- Email: [email protected]
Effect of oocyte vitrification on deoxyribonucleic acid methylation of H19, Peg3, and Snrpn differentially methylated regions in mouse blastocysts
ORIGINAL ARTICLE: REPRODUCTIVE BIOLOGY
Effect of oocytes vitrification on deoxyribonucleic acid methylation of H19, Peg3, and Snrpn differentially methylated regions in mouse blastocysts Ke-Ren Cheng, Ph.D.,a Xiang-Wei Fu, Ph.D.,a Rui-Na Zhang, Ph.D.,a Gong-Xue Jia, Ph.D.,a Yun-Peng Hou, Ph.D.,b and Shi-En Zhu, Ph.D.a a Key Laboratory of Animal Genetics, Breeding and Reproduction, Ministry of Agriculture and National Engineering Laboratory for Animal Breeding, College of Animal Science and Technology; and b State Key Laboratory for Agro Biotechnology, College of Biological Sciences, China Agricultural University, Beijing, People's Republic of China
Objective: To examine whether mouse oocytes vitrification could alter the deoxyribonucleic acid (DNA) methylation of differentially methylated regions (DMRs) of three imprinted genes in in vitro fertilized blastocysts. Design: In vitro experiments using murine model. Setting: State key laboratory and university research laboratory. Animal(s): Kunming white mice. Intervention(s): The mouse metaphase II oocytes were vitrified. After thawing, the surviving oocytes were fertilized in vitro to produce blastocysts. The blastocysts derived in vitro from fresh oocytes were used as a control. The DNA methylation patterns of the DMRs of imprinted genes in oocytes and blastocysts and the relative expression of DNMTs (Dnmt1, Dnmt3a, Dnmt3b, and Dnmt3l) in oocytes and blastocysts were detected. Main Outcome Measure(s): Methylation patterns of DMRs of H19, Peg3, and Snrpn analyzed by bisulfite mutagenesis and sequencing. Expression levels of messenger ribonucleic acid as measured by real-time reverse-transcriptase polymerase chain reaction. Result(s): After oocytes vitrification, the methylation levels at H19, Peg3, and Snrpn DMRs in blastocysts were decreased. However, there was no significant difference in the percentage of hypermethylated strands at Peg3 DMRs between the vitrified and control groups. DNMTs expression in vitrified oocytes and the expression of Dnmt3b in blastocysts derived from vitrified oocytes were significantly reduced. Conclusion(s): Oocytes vitrification could lead to the loss of DNA methylation of imprinted genes (H19, Peg3, and Snrpn) in mouse blastocysts, which is mainly caused by the reductions Use your smartphone of DNMTs after vitrification of oocytes. (Fertil SterilÒ 2014;-:-–-. Ó2014 by American to scan this QR code Society for Reproductive Medicine.) and connect to the Key Words: Vitrification, mouse oocyte, blastocyst, DNA methylation, DNMTs Discuss: You can discuss this article with its authors and with other ASRM members at http:// fertstertforum.com/chengkr-mouse-oocytes-vitrification-dna-methylation-dmrs/
G
enomic imprinting is an epigenetic mechanism of transcriptional regulation that results in monoallelic expression of a subset
of mammalian genes (1). Genomic imprinting is a multi-step and sexspecific process. In mice, most imprints are erased when primordial germ cells
Received March 3, 2014; revised June 21, 2014; accepted June 23, 2014. K.-R.C. has nothing to disclose. X.-W.F. has nothing to disclose. R.-N.Z. has nothing to disclose. G.-X.J. has nothing to disclose. Y.-P.H. has nothing to disclose. S.-E.Z. has nothing to disclose. Reprint requests: Shi-En Zhu, Ph.D., College of Animal Science and Technology, China Agricultural University, No.2 West Yuanmingyuan Road, Beijing 100193, People's Republic of China (E-mail: [email protected]). Fertility and Sterility® Vol. -, No. -, - 2014 0015-0282/$36.00 Copyright ©2014 American Society for Reproductive Medicine, Published by Elsevier Inc. http://dx.doi.org/10.1016/j.fertnstert.2014.06.037 VOL. - NO. - / - 2014
discussion forum for this article now.*
* Download a free QR code scanner by searching for “QR scanner” in your smartphone’s app store or app marketplace.
enter the genital ridge at embryonic day (E) 11.5. Depending on the sex of developing germ cells, a select group of genes will be re-imprinted later. In the male germline, H19 methylation imprints are initiated in fetal germ cells and completed in pachytene spermatocytes. In females, Snrpn and Peg3 methylation imprints are acquired asynchronously in a genespecific manner, during the transition from primordial to antral follicles in 1
ORIGINAL ARTICLE: REPRODUCTIVE BIOLOGY the postnatal growth phase (2). Although global demethylation occurs after fertilization and continues until the first lineage segregation, when cells from the inner cell mass and trophectoderm are differentially methylated, both paternally and maternally imprinted genes retain methylation at their differentially methylated regions (DMRs) during this phase (3). In humans, studies on deoxyribonucleic acid (DNA) methylation of imprinted genes in preimplantation embryos are very limited for ethical reasons. However, available findings suggest that there is conservation of imprinting in mice and humans. For example, the mouse H19 gene maps to the distal segment of chromosome 7 (4), and it is parentally imprinted (5). H19 encodes a noncoding ribonucleic acid (RNA) and lies at the end of a cluster of imprinted genes (6). In humans, the H19 gene is located at chromosome 11p15.5, and its DMR is paternally methylated. Peg3 (paternally expressed gene 3) is the first imprinted gene detected in the proximal region of mouse chromosome 7 (7). Peg3 encodes a Kr€ uppel-type (C2H2) zinc finger–containing (ZNF) protein containing putative transcription factor activities (8, 9). Human chromosome 19q13.4 is synthetically homologous to mouse Peg3, where the genes for myotonic dystrophy and a putative tumor suppressor gene are located (7). Snrpn is a maternally imprinted gene in mouse, encoding a brain-enriched small nuclear ribonucleoprotein (snRNP)– associated polypeptide SmN, mapped to the central part of mouse chromosome 7 in a region of homology with human chromosome 15q11-13. These genes are of particular interest because of their important biological functions and the characteristic phenotypes associated with the absence of their gene products. Hypomethylation of H19 DMR contributes about 35%–65% of Silver–Russell syndrome cases (10). Snrpn maps in the Prader-Willi critical region, as a candidate gene involved in Prader-Willi and Angelman syndromes (11). The methylated base 5-methylcytosine typically occurs at CpG (cytosine and guanine connected by a phosphodiester bond) sites, which is not only the most widely investigated epigenetic marker associated with genomic imprinting but also one of the epigenetic modifications that regulates gene expression (12). CpG islands found at the promoters of imprinted genes are differentially methylated. These differentially methylated regions are called DMRs (13). DNA methylation is catalyzed by a family of DNA methyltransferases (DNMTs). In mammals, DNMTs include 5 members (DNMT1, DNMT2, DNMT3A, DNMT3B, and DNMT3L). The DNMT3A and DNMT3B are responsible for de novo CpGs methylation, whereas DNMT1 maintains this pattern during chromosome replication (14) and repair (15). DNMT3A and DNMT3B have no effect on maintenance of imprinted methylation patterns in early embryos (16). DNMT1 alone is sufficient to maintain the methylation marks of the imprinted genes during preimplantation development (17, 18). DNMT3L may cooperate with DNMT3A and DNMT3B methyltransferases to carry out de novo methylation of maternally imprinted genes during oogenesis (19). Cryopreservation of oocytes is an essential part of assisted reproductive technology (ART), which has been 2
more and more widely used for human ART, but is also used for the preservation of genetic resources in endangered species (20). Recently, an increasing number of studies have shown that oocyte vitrification may have an effect on the epigenetic modifications of preimplantation embryos, such as histone acetylation (21) and DNA methylation (22). Human oocytes vitrified at the germinal vesicle (GV) stage and in vitro matured (IVM) after thawing did not affect the methylation patterns of H19 DMR and KvDMR1 (23). However, cryopreservation altered the expression profile of human MII oocytes (24), and vitrification significantly decreased the expression of Dnmt1o mRNA in mouse MII oocytes (25). It has also been reported that vitrification of mouse blastocysts significantly decreased Oct4, Nanog, and Cdx2 promoter methylation in mouse blastocysts (26). Moreover, embryo vitrification aggravated the loss of methylation in the H19/Igf2 DMR (27). More studies are required to understand the effects of cryopreservation on genomic imprinting. The effect of oocyte vitrification on methylation of imprinted genes in blastocysts has not been investigated. To address this question, DNA methylation status at the DMRs of H19, Peg3, and Snrpn in the mouse blastocysts from vitrified oocytes was determined. The expression of the DNMTs (Dnmt1, Dnmt3a, Dnmt3b, and Dnmt3l) in the oocytes and blastocysts was also examined.
MATERIALS AND METHODS Unless otherwise indicated, all chemicals and media were purchased from Sigma-Aldrich. The protocols for the animal studies were approved by and performed in accordance with the requirements of the Institutional Animal Care and Use Committee of China Agricultural University.
Oocyte Collection Animals used in the study were Kunming white mice age 6–8 weeks (Academy of Military Medical Sciences, Beijing, China). One week after being housed in our animal facilities, mice were superovulated with 10 IU (intraperitoneal) equine chorionic gonadotropin (eCG; Ningbo Hormone Products Co.), followed 48 hours later by injection of 10 IU of human chorionic gonadotropin (hCG; Ningbo Hormone Products Co.). Thirteen hours after the hCG injection, cumulus-oocyte complexes were recovered in M2 medium supplemented with 4 mg/mL bovine serum albumin (BSA) from the ampulla of the oviducts. Cumulus cells were removed from oocytes with hyaluronidase (300 IU/mL) for 3–5 minutes in M2 medium. Only oocytes with normal morphology were used.
