampin E, RodriguezCabarcos M, et al. Effect of cryopreservation on human articular chondrocyte viability, proliferation, and collagen expression. Cryobiology 2001;42:2e10. [10] Barbero A, Ploegert S, Heberer M, et al. Plasticity of clonal populations of dedifferentiated adult human articular chondrocytes. Arthritis Rheum 2003;48:1315e25. [11] Mamidi MK, Nathan KG, Singh G, et al. Comparative cellular and molecular analyses of pooled bone marrow multipotent mesenchymal stromal cells during continuous passaging and after successive cryopreservation. J Cell Biochem 2012;113:3153e64. [12] Sekiya I, Muneta T, Koga H, et al. [Articular cartilage regeneration with synovial mesenchymal stem cells]. Clin Calcium 2011;21:879e89. Japanese. [13] Gullo F, de Bari C. Prospective purification of a subpopulation of human synovial mesenchymal stem cells with enhanced chondro-osteogenic potency. Rheumatology (Oxford) 2013;52: 1758e68. [14] Koga H, Shimaya M, Muneta T, et al. Local adherent technique for transplanting mesenchymal stem cells as a potential treatment of cartilage defect. Arthritis Res Ther 2008;10. R84. [15] Shimizu T, Akahane M, Ueha T, et al. Osteogenesis of cryopreserved osteogenic matrix cell sheets. Cryobiology 2013;66: 326e32. [16] Otte A, Bucan V, Reimers K, et al. Mesenchymal stem cells maintain long-term in vitro stemness during explant culture. Tissue Eng Part C Methods 2013;19:937e48.
Regenerative Medicine Laboratory, Center for Stem Cell Research, Department of Biomedical Science and Technology, Institute of Biomedical Science and Technology (IBST), Konkuk University, Seoul, Republic of Korea; bDepartment of Regenerative Medicine, Yokohama City University Graduate School of Medicine, Yokohama, Japan; and cPRESTO, Japan Science and Technology Agency, Kawaguchi, Japan
ABSTRACT Autologous chondrocyte transplantation (ACT) is an effective and safe therapy for repairing articular cartilage defects and requires cell preservation and subculture before transplantation. We compared the effects of cryopreservation and passaging on cell viability, proliferation, and maintenance of the function of chondrocytes and synoviumderived mesenchymal stem cells (MSCs) used as sources for ACT. These cells were isolated from the knee joints of rabbits and were cultured, passaged serially, and divided into 2 groups that were either cryopreserved or not. The morphology, viability, gene expression, and differentiation potential of the 2 groups were compared. Maintenance of the potential to undergo chondrogenic differentiation was determined with the use of a 3-dimensional culture method. Passaging and cryopreservation significantly affected the ability of chondrocytes to maintain their morphology, express chondrogenic genes, and differentiate. In contrast, synovium-derived cells were not affected by passaging and cryopreservation. Our results may serve as the foundation for the application of passaged and cryopreserved chondrocyte or other source cells of MSCs in ACT.
C
ELLS that are obtained from autologous, homologous, or heterologous tissues may undergo phenotypic changes by proliferation or selection methods in vitro. Many clinical studies have focused on the application of cell therapy to the treatment of a variety of diseases affecting systems such as the circulatory, nervous, and musculoskeletal systems [1e3]. One strategy involves injecting the cells directly [4]. This has succeeded in reducing patients’ fears and the inconvenience faced with the use of other modalities. However, cell therapy has a number of limitations that must be addressed, such as preservation and subculture of cells in numbers that are sufficient for transplantation [5]. However, these techniques may cause cells to lose their specific phenotype, including proliferation and viability [5,6]. Defects in articular cartilage are difficult to treat because it has limited ability for self-repair [6,7]. Intensive long-term research designed to overcome these difficulties has failed to establish an effective and safe treatment. Various methods have been used to repair articular cartilage
damage, including arthroscopic debridement, bone marrow stimulation, osteochondral mosaicplasty, and autologous chondrocyte transplantation (ACT) [8]. ACT, as its name implies, uses the patient’s chondrocytes and has generated increasing interest among researchers [5,9]. However, chondrocytes may undergo dedifferentiation and lose their chondrocytic characteristics during monolayer culture and cryopreservation before transplantation [5,8,10], Therefore, mesenchymal stem cells (MSCs) have been commonly used as alternative sources for chondrocytes in a number of cell therapies [11,12]. The synovium-derived MSCs from
Funding: Basic Science Research Program, through the National Research Foundation of Korea (NRF) funded by the Ministry of Education, Science, and Technology (2010-0024188). *Address correspondence to Jeong Ik Lee, DVM, PhD, DVetMedSci, DMed, Konkuk University, 120 Neungdong-ro (Hwayang-dong), Gwangjin-gu, Seoul 143-701, Korea. E-mail: [email protected]
Crown Copyright ª 2014 Published by Elsevier Inc. All rights reserved. 360 Park Avenue South, New York, NY 10010-1710 Transplantation Proceedings, 46, 1145e1149 (2014)
0041-1345/14/$esee front matter http://dx.doi.org/10.1016/j.transproceed.2013.11.117 1145
1146
articular cartilage synovium have high potential to differentiate into mesenchymal lineages of joint components, including cartilages and bones [7,12,13]. The main purpose of the present study was to compare the effects of cryopreservation and passaging on cell viability, proliferation, and maintenance of function on chondrocytes and synovium-derived cells intended for use as sources for ACT (Fig 1).