Oocyte Vitrification and Thawing The open-pulled straw (OPS) was made by the method described by Vajta with some modifications (28). Briefly, the straws (0.25 mL; IMV) were heat-softened and pulled manually to obtain a straw of approximately 2–3 cm in length, 0.05 mm in inner diameter, and 0.10 mm in outer diameter. The equilibration solution (ED solution) contained 10% ethylene glycol (EG) and 10% dimethylsulfoxide (DMSO) in VOL. - NO. - / - 2014
Fertility and Sterility® mPBS medium. The vitrification solution (EDFS30) contained 15% EG and 15% DMSO in FS solution (Modified PBS containing 300 mg/mL Ficoll, 171.2 g/L sucrose, and 3 mg/mL BSA). All manipulations were performed on a 37 C hot plate in a room at 25 C. Oocytes were pretreated in the equilibration solution for 30 seconds and then transferred to vitrification solution in the narrow end of the pulled straw and held for 25 seconds. The straws were then immediately plunged into liquid nitrogen (LN2). For thawing, oocytes were rinsed in 0.5 mol/L sucrose for 5 minutes, then rinsed three times in M2 medium and incubated in an incubator with 5% CO2, 37 C, and maximum humidity for 30 minutes before use.
IVF and Embryo Collection Oocytes in the fresh and vitrified groups were individually placed into 70-mL drops of human tubal fluid (HTF) medium (Millipore) under mineral oil, into which a 5-mL spermatozoa suspension was added for insemination. The final concentration was 5.0105 sperm/mL. Five hours after IVF, the eggs were removed from the fertilization drops, washed in KSOMaa medium (Millipore), and cultured in 70-mL drops of KSOMaa medium. Blastocysts were collected 96 hours after fertilization.
Bisulfite Sequencing Bisulfite treatment of oocyte DNA was carried out according to previous work, with slight modifications (29). Briefly, oocytes were incubated at 37 C in 0.5% pronase (Roche Diagnostics GmbH) in M2 for 3–5 minutes to remove the zona pellucida. Oocytes were collected into 7 mL 2% low–melting point agarose in a 1.5-mL tube, and the agarose was covered with chilled mineral oil for 10 minutes on ice to allow formation of beads. Then, 500 mL lysis buffer (1 mM SDS, 10 mM TisHCl, 100 mM ethylenediaminetetraacetic acid EDTA, 280 mg/mL proteinase K) was added into the tube and the beads were incubated at 50 C for 8 hours, followed by an equilibration against 0.3 M NaOH (500 mL) for 215 minutes at room temperature. Then the beads were equilibrated against 500 mL of freshly made bisulfite solution (2.5 M sodium metabisulfite, 125 mM hydroquinone; pH ¼ 5) at 50 C for 8 hours in the dark. The reactions were stopped by equilibrations against 1 mL Tris-EDTA (TE) buffer for 315 minutes. After desulfonation in 500 mL 0.3 M NaOH for 215 minutes, the beads were washed with TE for 215 minutes and H2O for 215 minutes and then either used immediately for polymerase chain reaction (PCR) or stored at 20 C. Groups of embryos were directly subjected to bisulfite conversion by using the EZ DNA Methylation Direct Kit (Zymo Research). For each group, the number of blastocysts used for bisulfite conversion each time was about 50. Nested PCR was performed using methylation-specific DNA polymerase (Tiangen) or HotMaster DNA polymerase (Tiangen). The sequences of the PCR primers and PCR conditions are listed in Supplemental Table 1 (available online). Both the first- and second-round PCRs were performed under the following conditions: 2 minutes at 95 C, followed by 30 cycles of PCR consisting of 30 seconds VOL. - NO. - / - 2014
at 94 C, 30 seconds at annealing temperatures, and 1 minute at 72 C. The PCR products were separated by electrophoresis in 1% agarose gel, and correct bands were excised from the gel and purified with QIAquick Gel Extraction Kit (Qiagen). Then, the purified DNA was cloned into a pDM18-T Vector (TaKaRa) according to the manufacturer's instructions. The positive clones were obtained by antibiotic selection, and the insert was sequenced by SunBiotech. The sequencing data were analyzed using an online tool QUMA (30). Methylation levels were determined by calculating the number of methylated CpGs/total number of CpGs for each individual CpG site as a percentage. Clones with >50% of the CpGs methylated were considered hypermethylated.
RNA Purification and Quantitative Real-Time PCR RNA was extracted from 100 oocytes or 50 blastocysts utilizing TRIzol reagent (Invitrogen) according to the manufacturer's instructions. The first cDNA strand was synthesized using a cDNA reverse transcription kit (High-Capacity cDNA Reverse Transcription kit; Applied Biosystems). Quantitative realtime PCR was carried out using the CFX96TM Real-Time PCR Detection System (Bio-Rad) under standard conditions. At least triple samples were analyzed for each gene, and 18s was used as a reference gene. The expression levels were calcuOOCt ) method (29). The lated using the comparative Ct (2 primers are shown in Supplemental Table 2 (available online).
Statistical Analysis Each experiment was repeated at least 3 times. Data are presented as mean standard error. The proportions of hypermethylated clones among different groups were determined to be normally distributed, with homogeneity of variance. The significance between groups was compared by one-way ANOVA using SPSS 20.0 software. P< .05 was considered statistically significant.
RESULTS Effect of Oocyte Vitrification on Methylation Patterns of Imprinted Genes in Oocytes To identify whether oocyte vitrification could influence the DNA methylation patterns of imprinted genes in oocytes, the regions including 15 CpGs located in the H19 DMR, 18 CpGs located in the Peg3 DMR, and 16 CpGs located in the Snrpn DMR were analyzed. The Peg3 and Snrpn DMRs acquire maternal-specific methylation during oogenesis, whereas the H19 DMR acquires paternal-specific methylation during spermatogenesis (31). Figure 1 shows one example of the bisulfite sequencing analysis of the DMRs in H19, Peg3, and Snrpn. There were no statistically significant differences between the fresh and vitrified oocytes 0.5 hours after thawing.
Effect of Oocyte Vitrification on Methylation Patterns of Imprinted Genes in Blastocysts To determine the effects of vitrification on imprint maintenance, methylation patterns of imprinted genes in blastocysts were analyzed. As shown in Figure 2, the overall methylated 3
ORIGINAL ARTICLE: REPRODUCTIVE BIOLOGY
FIGURE 1
Representative methylation status of H19, Peg3, and Snrpn differentially methylated regions in oocytes. Each row represents a unique DNA clone; filled and open circles represent methylated and unmethylated CpGs, respectively. Cheng. Vitrification of mature oocytes. Fertil Steril 2014.
CpGs percentages of all three genes in the vitrified oocyte groups were lower than those of the fresh oocyte groups. The H19 methylation levels in the fresh and vitrified groups were 32.15% and 30.97%, respectively. The Peg3 methylation levels in the fresh and vitrified groups were 35.38% and 30.19%, respectively. The Snrpn methylation levels were 35.48% and 18.11% for the fresh and vitrified groups, respectively.
Dnmt3b, and Dnmt3l in oocytes by quantitative real-time PCR. As shown in Figure 3A, after oocyte vitrification and thawing, the relative expression levels of DNMTs were significantly decreased (P< .05).
Percentages of Hypermethylated Clones in the Imprinted Genes of Fresh and Vitrified Groups
To further study whether the expression of DNMTs would return to the normal level, we performed the relative expression analysis of DNMTs in blastocysts. As shown in Figure 3B, the relative expression of Dnmt3b mRNA in blastocysts in the vitrified group was lower (P< .05). There were no significant differences in the relative abundance of Dnmt1, Dnmt3a, and Dnmt3l between the vitrified and fresh groups (P>.05).
As shown in Table 1, the proportion of hypermethylated clones of H19 (16.67% 2.38%) in the vitrified groups was significantly lower than that in the fresh groups (35.56% 2.22%) (P< .05). For Peg3 and Snrpn, there were no significant differences between the two groups. Clones with >50% of the CpGs methylated were considered hypermethylated, as suggested elsewhere (32).
Relative Expression Levels of DNMTs in Mouse MII Oocytes after Vitrification To investigate if DNMTs were affected by vitrification, we determined the relative expression of Dnmt1, Dnmt3a, 4
Effect of Vitrification on the Relative Expression Levels of DNMTs in Blastocysts
DISCUSSION In humans, assisted reproduction has been linked to the generation of epigenetic errors that may result in the development of the human imprinting disorders such as Prader-Willi and Angelman Syndromes and BeckwithWeidemann Syndrome. Multiple studies have examined the association of ARTs and imprinting. Some reports have VOL. - NO. - / - 2014
Fertility and Sterility®
FIGURE 2
Methylation status of H19, Peg3, and Snrpn differentially methylated regions in blastocysts derived from fresh and vitrified oocytes. (A) H19; (B) Peg3; (C) Snrpn. Each row represents a unique methylation profile within the pool of clones sequenced. Filled and open circles represent methylated and unmethylated CpGs, respectively. The percentage on the right of the strand represents the proportion of strand with that phenotype. N represents the total number of selected clones. Cheng. Vitrification of mature oocytes. Fertil Steril 2014.
postulated that Beckwith-Weidemann Syndrome is linked to more-specific procedures such as IVF/intracytoplasmic sperm injection (ICSI; 33) or ovarian stimulation (34). Hypomethylation of H19 DMR has been reported in 18.7% of the preimplantation IVF embryos (35). Good-quality cryopreserved blastocysts donated for research showed a lower-than-expected methylation level (36), suggesting that there is a possible link between ART and H19 imprinting
TABLE 1 The proportion (% ± standard error) of hypermethylated clones of imprinted genes in blastocysts. H19
Oocyte treatment Fresh Vitrified
Peg3
35.56 2.22 36.67 3.33 16.67 2.38 30 10.00
Snrpn 41.94 11.69 10.00 5.77
Note: The values for fresh vs. vitrified are significantly different for H19 (P< .05). Hypermethylation means that at least 50% CpGs are methylated in a strand. Cheng. Vitrification of mature oocytes. Fertil Steril 2014.
VOL. - NO. - / - 2014
disorder (37). However, low-level imprinting errors and global disruption of methylation were not commonly observed in IVF children (38). In mice studies, such as ovulation induction (39) and embryo culture (40, 41), designed to validate epigenetic effect in response to IVF/ICSI, H19 is also most frequently involved. IVF might cause aberrant DNA methylation in the Igf2-H19 gene region (42), and abnormal imprinting of the Kcn1ot gene at the morula and blastocyst stages in the mouse (37). All the above show that the epigenetic disruption caused by ART is related to imprinted genes. Likewise, stress induced by oocyte vitrification can affect the oocyte's ability to synthesize and store sufficient amounts of maternal factors such as mRNA of DNMTs, which may perturb genomic imprinting during embryo development. For cryopreservation of oocytes/embryos, more studies are required to understand the effects of cryogenic technologies on genomic imprinting. Mice that were produced following whole-ovary cryopreservation maintained normal H19 and Kcnq1ot1 methylation ratios (43). Vitrification of 5
ORIGINAL ARTICLE: REPRODUCTIVE BIOLOGY
FIGURE 3
(A) Relative expression levels of DNMT mRNA in fresh and vitrified oocytes after thawing. In Dnmt3l, the error bars are too small to be observed. (B) Relative expression levels of DNMT mRNA in blastocysts derived from fresh and vitrified oocytes. Different superscripts represent statistically significant differences between groups (P<.05). Cheng. Vitrification of mature oocytes. Fertil Steril 2014.
mouse prenatal follicles followed by long-term IVM to GV oocytes led to Snrpn loss of methylation but not Igf2r loss of methylation or H19 gain of methylation (44). Oocytes (22) and embryo vitrification (27) could affect embryo DNA methylation too. In women, the maternal methylation imprints become fully established by the fully grown oocyte stage (45); vitrification of human GV oocytes followed by short-term IVM resulted in H19 gain of methylation in MII oocyte pools (23). Our results showed that MII oocyte vitrification did not alter the methylation patterns of imprinted genes in oocytes. However, loss of methylation of imprinted genes in blastocysts derived from vitrified oocytes was found. Thus, more studies are required to understand the effects of oocyte vitrification on genomic imprinting. Some studies suggest that MII oocytes do not undergo DNA replication and DNA methylations (46). Indeed, previous work revealed that vitrification does not alter the methylation patterns of the promoter CpG islands in Dnmt1o, Hat1, or Hdac1 in mouse MII oocytes (25). The methyl group is very stable, which means that it needs a specific enzyme to open the chemical bond and cannot be affected by vitrification. During oocyte cryopreservation, extrusion of water surrounding mRNA could generate mRNA unfolding and facilitate RNAase access, leading to lysis of molecules (47). Thus, the vitrification of oocytes at the metaphase II stage can reduce the expression of Dnmt1o, histone acetyltransferase 1, and deacetylase 1 mRNA (25). Consistent with previous studies, our present work showed that the transcript abundance of DNMTs decreased after oocyte vitrification, which might affect the maintenance of DNA methylation of imprinted genes. During the process of cooling and thawing, the loss of related mRNAs, which are stored in mature oocytes, and epigenetic modification would inevitably have implications for epigenetic inheritance during early embryonic development. Thus, mRNA abundance decreased in oocytes after thawing, causing potential disturbance of the imprinting in the preimplantation embryo. The inheritance of genomic imprints was strictly due to the embryonic maintenance of DNA methylation. Such maintenance occurs in association with every cycle of DNA 6
replication, including those of preimplantation embryos. Especially during the preimplantation stage, histone modification and DNA methylation of imprinted genes, once lost, would be difficult to recover (48). Theoretically, the DNA methylation patterns of imprinted genes are constant during preimplantation embryo development. Pluripotency-associated protein 3 (DPPA3/Stella/PGC7) protects the maternal genome and imprinted genes from active demethylation by binding to H3K9me2, inhibiting 5-methylcytosine conversion to 5 hydroxymethylcytosine from tubal embryo transfer–mediated demethylation. The major function of these transfers is oxidization of 5-methylcytosine (49). Also, zinc finger protein (ZFP)57, along with its cofactor tripartite motif containing 28 (TRIM28; KRAB-associated protein 1 [KAP1]), maintains both maternal and paternal imprints (50). Regarding imprinted genes, DNMT1 alone is sufficient to maintain the methylation marks of the imprinted genes (18). However, zygotic DNMT3B is required for the methylation maintenance at Rasgrf1 in preimplantation embryos (17). Our results demonstrated that in vitrified oocytes after fertilization, expression of some DNMTs could generally return to normal levels in blastocysts. However, oocyte vitrification significantly affected the expression of Dnmt3b in blastocysts. We preferred that reduction of abundance of DNMTs caused by oocyte vitrification lead to reduced maintenance of DNA methylation of imprinted genes during DNA replication, and it is analogous to passive DNA demethylation. In conclusion, the vitrification of mouse MII oocytes can lead to a loss of DNA methylation of imprinted genes in blastocysts. This loss is most likely because of a reduction in the abundance of DNMTs in oocytes after vitrification. Understanding the effect of oocyte vitrification on DNA methylation of imprinted genes still requires more detailed studies. Acknowledgments: This work was supported by the Specialized Research Fund for the Doctoral Program of Higher Education (SRFDP) (No. 20120008110001) and the National Natural Science Foundation Project of China VOL. - NO. - / - 2014
Fertility and Sterility® (No. 31372307). The authors thank Dr. Guang-Bing Zhou (Sichuan Agricultural University), Dr. Qi-En Yang (Washington State University), and Nature Publishing Group Language Editing (NPG Language Editing) for proofreading of the article.
REFERENCES 1.
2.
3.
4. 5. 6.
7.
8. 9. 10.
11.
12. 13. 14. 15.
16.
17.
18.
19.
20.
21.
Verona RI, Mann MR, Bartolomei MS. Genomic imprinting: intricacies of epigenetic regulation in clusters. Annu Rev Cell Dev Biol 2003;19: 237–59. Saitou M, Kagiwada S, Kurimoto K. Epigenetic reprogramming in mouse pre-implantation development and primordial germ cells. Development 2012;139:15–31. Lepikhov K, Wossidlo M, Arand J, Walter J. DNA methylation reprogramming and DNA repair in the mouse zygote. Int J Dev Biol 2010; 54:1565–74. Searle AG, Beechey CV. Noncomplementation phenomena and their bearing on nondisjunctional effects. Basic Life Sci 1985;36:363–76. Bartolomei MS, Zemel S, Tilghman SM. Parental imprinting of the mouse H19 gene. Nature 1991;351:153–5. Leighton PA, Ingram RS, Eggenschwiler J, Efstratiadis A, Tilghman SM. Disruption of imprinting caused by deletion of the H19 gene region in mice. Nature 1995;375:34–9. Kuroiwa Y, Kaneko-Ishino T, Kagitani F, Kohda T, Li LL, Tada M, et al. Peg3 imprinted gene on proximal chromosome 7 encodes for a zinc finger protein. Nat Genet 1996;12:186–90. El-Baradi T, Pieler T. Zinc finger proteins: what we know and what we would like to know. Mech Dev 1991;35:155–69. Pieler T, Bellefroid E. Perspectives on zinc-finger protein function and evolution—an update. Mol Biol Rep 1994;20:1–8. Abu-Amero S, Monk D, Frost J, Preece M, Stanier P, Moore GE. The genetic aetiology of Silver-Russell syndrome. J Med Genet 2008;45: 193–9. Leff SE, Brannan CI, Reed ML, Ozcelik T, Francke U, Copeland NG, et al. Maternal imprinting of the mouse Snrpn gene and conserved linkage homology with the human Prader-Willi syndrome region. Nat Genet 1992;2:259–64. Robertson KD, Wolffe AP. DNA methylation in health and disease. Nat Rev Genet 2000;1:11–9. Bartolomei MS, Ferguson-Smith AC. Mammalian genomic imprinting. Cold Spring Harb Perspect Biol 2011;3. Chen T, Li E. Establishment and maintenance of DNA methylation patterns in mammals. Curr Top Microbiol Immunol 2006;301:179–201. Mortusewicz O, Schermelleh L, Walter J, Cardoso MC, Leonhardt H. Recruitment of DNA methyltransferase I to DNA repair sites. Proc Natl Acad Sci USA 2005;102:8905–9. Okano M, Bell DW, Haber DA, Li E. DNA methyltransferases Dnmt3a and Dnmt3b are essential for de novo methylation and mammalian development. Cell 1999;99:247–57. Hirasawa R, Chiba H, Kaneda M, Tajima S, Li E, Jaenisch R, et al. Maternal and zygotic Dnmt1 are necessary and sufficient for the maintenance of DNA methylation imprints during preimplantation development. Genes Dev 2008;22:1607–16. Cirio MC, Ratnam S, Ding F, Reinhart B, Navara C, Chaillet JR. Preimplantation expression of the somatic form of Dnmt1 suggests a role in the inheritance of genomic imprints. BMC Dev Biol 2008;8:9. Hata K, Okano M, Lei H, Li E. Dnmt3L cooperates with the Dnmt3 family of de novo DNA methyltransferases to establish maternal imprints in mice. Development 2002;129:1983–93. Pukazhenthi BS, Wildt DE. Which reproductive technologies are most relevant to studying, managing and conserving wildlife? Reprod Fertil Dev 2004;16:33–46. Yan LY, Yan J, Qiao J, Zhao PL, Liu P. Effects of oocyte vitrification on histone modifications. Reprod Fertil Dev 2010;22:920–5.