MATERIALS AND METHODS Tissue Harvest and Cell Isolation The animal experiments were approved by Konkuk University and performed according to its guidelines on animal use (KU13003). Cartilage and synovium were harvested from the knee joints of 7week-old male New Zealand white rabbits (Samtako, Osan, Korea). The harvested tissues were minced and digested with 3 mg/mL type 1 collagenase (Worthington Biochemical Co, USA) in Dulbecco Modified Eagle Medium:eNutrient Mixture F-12 (DMEM/ F12; 1:1, Ham, Gibco, USA) containing 1% antibiotics-antimycotics (AA; Gibco), and were subsequently incubated at 37 C for 5 hours in a shaking water bath in an atmosphere containing 5% CO2. The chondrocytes from the digested tissues were cultured in DMEM/ F12 containing 1% AA, 10% fetal bovine serum (FBS; Gibco), and 1% ascorbic acid (50 mg/mL; Sigma-Aldrich, USA) at 37 C in an
Fig 1. Experimental design.
NAM, KIM, JO ET AL atmosphere containing 5% CO2, and the synovium-derived cells were cultured in DMEM/F12 containing 1% AA and 10% FBS at 37 C in an atmosphere containing 5% CO2. Each cell culture was passaged at a density of 2 104 cells/cm2.
Three-Dimensional (3D) Culture and Differentiation Pellets were obtained from a 3D culture system with the use of serially passaged fresh or cryopreserved cells. The pellets were prepared by seeding 5 105 cells in a 15-mL tube and centrifuging them at 1,600 rpm for 5 minutes. The supernates were discarded and replaced with chondrogenesis differentiation media (DMEMHG, FBS, 100 mmol/L dexamethasone, 50 mmol/L ascorbate-2phosphate [Sigma-Aldrich], insulin-transferrin-selenium [Gibco], and 5 ng/mL transforming growth factor b1 [Sigma-Aldrich]) for 3 weeks.
Cryopreservation Cells were cultured in 150-mm-diameter dishes at an initial density of 2 104 cells/cm2. The cells were treated with 0.25% trypsinEDTA (Gibco), and harvested twice with the use of complete media and phosphate-buffered saline solution (PBS) and then washed with PBS. The cells were then preserved in 1 mL of a commercial preservation solution, Cell Banker (Zenoaq, Fukushima, Japan), in cryogenic vials. Cryovials were placed in a cryofreezing container and then transferred to a 80 C freezer for 1 week.
CRYOPRESERVATION AND CELL PASSAGE NUMBER
Cell Viability and Proliferation Cell viability and proliferation rates were evaluated with the use of 1-(4,5-dimethylthiazol-2-yl)-3,5-diphenyl-formazan (MTT formazan) solution (5 mg/mL in PBS; Sigma-Aldrich). After 3 days, the cells were seeded; then, MTT formazan solution was added to each well and the mixture incubated for 30 minutes. The optical density of the cells was measured at 540 nm with the use of a spectrophotometer, Spectra Max 190 (Molecular Devices, USA). Cells were counted with the use of a hemocytometer with trypan blue (Gibco).
1147
RESULTS Cell Viability
Our data showed that serial passaging and cryopreservation did not affect the viabilities of chondrocytes and synoviumderived cells as determined by the results of MTT assay and a trypan blue cell counting assay (Fig 2). Although the number of cells decreased after passaging, the difference was not statistically significant (data not shown). Similarly, cryopreservation did not affect cell viability (Fig 2).
DNA Quantification and Glycosaminoglycan (GAG) Assay Pellets were used for GAG determination with the use of the Blyscan sulfated glycosaminoglycan assay (Biocolor, United Kingdom) following the manufacturer’s protocol. The remaining contents were used for quantification of DNA. The DNA (mg/mL) content was measured with the use of a Nanodrop ND-1000 Spectrophotometer (Nanodrop Technologies, USA). The final concentration of GAG in each sample was determined by dividing the GAG level in the supernate by the corresponding DNA concentration.