VOL. - NO. - / - 2014
22.
23.
24.
25.
26.
27.
28.
29.
30. 31.
32.
33.
34.
35.
36.
37.
38.
39.
40.
41.
Liang Y, Fu XW, Li JJ, Yuan DS, Zhu SE. DNA methylation pattern in mouse oocytes and their in vitro fertilized early embryos: effect of oocyte vitrification. Zygote 2012:1–8. Al-Khtib M, Perret A, Khoueiry R, Ibala-Romdhane S, Blachere T, Greze C, et al. Vitrification at the germinal vesicle stage does not affect the methylation profile of H19 and KCNQ1OT1 imprinting centers in human oocytes subsequently matured in vitro. Fertil Steril 2011;95: 1955–60. Monzo C, Haouzi D, Roman K, Assou S, Dechaud H, Hamamah S. Slow freezing and vitrification differentially modify the gene expression profile of human metaphase II oocytes. Hum Reprod 2012;27: 2160–8. Zhao XM, Ren JJ, Du WH, Hao HS, Wang D, Qin T, et al. Effect of vitrification on promoter CpG island methylation patterns and expression levels of DNA methyltransferase 1o, histone acetyltransferase 1, and deacetylase 1 in metaphase II mouse oocytes. Fertil Steril 2013; 100:256–61. Zhao XM, Du WH, Hao HS, Wang D, Qin T, Liu Y, et al. Effect of vitrification on promoter methylation and the expression of pluripotency and differentiation genes in mouse blastocysts. Mol Reprod Dev 2012;79: 445–50. Wang Z, Xu L, He F. Embryo vitrification affects the methylation of the H19/Igf2 differentially methylated domain and the expression of H19 and Igf2. Fertil Steril 2010;93:2729–33. Vajta G, Booth PJ, Holm P, Greve T, Callesen H. Successful vitrification of early stage bovine in vitro produced embryos with the open pulled straw (OPS) method. Cryo-Letters 1997;18:191–5. Livak KJ, Schmittgen TD. Analysis of relative gene expression data using real-time quantitative PCR and the 2(T)(-Delta Delta C) method. Methods 2001;25:402–8. Kumaki Y, Oda M, Okano M. QUMA: quantification tool for methylation analysis. Nucleic Acids Res 2008;36:W170–5. Lucifero D, Mann MR, Bartolomei MS, Trasler JM. Gene-specific timing and epigenetic memory in oocyte imprinting. Hum Mol Genet 2004;13: 839–49. Davis TL, Trasler JM, Moss SB, Yang GJ, Bartolomei MS. Acquisition of the H19 methylation imprint occurs differentially on the parental alleles during spermatogenesis. Genomics 1999;58:18–28. Sutcliffe AG, Peters CJ, Bowdin S, Temple K, Reardon W, Wilson L, et al. Assisted reproductive therapies and imprinting disorders—a preliminary British survey. Hum Reprod 2006;21:1009–11. Chang AS, Moley KH, Wangler M, Feinberg AP, Debaun MR. Association between Beckwith-Wiedemann syndrome and assisted reproductive technology: a case series of 19 patients. Fertil Steril 2005;83: 349–54. Chen SL, Shi XY, Zheng HY, Wu FR, Luo C. Aberrant DNA methylation of imprinted H19 gene in human preimplantation embryos. Fertil Steril 2010; 94:2356–8, 8.e1. Ibala-Romdhane S, Al-Khtib M, Khoueiry R, Blachere T, Guerin JF, Lefevre A. Analysis of H19 methylation in control and abnormal human embryos, sperm and oocytes. Eur J Hum Genet 2011;19:1138–43. Gicquel C, Gaston V, Mandelbaum J, Siffroi JP, Flahault A, Le Bouc Y. In vitro fertilization may increase the risk of Beckwith-Wiedemann syndrome related to the abnormal imprinting of the KCN1OT gene. Am J Hum Genet 2003;72: 1338–41. Oliver VF, Miles HL, Cutfield WS, Hofman PL, Ludgate JL, Morison IM. Defects in imprinting and genome-wide DNA methylation are not common in the in vitro fertilization population. Fertil Steril 2012;97: 147–53.e7. Fortier AL, Lopes FL, Darricarrere N, Martel J, Trasler JM. Superovulation alters the expression of imprinted genes in the midgestation mouse placenta. Hum Mol Genet 2008;17:1653–65. Mann MR, Lee SS, Doherty AS, Verona RI, Nolen LD, Schultz RM, et al. Selective loss of imprinting in the placenta following preimplantation development in culture. Development 2004;131:3727–35. Rivera RM, Stein P, Weaver JR, Mager J, Schultz RM, Bartolomei MS. Manipulations of mouse embryos prior to implantation result in aberrant
7
ORIGINAL ARTICLE: REPRODUCTIVE BIOLOGY
42.
43.
44.
45.
8
expression of imprinted genes on day 9.5 of development. Hum Mol Genet 2008;17:1–14. Li T, Vu TH, Ulaner GA, Littman E, Ling J-Q, Chen H-L, et al. IVF results in de novo DNA methylation and histone methylation at an Igf2-H19 imprinting epigenetic switch. Mol Hum Reprod 2005;11:631–40. Sauvat F, Capito C, Sarnacki S, Poirot C, Bachelot A, Meduri G, et al. Immature cryopreserved ovary restores puberty and fertility in mice without alteration of epigenetic marks. Plos One 2008;3:e1972. Trapphoff T, El Hajj N, Zechner U, Haaf T, Eichenlaub-Ritter U. DNA integrity, growth pattern, spindle formation, chromosomal constitution and imprinting patterns of mouse oocytes from vitrified pre-antral follicles. Hum Reprod 2010;25:3025–42. Hiura H, Obata Y, Komiyama J, Shirai M, Kono T. Oocyte growthdependent progression of maternal imprinting in mice. Genes Cells 2006; 11:353–61.
46. 47.
48.
49.
50.
Gosden RG. Oogenesis as a foundation for embryogenesis. Mol Cell Endocrinol 2002;186:149–53. Hyttel P, Vajta G, Callesen H. Vitrification of bovine oocytes with the open pulled straw method: ultrastructural consequences. Mol Reprod Dev 2000;56:80–8. Tucker KL, Beard C, Dausmann J, Jackson-Grusby L, Laird PW, Lei H, et al. Germ-line passage is required for establishment of methylation and expression patterns of imprinted but not of nonimprinted genes. Genes Dev 1996;10:1008–20. Nakamura T, Liu YJ, Nakashima H, Umehara H, Inoue K, Matoba S, et al. PGC7 binds histone H3K9me2 to protect against conversion of 5mC to 5hmC in early embryos. Nature 2012;486:415–9. Li XJ, Ito M, Zhou F, Youngson N, Zuo XP, Leder P, et al. A maternal-zygotic effect gene, Zfp57, maintains both maternal and paternal imprints. Dev Cell 2008;15:547–57.
VOL. - NO. - / - 2014
Fertility and Sterility®
SUPPLEMENTAL TABLE 1 Primers and reaction conditions for bisulfite PCR. Gene H19
Peg3
Snrpn
Accession U19619
AF105262.1
AF081460
Primer type
Primer sequence (50 -30 )
Annealing temperature ( C)
Reference
Out forward Out reverse In forward In reverse Out forward Out reverse In forward In reverse Out forward Out reverse In forward In reverse
GAGTATTTAGGAGGTATAAGAATT ATCAAAAACTAACATAAACCCCT GTAAGGAGATTATGTTTATTTTTGG CTAACCTCATAAAACCCATAACTAT TTGTTGATGTTAATTTTGTGTTTTGGTG TCAACCTTATCAATTACCCTTAAAAACC TTTTGTAGAGGATTTTGATAAGGAGGTG CCCCAAACACCATCTAAACTCTACAAAC TATGTAATATGATATAGTTTAGAAATTAG AATAAACCCAAATCTAAAATATTTTAATC AATTTGTGTGATGTTTGTAATTATTTGG ATAAAATACACTTTCACTACTAAA ATCC
55
(1)
55 55
(2)
63 55
(2)
60
Cheng. Vitrification of mature oocytes. Fertil Steril 2014.
VOL. - NO. - / - 2014
8.e1
ORIGINAL ARTICLE: REPRODUCTIVE BIOLOGY
SUPPLEMENTAL TABLE 2 Primer sets used for real-time PCR. Gene Dnmt1 Dnmt3a Dnmt3b Dnmt3l 18S
Primers 0
0
F:5 -CCTAGTTCCGTGGCTACGAGGAGAA-3 R:50 -TCTCTCTCCTCTGCAGCCGACTCA-30 F:50 -GCCGAATTGTGTCTTGGTGGATGACA-30 R:50 -CCTGGTGGAATGCACTGCAGAAGGA-30 F:50 -TTCAGTGACCAGTCCTCAGACACGAA-30 R:50 -TCAGAAGGCTGGAGACCTCCCTCTT-30 F:50 -GTGCGGGTACTGAGCCTTTTTAGA-30 F:50 -CGACATTTGTGACATCTTCCACGTA-30 F:50 -GCCCTGTAATTGGAATGAGTCCACTT-30 R:50 -GTCCCCAAGATCCAACTACGAGCTTT-30
Product size (bp)
Annealing temperature ( C)
137
58
147
59
145
59
120
63
140
59–63
Cheng. Vitrification of mature oocytes. Fertil Steril 2014.
8.e2
VOL. - NO. - / - 2014
Fertility and Sterility®
REFERENCES 1.
Rivera RM, Stein P, Weaver JR, Mager J, Schultz RM, Bartolomei MS. Manipulations of mouse embryos prior to implantation result in aberrant expression of imprinted genes on day 9.5 of development. Hum Mol Genet 2008;17:1–14.
VOL. - NO. - / - 2014
2.
Lucifero D, Mertineit C, Clarke HJ, Bestor TH, Trasler JM. Methylation dynamics of imprinted genes in mouse germ cells. Genomics 2002;79: 530–8.
8.e3
Effect of oocytes vitrification on deoxyribonucleic acid methylation of H19, Peg3, and Snrpn differentially methylated regions in mouse blastocysts Ke-Ren Cheng, Ph.D.,a Xiang-Wei Fu, Ph.D.,a Rui-Na Zhang, Ph.D.,a Gong-Xue Jia, Ph.D.,a Yun-Peng Hou, Ph.D.,b and Shi-En Zhu, Ph.D.a a Key Laboratory of Animal Genetics, Breeding and Reproduction, Ministry of Agriculture and National Engineering Laboratory for Animal Breeding, College of Animal Science and Technology; and b State Key Laboratory for Agro Biotechnology, College of Biological Sciences, China Agricultural University, Beijing, People's Republic of China
Objective: To examine whether mouse oocytes vitrification could alter the deoxyribonucleic acid (DNA) methylation of differentially methylated regions (DMRs) of three imprinted genes in in vitro fertilized blastocysts. Design: In vitro experiments using murine model. Setting: State key laboratory and university research laboratory. Animal(s): Kunming white mice. Intervention(s): The mouse metaphase II oocytes were vitrified. After thawing, the surviving oocytes were fertilized in vitro to produce blastocysts. The blastocysts derived in vitro from fresh oocytes were used as a control. The DNA methylation patterns of the DMRs of imprinted genes in oocytes and blastocysts and the relative expression of DNMTs (Dnmt1, Dnmt3a, Dnmt3b, and Dnmt3l) in oocytes and blastocysts were detected. Main Outcome Measure(s): Methylation patterns of DMRs of H19, Peg3, and Snrpn analyzed by bisulfite mutagenesis and sequencing. Expression levels of messenger ribonucleic acid as measured by real-time reverse-transcriptase polymerase chain reaction. Result(s): After oocytes vitrification, the methylation levels at H19, Peg3, and Snrpn DMRs in blastocysts were decreased. However, there was no significant difference in the percentage of hypermethylated strands at Peg3 DMRs between the vitrified and control groups. DNMTs expression in vitrified oocytes and the expression of Dnmt3b in blastocysts derived from vitrified oocytes were significantly reduced. Conclusion(s): Oocytes vitrification could lead to the loss of DNA methylation of imprinted genes (H19, Peg3, and Snrpn) in mouse blastocysts, which is mainly caused by the reductions Use your smartphone of DNMTs after vitrification of oocytes. (Fertil SterilÒ 2014;-:-–-. Ó2014 by American to scan this QR code Society for Reproductive Medicine.) and connect to the Key Words: Vitrification, mouse oocyte, blastocyst, DNA methylation, DNMTs Discuss: You can discuss this article with its authors and with other ASRM members at http:// fertstertforum.com/chengkr-mouse-oocytes-vitrification-dna-methylation-dmrs/
G
enomic imprinting is an epigenetic mechanism of transcriptional regulation that results in monoallelic expression of a subset
of mammalian genes (1). Genomic imprinting is a multi-step and sexspecific process. In mice, most imprints are erased when primordial germ cells
Received March 3, 2014; revised June 21, 2014; accepted June 23, 2014. K.-R.C. has nothing to disclose. X.-W.F. has nothing to disclose. R.-N.Z. has nothing to disclose. G.-X.J. has nothing to disclose. Y.-P.H. has nothing to disclose. S.-E.Z. has nothing to disclose. Reprint requests: Shi-En Zhu, Ph.D., College of Animal Science and Technology, China Agricultural University, No.2 West Yuanmingyuan Road, Beijing 100193, People's Republic of China (E-mail: [email protected]). Fertility and Sterility® Vol. -, No. -, - 2014 0015-0282/$36.00 Copyright ©2014 American Society for Reproductive Medicine, Published by Elsevier Inc. http://dx.doi.org/10.1016/j.fertnstert.2014.06.037 VOL. - NO. - / - 2014
discussion forum for this article now.*
* Download a free QR code scanner by searching for “QR scanner” in your smartphone’s app store or app marketplace.
enter the genital ridge at embryonic day (E) 11.5. Depending on the sex of developing germ cells, a select group of genes will be re-imprinted later. In the male germline, H19 methylation imprints are initiated in fetal germ cells and completed in pachytene spermatocytes. In females, Snrpn and Peg3 methylation imprints are acquired asynchronously in a genespecific manner, during the transition from primordial to antral follicles in 1
ORIGINAL ARTICLE: REPRODUCTIVE BIOLOGY the postnatal growth phase (2). Although global demethylation occurs after fertilization and continues until the first lineage segregation, when cells from the inner cell mass and trophectoderm are differentially methylated, both paternally and maternally imprinted genes retain methylation at their differentially methylated regions (DMRs) during this phase (3). In humans, studies on deoxyribonucleic acid (DNA) methylation of imprinted genes in preimplantation embryos are very limited for ethical reasons. However, available findings suggest that there is conservation of imprinting in mice and humans. For example, the mouse H19 gene maps to the distal segment of chromosome 7 (4), and it is parentally imprinted (5). H19 encodes a noncoding ribonucleic acid (RNA) and lies at the end of a cluster of imprinted genes (6). In humans, the H19 gene is located at chromosome 11p15.5, and its DMR is paternally methylated. Peg3 (paternally expressed gene 3) is the first imprinted gene detected in the proximal region of mouse chromosome 7 (7). Peg3 encodes a Kr€ uppel-type (C2H2) zinc finger–containing (ZNF) protein containing putative transcription factor activities (8, 9). Human chromosome 19q13.4 is synthetically homologous to mouse Peg3, where the genes for myotonic dystrophy and a putative tumor suppressor gene are located (7). Snrpn is a maternally imprinted gene in mouse, encoding a brain-enriched small nuclear ribonucleoprotein (snRNP)– associated polypeptide SmN, mapped to the central part of mouse chromosome 7 in a region of homology with human chromosome 15q11-13. These genes are of particular interest because of their important biological functions and the characteristic phenotypes associated with the absence of their gene products. Hypomethylation of H19 DMR contributes about 35%–65% of Silver–Russell syndrome cases (10). Snrpn maps in the Prader-Willi critical region, as a candidate gene involved in Prader-Willi and Angelman syndromes (11). The methylated base 5-methylcytosine typically occurs at CpG (cytosine and guanine connected by a phosphodiester bond) sites, which is not only the most widely investigated epigenetic marker associated with genomic imprinting but also one of the epigenetic modifications that regulates gene expression (12). CpG islands found at the promoters of imprinted genes are differentially methylated. These differentially methylated regions are called DMRs (13). DNA methylation is catalyzed by a family of DNA methyltransferases (DNMTs). In mammals, DNMTs include 5 members (DNMT1, DNMT2, DNMT3A, DNMT3B, and DNMT3L). The DNMT3A and DNMT3B are responsible for de novo CpGs methylation, whereas DNMT1 maintains this pattern during chromosome replication (14) and repair (15). DNMT3A and DNMT3B have no effect on maintenance of imprinted methylation patterns in early embryos (16). DNMT1 alone is sufficient to maintain the methylation marks of the imprinted genes during preimplantation development (17, 18). DNMT3L may cooperate with DNMT3A and DNMT3B methyltransferases to carry out de novo methylation of maternally imprinted genes during oogenesis (19). Cryopreservation of oocytes is an essential part of assisted reproductive technology (ART), which has been 2
more and more widely used for human ART, but is also used for the preservation of genetic resources in endangered species (20). Recently, an increasing number of studies have shown that oocyte vitrification may have an effect on the epigenetic modifications of preimplantation embryos, such as histone acetylation (21) and DNA methylation (22). Human oocytes vitrified at the germinal vesicle (GV) stage and in vitro matured (IVM) after thawing did not affect the methylation patterns of H19 DMR and KvDMR1 (23). However, cryopreservation altered the expression profile of human MII oocytes (24), and vitrification significantly decreased the expression of Dnmt1o mRNA in mouse MII oocytes (25). It has also been reported that vitrification of mouse blastocysts significantly decreased Oct4, Nanog, and Cdx2 promoter methylation in mouse blastocysts (26). Moreover, embryo vitrification aggravated the loss of methylation in the H19/Igf2 DMR (27). More studies are required to understand the effects of cryopreservation on genomic imprinting. The effect of oocyte vitrification on methylation of imprinted genes in blastocysts has not been investigated. To address this question, DNA methylation status at the DMRs of H19, Peg3, and Snrpn in the mouse blastocysts from vitrified oocytes was determined. The expression of the DNMTs (Dnmt1, Dnmt3a, Dnmt3b, and Dnmt3l) in the oocytes and blastocysts was also examined.
MATERIALS AND METHODS Unless otherwise indicated, all chemicals and media were purchased from Sigma-Aldrich. The protocols for the animal studies were approved by and performed in accordance with the requirements of the Institutional Animal Care and Use Committee of China Agricultural University.
Oocyte Collection Animals used in the study were Kunming white mice age 6–8 weeks (Academy of Military Medical Sciences, Beijing, China). One week after being housed in our animal facilities, mice were superovulated with 10 IU (intraperitoneal) equine chorionic gonadotropin (eCG; Ningbo Hormone Products Co.), followed 48 hours later by injection of 10 IU of human chorionic gonadotropin (hCG; Ningbo Hormone Products Co.). Thirteen hours after the hCG injection, cumulus-oocyte complexes were recovered in M2 medium supplemented with 4 mg/mL bovine serum albumin (BSA) from the ampulla of the oviducts. Cumulus cells were removed from oocytes with hyaluronidase (300 IU/mL) for 3–5 minutes in M2 medium. Only oocytes with normal morphology were used.