Levels of Chondrogenic Gene Expression in Passaged and Cryopreserved Cells
We determined whether the cells maintained their chondrocytic potential by determining the levels of mRNA encoding the chondrocyte markers Aggrecan (ACAN), collagen type II alpha 1 (COL2A1), and sex-determining region box 9 (SOX-9). Their mRNA expression levels decreased as the cells were passaged. However, no
RNA Isolation and Reverse-Transcription Polymerase Chain Reaction (RT-PCR) Total RNA was isolated from passaged fresh and cryopreserved chondrocyte and synovium-derived cells with the use of TRI reagent TR118 (Molecular Research Center, USA). Complementary DNA (cDNA) was synthesized with the use of M-MLV reverse transcriptase (Elpis Biotech, Daejeon, Korea) according to the manufacturer’s protocols. Template cDNA, w100 pg total RNA, was mixed with Accupower Taq PCR Premix (Bioneer, Daejeon, Korea) and 5 pmol each of the forward and reverse primers in a final volume of 20 mL. Amplification was performed with the use of a 7500 PCR system (Applied Biosystems, USA) with the following protocol and the primers listed in Table 1: denaturation at 95 C for 7 minutes and 25 cycles each of 95 C for 30 seconds, 60 C for 30 seconds, and 72 C for 30 seconds.
Statistical Analysis One-way analysis of variance (Graphpad Prism 5 for Windows; Graphpad, USA) was used to assess the correlations between the fresh and cryopreserved groups. P values of <.05 were considered to be statistically significant. Table 1. Reverse-Transcription Polymerase Chain Reaction Primers Primers
Aggrecan Forward Reverse COL2A1 Forward Reverse SOX9 Forward Reverse GAPDH Forward Reverse
Sequence
Amplicon Size
GCTACGGAGACAAGGATGAGTTC CGTAAAAGACCTCACCCTCCAT
114 bp
CCTGTGCGACGACATAATCTGT GGTCCTTTAGGTCCTACGATATCCT
177 bp
GGCTCCGACACCGAGAATAC TCCGGGTGGTCTTTCTTGTG
395 bp
TCACCATCTTCCAGGAGCGA CACAATGCCGAAGTGGTCGT
304 bp
Fig 2. Evaluation of the cell viability of (A) chondrocytes and (B) synovium-derived cells that were passaged and cryopreserved. P, passage.
1148
significant differences were detected between the levels of these mRNAs in fresh and cryopreserved cells (Fig 3). Quantification of GAG Content
Chondrocytes that were not cryopreserved had a higher GAG expression level than those that were cryopreserved (Fig 4A). Furthermore, GAG secretion by chondrocytes decreased during serial passage. However, GAG secretion by synovium-derived cells was not affected by cryopreservation and passaging (Fig 4B). DISCUSSION
Articular cartilage is normally exposed to exogenous physical and mechanical stress. Forces exerted on joints can exceed the limits of cartilage structures, causing their corrosion and loss of components from solid surfaces [6]. Most efforts to repair an articular cartilage injury have been aimed at overcoming the limitations of the use of this tissue for healing by the introduction of new cells with chondrogenic potential [8,12,14]. However, none of these treatments efficiently regenerated the damaged hyaline cartilage. Cell therapy is a promising clinical approach to regenerate damaged tissues. ACT is an effective and safe cell-based therapy for repairing articular cartilage defects [8]. However, this therapeutic strategy requires preservation and subculture of cells for the secondary injection [5]. Chondrocytes and MSCs are used as sources for ACT [11,12], These stem cells can either be continuously cultured in vitro or cryopreserved, which decreases the proliferative potential and phenotypic stability [9]. Therefore, in the present study, we investigated the effects of cryopreservation and culturing on cell viability, proliferation, and maintenance of function of chondrocyte and synoviumderived cells as sources for ACT. We confirmed that synovium-derived cells are MSCs that have a higher proliferation and the ability to differentiate into osteoblasts, adipocytes, and chondrocytes. These cells strongly expressed MSC markers (data not shown). Our data show that culturing, but not cryopreservation, significantly affected the expression of chondrogenic genes, including those encoding AGGRECAN, COL2A1, and
Fig 3. Effects of passage (P) number and cryopreservation on the mRNA expression levels of chondrogenic genes of chondrocytes cultured as monolayers.