Oocyte Vitrification and Thawing The open-pulled straw (OPS) was made by the method described by Vajta with some modifications (28). Briefly, the straws (0.25 mL; IMV) were heat-softened and pulled manually to obtain a straw of approximately 2–3 cm in length, 0.05 mm in inner diameter, and 0.10 mm in outer diameter. The equilibration solution (ED solution) contained 10% ethylene glycol (EG) and 10% dimethylsulfoxide (DMSO) in VOL. - NO. - / - 2014
Fertility and Sterility® mPBS medium. The vitrification solution (EDFS30) contained 15% EG and 15% DMSO in FS solution (Modified PBS containing 300 mg/mL Ficoll, 171.2 g/L sucrose, and 3 mg/mL BSA). All manipulations were performed on a 37 C hot plate in a room at 25 C. Oocytes were pretreated in the equilibration solution for 30 seconds and then transferred to vitrification solution in the narrow end of the pulled straw and held for 25 seconds. The straws were then immediately plunged into liquid nitrogen (LN2). For thawing, oocytes were rinsed in 0.5 mol/L sucrose for 5 minutes, then rinsed three times in M2 medium and incubated in an incubator with 5% CO2, 37 C, and maximum humidity for 30 minutes before use.
IVF and Embryo Collection Oocytes in the fresh and vitrified groups were individually placed into 70-mL drops of human tubal fluid (HTF) medium (Millipore) under mineral oil, into which a 5-mL spermatozoa suspension was added for insemination. The final concentration was 5.0105 sperm/mL. Five hours after IVF, the eggs were removed from the fertilization drops, washed in KSOMaa medium (Millipore), and cultured in 70-mL drops of KSOMaa medium. Blastocysts were collected 96 hours after fertilization.
Bisulfite Sequencing Bisulfite treatment of oocyte DNA was carried out according to previous work, with slight modifications (29). Briefly, oocytes were incubated at 37 C in 0.5% pronase (Roche Diagnostics GmbH) in M2 for 3–5 minutes to remove the zona pellucida. Oocytes were collected into 7 mL 2% low–melting point agarose in a 1.5-mL tube, and the agarose was covered with chilled mineral oil for 10 minutes on ice to allow formation of beads. Then, 500 mL lysis buffer (1 mM SDS, 10 mM TisHCl, 100 mM ethylenediaminetetraacetic acid EDTA, 280 mg/mL proteinase K) was added into the tube and the beads were incubated at 50 C for 8 hours, followed by an equilibration against 0.3 M NaOH (500 mL) for 215 minutes at room temperature. Then the beads were equilibrated against 500 mL of freshly made bisulfite solution (2.5 M sodium metabisulfite, 125 mM hydroquinone; pH ¼ 5) at 50 C for 8 hours in the dark. The reactions were stopped by equilibrations against 1 mL Tris-EDTA (TE) buffer for 315 minutes. After desulfonation in 500 mL 0.3 M NaOH for 215 minutes, the beads were washed with TE for 215 minutes and H2O for 215 minutes and then either used immediately for polymerase chain reaction (PCR) or stored at 20 C. Groups of embryos were directly subjected to bisulfite conversion by using the EZ DNA Methylation Direct Kit (Zymo Research). For each group, the number of blastocysts used for bisulfite conversion each time was about 50. Nested PCR was performed using methylation-specific DNA polymerase (Tiangen) or HotMaster DNA polymerase (Tiangen). The sequences of the PCR primers and PCR conditions are listed in Supplemental Table 1 (available online). Both the first- and second-round PCRs were performed under the following conditions: 2 minutes at 95 C, followed by 30 cycles of PCR consisting of 30 seconds VOL. - NO. - / - 2014
at 94 C, 30 seconds at annealing temperatures, and 1 minute at 72 C. The PCR products were separated by electrophoresis in 1% agarose gel, and correct bands were excised from the gel and purified with QIAquick Gel Extraction Kit (Qiagen). Then, the purified DNA was cloned into a pDM18-T Vector (TaKaRa) according to the manufacturer's instructions. The positive clones were obtained by antibiotic selection, and the insert was sequenced by SunBiotech. The sequencing data were analyzed using an online tool QUMA (30). Methylation levels were determined by calculating the number of methylated CpGs/total number of CpGs for each individual CpG site as a percentage. Clones with >50% of the CpGs methylated were considered hypermethylated.
RNA Purification and Quantitative Real-Time PCR RNA was extracted from 100 oocytes or 50 blastocysts utilizing TRIzol reagent (Invitrogen) according to the manufacturer's instructions. The first cDNA strand was synthesized using a cDNA reverse transcription kit (High-Capacity cDNA Reverse Transcription kit; Applied Biosystems). Quantitative realtime PCR was carried out using the CFX96TM Real-Time PCR Detection System (Bio-Rad) under standard conditions. At least triple samples were analyzed for each gene, and 18s was used as a reference gene. The expression levels were calcuOOCt ) method (29). The lated using the comparative Ct (2 primers are shown in Supplemental Table 2 (available online).
Statistical Analysis Each experiment was repeated at least 3 times. Data are presented as mean standard error. The proportions of hypermethylated clones among different groups were determined to be normally distributed, with homogeneity of variance. The significance between groups was compared by one-way ANOVA using SPSS 20.0 software. P< .05 was considered statistically significant.
RESULTS Effect of Oocyte Vitrification on Methylation Patterns of Imprinted Genes in Oocytes To identify whether oocyte vitrification could influence the DNA methylation patterns of imprinted genes in oocytes, the regions including 15 CpGs located in the H19 DMR, 18 CpGs located in the Peg3 DMR, and 16 CpGs located in the Snrpn DMR were analyzed. The Peg3 and Snrpn DMRs acquire maternal-specific methylation during oogenesis, whereas the H19 DMR acquires paternal-specific methylation during spermatogenesis (31). Figure 1 shows one example of the bisulfite sequencing analysis of the DMRs in H19, Peg3, and Snrpn. There were no statistically significant differences between the fresh and vitrified oocytes 0.5 hours after thawing.
Effect of Oocyte Vitrification on Methylation Patterns of Imprinted Genes in Blastocysts To determine the effects of vitrification on imprint maintenance, methylation patterns of imprinted genes in blastocysts were analyzed. As shown in Figure 2, the overall methylated 3
ORIGINAL ARTICLE: REPRODUCTIVE BIOLOGY
FIGURE 1
Representative methylation status of H19, Peg3, and Snrpn differentially methylated regions in oocytes. Each row represents a unique DNA clone; filled and open circles represent methylated and unmethylated CpGs, respectively. Cheng. Vitrification of mature oocytes. Fertil Steril 2014.
CpGs percentages of all three genes in the vitrified oocyte groups were lower than those of the fresh oocyte groups. The H19 methylation levels in the fresh and vitrified groups were 32.15% and 30.97%, respectively. The Peg3 methylation levels in the fresh and vitrified groups were 35.38% and 30.19%, respectively. The Snrpn methylation levels were 35.48% and 18.11% for the fresh and vitrified groups, respectively.
Dnmt3b, and Dnmt3l in oocytes by quantitative real-time PCR. As shown in Figure 3A, after oocyte vitrification and thawing, the relative expression levels of DNMTs were significantly decreased (P< .05).
Percentages of Hypermethylated Clones in the Imprinted Genes of Fresh and Vitrified Groups
To further study whether the expression of DNMTs would return to the normal level, we performed the relative expression analysis of DNMTs in blastocysts. As shown in Figure 3B, the relative expression of Dnmt3b mRNA in blastocysts in the vitrified group was lower (P< .05). There were no significant differences in the relative abundance of Dnmt1, Dnmt3a, and Dnmt3l between the vitrified and fresh groups (P>.05).
As shown in Table 1, the proportion of hypermethylated clones of H19 (16.67% 2.38%) in the vitrified groups was significantly lower than that in the fresh groups (35.56% 2.22%) (P< .05). For Peg3 and Snrpn, there were no significant differences between the two groups. Clones with >50% of the CpGs methylated were considered hypermethylated, as suggested elsewhere (32).
Relative Expression Levels of DNMTs in Mouse MII Oocytes after Vitrification To investigate if DNMTs were affected by vitrification, we determined the relative expression of Dnmt1, Dnmt3a, 4
Effect of Vitrification on the Relative Expression Levels of DNMTs in Blastocysts
DISCUSSION In humans, assisted reproduction has been linked to the generation of epigenetic errors that may result in the development of the human imprinting disorders such as Prader-Willi and Angelman Syndromes and BeckwithWeidemann Syndrome. Multiple studies have examined the association of ARTs and imprinting. Some reports have VOL. - NO. - / - 2014
Fertility and Sterility®
FIGURE 2
Methylation status of H19, Peg3, and Snrpn differentially methylated regions in blastocysts derived from fresh and vitrified oocytes. (A) H19; (B) Peg3; (C) Snrpn. Each row represents a unique methylation profile within the pool of clones sequenced. Filled and open circles represent methylated and unmethylated CpGs, respectively. The percentage on the right of the strand represents the proportion of strand with that phenotype. N represents the total number of selected clones. Cheng. Vitrification of mature oocytes. Fertil Steril 2014.
postulated that Beckwith-Weidemann Syndrome is linked to more-specific procedures such as IVF/intracytoplasmic sperm injection (ICSI; 33) or ovarian stimulation (34). Hypomethylation of H19 DMR has been reported in 18.7% of the preimplantation IVF embryos (35). Good-quality cryopreserved blastocysts donated for research showed a lower-than-expected methylation level (36), suggesting that there is a possible link between ART and H19 imprinting
TABLE 1 The proportion (% ± standard error) of hypermethylated clones of imprinted genes in blastocysts. H19
Oocyte treatment Fresh Vitrified
Peg3
35.56 2.22 36.67 3.33 16.67 2.38 30 10.00
Snrpn 41.94 11.69 10.00 5.77
Note: The values for fresh vs. vitrified are significantly different for H19 (P< .05). Hypermethylation means that at least 50% CpGs are methylated in a strand. Cheng. Vitrification of mature oocytes. Fertil Steril 2014.
VOL. - NO. - / - 2014
disorder (37). However, low-level imprinting errors and global disruption of methylation were not commonly observed in IVF children (38). In mice studies, such as ovulation induction (39) and embryo culture (40, 41), designed to validate epigenetic effect in response to IVF/ICSI, H19 is also most frequently involved. IVF might cause aberrant DNA methylation in the Igf2-H19 gene region (42), and abnormal imprinting of the Kcn1ot gene at the morula and blastocyst stages in the mouse (37). All the above show that the epigenetic disruption caused by ART is related to imprinted genes. Likewise, stress induced by oocyte vitrification can affect the oocyte's ability to synthesize and store sufficient amounts of maternal factors such as mRNA of DNMTs, which may perturb genomic imprinting during embryo development. For cryopreservation of oocytes/embryos, more studies are required to understand the effects of cryogenic technologies on genomic imprinting. Mice that were produced following whole-ovary cryopreservation maintained normal H19 and Kcnq1ot1 methylation ratios (43). Vitrification of 5
ORIGINAL ARTICLE: REPRODUCTIVE BIOLOGY
FIGURE 3
(A) Relative expression levels of DNMT mRNA in fresh and vitrified oocytes after thawing. In Dnmt3l, the error bars are too small to be observed. (B) Relative expression levels of DNMT mRNA in blastocysts derived from fresh and vitrified oocytes. Different superscripts represent statistically significant differences between groups (P<.05). Cheng. Vitrification of mature oocytes. Fertil Steril 2014.
mouse prenatal follicles followed by long-term IVM to GV oocytes led to Snrpn loss of methylation but not Igf2r loss of methylation or H19 gain of methylation (44). Oocytes (22) and embryo vitrification (27) could affect embryo DNA methylation too. In women, the maternal methylation imprints become fully established by the fully grown oocyte stage (45); vitrification of human GV oocytes followed by short-term IVM resulted in H19 gain of methylation in MII oocyte pools (23). Our results showed that MII oocyte vitrification did not alter the methylation patterns of imprinted genes in oocytes. However, loss of methylation of imprinted genes in blastocysts derived from vitrified oocytes was found. Thus, more studies are required to understand the effects of oocyte vitrification on genomic imprinting. Some studies suggest that MII oocytes do not undergo DNA replication and DNA methylations (46). Indeed, previous work revealed that vitrification does not alter the methylation patterns of the promoter CpG islands in Dnmt1o, Hat1, or Hdac1 in mouse MII oocytes (25). The methyl group is very stable, which means that it needs a specific enzyme to open the chemical bond and cannot be affected by vitrification. During oocyte cryopreservation, extrusion of water surrounding mRNA could generate mRNA unfolding and facilitate RNAase access, leading to lysis of molecules (47). Thus, the vitrification of oocytes at the metaphase II stage can reduce the expression of Dnmt1o, histone acetyltransferase 1, and deacetylase 1 mRNA (25). Consistent with previous studies, our present work showed that the transcript abundance of DNMTs decreased after oocyte vitrification, which might affect the maintenance of DNA methylation of imprinted genes. During the process of cooling and thawing, the loss of related mRNAs, which are stored in mature oocytes, and epigenetic modification would inevitably have implications for epigenetic inheritance during early embryonic development. Thus, mRNA abundance decreased in oocytes after thawing, causing potential disturbance of the imprinting in the preimplantation embryo. The inheritance of genomic imprints was strictly due to the embryonic maintenance of DNA methylation. Such maintenance occurs in association with every cycle of DNA 6
replication, including those of preimplantation embryos. Especially during the preimplantation stage, histone modification and DNA methylation of imprinted genes, once lost, would be difficult to recover (48). Theoretically, the DNA methylation patterns of imprinted genes are constant during preimplantation embryo development. Pluripotency-associated protein 3 (DPPA3/Stella/PGC7) protects the maternal genome and imprinted genes from active demethylation by binding to H3K9me2, inhibiting 5-methylcytosine conversion to 5 hydroxymethylcytosine from tubal embryo transfer–mediated demethylation. The major function of these transfers is oxidization of 5-methylcytosine (49). Also, zinc finger protein (ZFP)57, along with its cofactor tripartite motif containing 28 (TRIM28; KRAB-associated protein 1 [KAP1]), maintains both maternal and paternal imprints (50). Regarding imprinted genes, DNMT1 alone is sufficient to maintain the methylation marks of the imprinted genes (18). However, zygotic DNMT3B is required for the methylation maintenance at Rasgrf1 in preimplantation embryos (17). Our results demonstrated that in vitrified oocytes after fertilization, expression of some DNMTs could generally return to normal levels in blastocysts. However, oocyte vitrification significantly affected the expression of Dnmt3b in blastocysts. We preferred that reduction of abundance of DNMTs caused by oocyte vitrification lead to reduced maintenance of DNA methylation of imprinted genes during DNA replication, and it is analogous to passive DNA demethylation. In conclusion, the vitrification of mouse MII oocytes can lead to a loss of DNA methylation of imprinted genes in blastocysts. This loss is most likely because of a reduction in the abundance of DNMTs in oocytes after vitrification. Understanding the effect of oocyte vitrification on DNA methylation of imprinted genes still requires more detailed studies. Acknowledgments: This work was supported by the Specialized Research Fund for the Doctoral Program of Higher Education (SRFDP) (No. 20120008110001) and the National Natural Science Foundation Project of China VOL. - NO. - / - 2014
Fertility and Sterility® (No. 31372307). The authors thank Dr. Guang-Bing Zhou (Sichuan Agricultural University), Dr. Qi-En Yang (Washington State University), and Nature Publishing Group Language Editing (NPG Language Editing) for proofreading of the article.
REFERENCES 1.
2.
3.
4. 5. 6.
7.
8. 9. 10.
11.
12. 13. 14. 15.
16.
17.
18.
19.
20.
21.
Verona RI, Mann MR, Bartolomei MS. Genomic imprinting: intricacies of epigenetic regulation in clusters. Annu Rev Cell Dev Biol 2003;19: 237–59. Saitou M, Kagiwada S, Kurimoto K. Epigenetic reprogramming in mouse pre-implantation development and primordial germ cells. Development 2012;139:15–31. Lepikhov K, Wossidlo M, Arand J, Walter J. DNA methylation reprogramming and DNA repair in the mouse zygote. Int J Dev Biol 2010; 54:1565–74. Searle AG, Beechey CV. Noncomplementation phenomena and their bearing on nondisjunctional effects. Basic Life Sci 1985;36:363–76. Bartolomei MS, Zemel S, Tilghman SM. Parental imprinting of the mouse H19 gene. Nature 1991;351:153–5. Leighton PA, Ingram RS, Eggenschwiler J, Efstratiadis A, Tilghman SM. Disruption of imprinting caused by deletion of the H19 gene region in mice. Nature 1995;375:34–9. Kuroiwa Y, Kaneko-Ishino T, Kagitani F, Kohda T, Li LL, Tada M, et al. Peg3 imprinted gene on proximal chromosome 7 encodes for a zinc finger protein. Nat Genet 1996;12:186–90. El-Baradi T, Pieler T. Zinc finger proteins: what we know and what we would like to know. Mech Dev 1991;35:155–69. Pieler T, Bellefroid E. Perspectives on zinc-finger protein function and evolution—an update. Mol Biol Rep 1994;20:1–8. Abu-Amero S, Monk D, Frost J, Preece M, Stanier P, Moore GE. The genetic aetiology of Silver-Russell syndrome. J Med Genet 2008;45: 193–9. Leff SE, Brannan CI, Reed ML, Ozcelik T, Francke U, Copeland NG, et al. Maternal imprinting of the mouse Snrpn gene and conserved linkage homology with the human Prader-Willi syndrome region. Nat Genet 1992;2:259–64. Robertson KD, Wolffe AP. DNA methylation in health and disease. Nat Rev Genet 2000;1:11–9. Bartolomei MS, Ferguson-Smith AC. Mammalian genomic imprinting. Cold Spring Harb Perspect Biol 2011;3. Chen T, Li E. Establishment and maintenance of DNA methylation patterns in mammals. Curr Top Microbiol Immunol 2006;301:179–201. Mortusewicz O, Schermelleh L, Walter J, Cardoso MC, Leonhardt H. Recruitment of DNA methyltransferase I to DNA repair sites. Proc Natl Acad Sci USA 2005;102:8905–9. Okano M, Bell DW, Haber DA, Li E. DNA methyltransferases Dnmt3a and Dnmt3b are essential for de novo methylation and mammalian development. Cell 1999;99:247–57. Hirasawa R, Chiba H, Kaneda M, Tajima S, Li E, Jaenisch R, et al. Maternal and zygotic Dnmt1 are necessary and sufficient for the maintenance of DNA methylation imprints during preimplantation development. Genes Dev 2008;22:1607–16. Cirio MC, Ratnam S, Ding F, Reinhart B, Navara C, Chaillet JR. Preimplantation expression of the somatic form of Dnmt1 suggests a role in the inheritance of genomic imprints. BMC Dev Biol 2008;8:9. Hata K, Okano M, Lei H, Li E. Dnmt3L cooperates with the Dnmt3 family of de novo DNA methyltransferases to establish maternal imprints in mice. Development 2002;129:1983–93. Pukazhenthi BS, Wildt DE. Which reproductive technologies are most relevant to studying, managing and conserving wildlife? Reprod Fertil Dev 2004;16:33–46. Yan LY, Yan J, Qiao J, Zhao PL, Liu P. Effects of oocyte vitrification on histone modifications. Reprod Fertil Dev 2010;22:920–5.
VOL. - NO. - / - 2014
22.
23.
24.
25.
26.
27.
28.
29.
30. 31.
32.
33.
34.