NAM, KIM, JO ET AL
SOX9, which mediate the phenotypic stability and the differentiation potential of chondrocytes. We also found that cell culture and cryopreservation significantly changed the morphology of chondrocytes but did not affect their viabilities or proliferation rates. A number of studies have focused on the type and length of cell preservation [8,9,15]. In contrast, we investigated the effects of cryopreservation during a shorter period (1 wk). Our results showed that passage 2 or passage 3 chondrocytes maintained their specific phenotype (Fig 4) and superior viability rates compared with passage 1 cells (Fig 2). These data suggest that cell phenotype stabilized during passages 2 and 3. However, synovium-derived cells were not affected by passaging or cryopreservation. Recent reports have shown that MSCs have a “memory” of proliferation and differentiation that is not affected by cryopreservation [11] and maintain their stem cell characteristics during passaging in an in vitro culture system [16]. In summary, the present study demonstrated that cryopreservation and passaging affects chondrocytes but not
Fig 4. Quantification of glycosaminoglycan expression after passaging fresh and cryopreserved cells. (A) Chondrocytes and (B) synovium-derived cells cultured with the use of a 3D (pellet) method. P, passage.
CRYOPRESERVATION AND CELL PASSAGE NUMBER
synovium-derived cell qualitatively rather than quantitatively. Moreover, in the case of preparation for ACT, passage 2 or passage 3 chondrocytes were determined to be the optimal source for transplantation. REFERENCES [1] Raval Z, Losordo DW. Cell therapy of peripheral arterial disease: from experimental findings to clinical trials. Circ Res 2013;112:1288e302. [2] Miller RH, Bai L. Translating stem cell therapies to the clinic. Neurosci Lett 2012;519:87e92. [3] Shukrimi AB, Afizah MH, Schmitt JF, et al. Mesenchymal stem cell therapy for injured growth plate. Front Biosci (Schol Ed) 2013;5:774e85. [4] de Vries IJ, Lesterhuis WJ, Barentsz JO, et al. Magnetic resonance tracking of dendritic cells in melanoma patients for monitoring of cellular therapy. Nat Biotechnol 2005;23:1407e13. [5] Rajagopal K, Chilbule SK, Madhuri V. Viability, proliferation and phenotype maintenance in cryopreserved human iliac apophyseal chondrocytes. Cell Tissue Bank, 2013. [6] Muinos-Lopez E, Rendal-Vazquez ME, Hermida-Gomez T, et al. Cryopreservation effect on proliferative and chondrogenic potential of human chondrocytes isolated from superficial and deep cartilage. Open Orthop J 2012;6:150e9. [7] Lee JI, Sato M, Kim HW, et al. Transplantatation of scaffoldfree spheroids composed of synovium-derived cells and chondrocytes for the treatment of cartilage defects of the knee. Eur Cells Mater 2011;22:275e90. discussion 290.
1149 [8] Seddighi MR, Griffon DJ, Schaeffer DJ, et al. The effect of chondrocyte cryopreservation on cartilage engineering. Vet J 2008;178:244e50. [9] Rendal-Vazquez ME, Maneiro-Pampin E, RodriguezCabarcos M, et al. Effect of cryopreservation on human articular chondrocyte viability, proliferation, and collagen expression. Cryobiology 2001;42:2e10. [10] Barbero A, Ploegert S, Heberer M, et al. Plasticity of clonal populations of dedifferentiated adult human articular chondrocytes. Arthritis Rheum 2003;48:1315e25. [11] Mamidi MK, Nathan KG, Singh G, et al. Comparative cellular and molecular analyses of pooled bone marrow multipotent mesenchymal stromal cells during continuous passaging and after successive cryopreservation. J Cell Biochem 2012;113:3153e64. [12] Sekiya I, Muneta T, Koga H, et al. [Articular cartilage regeneration with synovial mesenchymal stem cells]. Clin Calcium 2011;21:879e89. Japanese. [13] Gullo F, de Bari C. Prospective purification of a subpopulation of human synovial mesenchymal stem cells with enhanced chondro-osteogenic potency. Rheumatology (Oxford) 2013;52: 1758e68. [14] Koga H, Shimaya M, Muneta T, et al. Local adherent technique for transplanting mesenchymal stem cells as a potential treatment of cartilage defect. Arthritis Res Ther 2008;10. R84. [15] Shimizu T, Akahane M, Ueha T, et al. Osteogenesis of cryopreserved osteogenic matrix cell sheets. Cryobiology 2013;66: 326e32. [16] Otte A, Bucan V, Reimers K, et al. Mesenchymal stem cells maintain long-term in vitro stemness during explant culture. Tissue Eng Part C Methods 2013;19:937e48.