35.
36.
37.
38.
39.
40.
41.
Liang Y, Fu XW, Li JJ, Yuan DS, Zhu SE. DNA methylation pattern in mouse oocytes and their in vitro fertilized early embryos: effect of oocyte vitrification. Zygote 2012:1–8. Al-Khtib M, Perret A, Khoueiry R, Ibala-Romdhane S, Blachere T, Greze C, et al. Vitrification at the germinal vesicle stage does not affect the methylation profile of H19 and KCNQ1OT1 imprinting centers in human oocytes subsequently matured in vitro. Fertil Steril 2011;95: 1955–60. Monzo C, Haouzi D, Roman K, Assou S, Dechaud H, Hamamah S. Slow freezing and vitrification differentially modify the gene expression profile of human metaphase II oocytes. Hum Reprod 2012;27: 2160–8. Zhao XM, Ren JJ, Du WH, Hao HS, Wang D, Qin T, et al. Effect of vitrification on promoter CpG island methylation patterns and expression levels of DNA methyltransferase 1o, histone acetyltransferase 1, and deacetylase 1 in metaphase II mouse oocytes. Fertil Steril 2013; 100:256–61. Zhao XM, Du WH, Hao HS, Wang D, Qin T, Liu Y, et al. Effect of vitrification on promoter methylation and the expression of pluripotency and differentiation genes in mouse blastocysts. Mol Reprod Dev 2012;79: 445–50. Wang Z, Xu L, He F. Embryo vitrification affects the methylation of the H19/Igf2 differentially methylated domain and the expression of H19 and Igf2. Fertil Steril 2010;93:2729–33. Vajta G, Booth PJ, Holm P, Greve T, Callesen H. Successful vitrification of early stage bovine in vitro produced embryos with the open pulled straw (OPS) method. Cryo-Letters 1997;18:191–5. Livak KJ, Schmittgen TD. Analysis of relative gene expression data using real-time quantitative PCR and the 2(T)(-Delta Delta C) method. Methods 2001;25:402–8. Kumaki Y, Oda M, Okano M. QUMA: quantification tool for methylation analysis. Nucleic Acids Res 2008;36:W170–5. Lucifero D, Mann MR, Bartolomei MS, Trasler JM. Gene-specific timing and epigenetic memory in oocyte imprinting. Hum Mol Genet 2004;13: 839–49. Davis TL, Trasler JM, Moss SB, Yang GJ, Bartolomei MS. Acquisition of the H19 methylation imprint occurs differentially on the parental alleles during spermatogenesis. Genomics 1999;58:18–28. Sutcliffe AG, Peters CJ, Bowdin S, Temple K, Reardon W, Wilson L, et al. Assisted reproductive therapies and imprinting disorders—a preliminary British survey. Hum Reprod 2006;21:1009–11. Chang AS, Moley KH, Wangler M, Feinberg AP, Debaun MR. Association between Beckwith-Wiedemann syndrome and assisted reproductive technology: a case series of 19 patients. Fertil Steril 2005;83: 349–54. Chen SL, Shi XY, Zheng HY, Wu FR, Luo C. Aberrant DNA methylation of imprinted H19 gene in human preimplantation embryos. Fertil Steril 2010; 94:2356–8, 8.e1. Ibala-Romdhane S, Al-Khtib M, Khoueiry R, Blachere T, Guerin JF, Lefevre A. Analysis of H19 methylation in control and abnormal human embryos, sperm and oocytes. Eur J Hum Genet 2011;19:1138–43. Gicquel C, Gaston V, Mandelbaum J, Siffroi JP, Flahault A, Le Bouc Y. In vitro fertilization may increase the risk of Beckwith-Wiedemann syndrome related to the abnormal imprinting of the KCN1OT gene. Am J Hum Genet 2003;72: 1338–41. Oliver VF, Miles HL, Cutfield WS, Hofman PL, Ludgate JL, Morison IM. Defects in imprinting and genome-wide DNA methylation are not common in the in vitro fertilization population. Fertil Steril 2012;97: 147–53.e7. Fortier AL, Lopes FL, Darricarrere N, Martel J, Trasler JM. Superovulation alters the expression of imprinted genes in the midgestation mouse placenta. Hum Mol Genet 2008;17:1653–65. Mann MR, Lee SS, Doherty AS, Verona RI, Nolen LD, Schultz RM, et al. Selective loss of imprinting in the placenta following preimplantation development in culture. Development 2004;131:3727–35. Rivera RM, Stein P, Weaver JR, Mager J, Schultz RM, Bartolomei MS. Manipulations of mouse embryos prior to implantation result in aberrant
7
ORIGINAL ARTICLE: REPRODUCTIVE BIOLOGY
42.
43.
44.
45.
8
expression of imprinted genes on day 9.5 of development. Hum Mol Genet 2008;17:1–14. Li T, Vu TH, Ulaner GA, Littman E, Ling J-Q, Chen H-L, et al. IVF results in de novo DNA methylation and histone methylation at an Igf2-H19 imprinting epigenetic switch. Mol Hum Reprod 2005;11:631–40. Sauvat F, Capito C, Sarnacki S, Poirot C, Bachelot A, Meduri G, et al. Immature cryopreserved ovary restores puberty and fertility in mice without alteration of epigenetic marks. Plos One 2008;3:e1972. Trapphoff T, El Hajj N, Zechner U, Haaf T, Eichenlaub-Ritter U. DNA integrity, growth pattern, spindle formation, chromosomal constitution and imprinting patterns of mouse oocytes from vitrified pre-antral follicles. Hum Reprod 2010;25:3025–42. Hiura H, Obata Y, Komiyama J, Shirai M, Kono T. Oocyte growthdependent progression of maternal imprinting in mice. Genes Cells 2006; 11:353–61.
46. 47.
48.
49.
50.
Gosden RG. Oogenesis as a foundation for embryogenesis. Mol Cell Endocrinol 2002;186:149–53. Hyttel P, Vajta G, Callesen H. Vitrification of bovine oocytes with the open pulled straw method: ultrastructural consequences. Mol Reprod Dev 2000;56:80–8. Tucker KL, Beard C, Dausmann J, Jackson-Grusby L, Laird PW, Lei H, et al. Germ-line passage is required for establishment of methylation and expression patterns of imprinted but not of nonimprinted genes. Genes Dev 1996;10:1008–20. Nakamura T, Liu YJ, Nakashima H, Umehara H, Inoue K, Matoba S, et al. PGC7 binds histone H3K9me2 to protect against conversion of 5mC to 5hmC in early embryos. Nature 2012;486:415–9. Li XJ, Ito M, Zhou F, Youngson N, Zuo XP, Leder P, et al. A maternal-zygotic effect gene, Zfp57, maintains both maternal and paternal imprints. Dev Cell 2008;15:547–57.
VOL. - NO. - / - 2014
Fertility and Sterility®
SUPPLEMENTAL TABLE 1 Primers and reaction conditions for bisulfite PCR. Gene H19
Peg3
Snrpn
Accession U19619
AF105262.1
AF081460
Primer type
Primer sequence (50 -30 )
Annealing temperature ( C)
Reference
Out forward Out reverse In forward In reverse Out forward Out reverse In forward In reverse Out forward Out reverse In forward In reverse
GAGTATTTAGGAGGTATAAGAATT ATCAAAAACTAACATAAACCCCT GTAAGGAGATTATGTTTATTTTTGG CTAACCTCATAAAACCCATAACTAT TTGTTGATGTTAATTTTGTGTTTTGGTG TCAACCTTATCAATTACCCTTAAAAACC TTTTGTAGAGGATTTTGATAAGGAGGTG CCCCAAACACCATCTAAACTCTACAAAC TATGTAATATGATATAGTTTAGAAATTAG AATAAACCCAAATCTAAAATATTTTAATC AATTTGTGTGATGTTTGTAATTATTTGG ATAAAATACACTTTCACTACTAAA ATCC
55
(1)
55 55
(2)
63 55
(2)
60
Cheng. Vitrification of mature oocytes. Fertil Steril 2014.
VOL. - NO. - / - 2014
8.e1
ORIGINAL ARTICLE: REPRODUCTIVE BIOLOGY
SUPPLEMENTAL TABLE 2 Primer sets used for real-time PCR. Gene Dnmt1 Dnmt3a Dnmt3b Dnmt3l 18S
Primers 0
0
F:5 -CCTAGTTCCGTGGCTACGAGGAGAA-3 R:50 -TCTCTCTCCTCTGCAGCCGACTCA-30 F:50 -GCCGAATTGTGTCTTGGTGGATGACA-30 R:50 -CCTGGTGGAATGCACTGCAGAAGGA-30 F:50 -TTCAGTGACCAGTCCTCAGACACGAA-30 R:50 -TCAGAAGGCTGGAGACCTCCCTCTT-30 F:50 -GTGCGGGTACTGAGCCTTTTTAGA-30 F:50 -CGACATTTGTGACATCTTCCACGTA-30 F:50 -GCCCTGTAATTGGAATGAGTCCACTT-30 R:50 -GTCCCCAAGATCCAACTACGAGCTTT-30
Product size (bp)
Annealing temperature ( C)
137
58
147
59
145
59
120
63
140
59–63
Cheng. Vitrification of mature oocytes. Fertil Steril 2014.
8.e2
VOL. - NO. - / - 2014
Fertility and Sterility®
REFERENCES 1.
Rivera RM, Stein P, Weaver JR, Mager J, Schultz RM, Bartolomei MS. Manipulations of mouse embryos prior to implantation result in aberrant expression of imprinted genes on day 9.5 of development. Hum Mol Genet 2008;17:1–14.
VOL. - NO. - / - 2014
2.
Lucifero D, Mertineit C, Clarke HJ, Bestor TH, Trasler JM. Methylation dynamics of imprinted genes in mouse germ cells. Genomics 2002;79: 530–8.
8.e3