Effect of Polymorphism of the HLA-DPA1 Chain on Presentation of Antigenic Peptides

Effect of Polymorphism of the HLA-DPA1 Chain on Presentation of Antigenic Peptides J. S. Hill Gaston, Jane C. Goodall, Joyce L. Young, and Stephen P. Young ABSTRACT: Human T-cell clones that recognize a peptide from mycobacterial heat shock protein 60 in the context of HLA-DP were found to be sensitive to changes in the DPA1 chain of the restricting element, optimal responses being seen with the combination HLADPA1*0201 and HLA-DPB*0301. HLA-DP dimers containing HLA-DPA1*01 were only able to present antigenic peptides to T-cell clones when peptides were present throughout the period of coculture of T cells with antigen presenting cells. In contrast the optimal HLA-DP dimer could also stimulate T-cell clones maximally when

incubated with peptides for 1 h and then thoroughly washed. This suggests that the DPA1 polymorphism influenced the strength of binding of antigenic peptides to the HLA-DP dimer. Modeling studies identified amino acid 31 of DPA1 as the polymorphic residue most likely to account for this effect. This is the first demonstration that the relatively limited polymorphism displayed by DPA1 has functional consequences. Human Immunology 54, 40 – 47 (1997). © American Society for Histocompatibility and Immunogenetics, 1997.

ABBREVIATIONS TCR T-cell receptor EBLCL Epstein-Barr virus-transformed lymphoblastoid cell lines

APC PBMC

INTRODUCTION The function of major histocompatibility complex (MHC) molecules is to present a diverse range of peptides to T lymphocytes. Recognition of the appropriate peptide:class II MHC antigen complexes by the antigenspecific T-cell receptor (TCR) leads to CD41 T-cell proliferation, cytokine secretion, and the recruitment of other effector cells. There are three families of functional HLA class II molecules in humans, HLA-DR, -DQ and -DP. The association of certain immunologic diseases with different class II alleles, particularly those of HLA-DR and DQ [1], has fueled extensive studies to determine the nature of their interaction with antigenic peptides. HLA-DR is the most common restriction eleFrom the Department of Medicine, University of Cambridge (J.S.H.G., J.C.G., J.L.Y.) and Department of Rheumatology, University of Birmingham, Birmingham, United Kingdom (S.P.Y.). Address reprint requests to: Professor J. S. H. Gaston, University of Cambridge School of Clinical Medicine, Box 157, Level 5, Addenbrooke’s Hospital, Hills Road, Cambridge CB2 2QQ, United Kingdom. Received January 22, 1997; accepted February 28, 1997. Human Immunology 54, 40 – 47 (1997) © American Society for Histocompatibility and Immunogenetics, 1997

Antigen-presenting cells Peripheral blood mononuclear cells

ment used by T cells and consequently has received the most study [2] as compared to HLA-DQ and -DP. Although the function of HLA-DP in immune responses remains unclear, some diseases have been associated with specific DP alleles; these include juvenile arthritis [3–5], berylliosis [6], and atopic disease [7]. HLA-DP has also received attention as a possible target of allospecific T cells in the context of graft-versus-host disease [8], although the extent to which HLA-DP mismatching accounts for this complication has been disputed [9]. Involvement in alloreactivity has also been demonstrated by the description of a DR3-derived peptide being presented by HLA-DP to an allospecific T-cell clone [10]. A number of T-cell clones restricted by HLA-DP have been described by several groups, these studies showed that HLA-DP can present foreign and self peptides [10 –14]. DR-restricted and DP-restricted epitopes have been identified within the same antigen, although the relative importance of these epitopes in the immune response has not been determined [14]. Because of the relative rarity of HLA-DP-restricted T-cells clones, there have been few analyses of the nature 0198-8859/97/$17.00 PII S0198-8859(97)00003-7

HLA-DPA1 Subtypes Affect Antigen Presentation

of the peptides presented by these molecules. It is un known how polymorphic differences within HLA-DP affect peptide binding and T-cell recognition. Approximately 60 DPB1 alleles have been described, but the pattern of polymorphism differs significantly from HLA-DR in that alleles represent different combinations of particular sequences found at 6 polymorphic sites in the B-chain [15, 16]. The HLA-DP alpha chain also has polymorphic variants, although the total number of DPA1 alleles is small, and only a few amino acid differences are seen [17–19]. It is interesting to note that although a very large number of different HLA-DP heterodimers could be produced by a combination of the known alleles, within particular human populations only a few alleles account for the majority of DP types seen. In this study we have examined the effects of HLA-DP polymorphism on T-cell recognition and proliferation. The T-cell clones used in this study were specific for a peptide derived from the mycobacterial 60 kilodalton heat shock protein (Mhsp60), which is recognized in the context of HLA-DP [20]. In previous reports we have described both the mapping of the antigenic peptides recognized by a variety of independently-isolated T-cell clones, and also the characterization of their T-cell receptors (TCR) [21]. T cells that recognized this DPrestricted epitope showed remarkable conservation of both Vb gene usage and CDR3 sequence in the TCR b-chain [22]. We now report that the recognition of antigenic peptides by these clones is sensitive to polymorphism of the DPA1 chain. MATERIALS AND METHODS T-Cell Clones The isolation and characterization of the T-cell clones used in this study have previously been reported in detail [20]. Clones were maintained by stimulation every 2 to 4 weeks with allogeneic irradiated PBMC, 1 mg/ml PHA (Wellcome, Beckenham, Kent UK) and 100 U/ml recombinant IL2 (Chiron, UK, Harefield, UK). Thereafter fresh medium containing 100 U/ml IL2 was added to the cultures every 3 to 4 days. T-cell clones were only tested in proliferative assays at least 10 days after restimulation with PHA. Cell Lines Used as Antigen-Presenting Cells HLA-typed Epstein-Barr virus-transformed lymphoblastoid cell lines (EBLCL) were kindly supplied by Dr. Susan Tonks, ICRF, Lincoln’s Inn Fields (London), or purchased from European Collection of Animal Cell Cultures, Porton Down, UK. Additional EBLCL were generated from local normal subjects; in addition to DPtyping by PCR and sequencing as described below, their HLA-DR alleles were determined by RT-PCR amplifi-

41

cation of DRB1-chain mRNA and typing with allelespecific oligonucleotides. Proliferation Assays T cells 2– 4 3 104 were cocultured with 5 to 10 3 104 antigen presenting cells (APC), either peripheral blood mononuclear cells (PBMC) (irradiated 2 Gy) or EpsteinBarr virus-transformed lymphoblastoid cell lines (EBLCL) (irradiated 6 Gy) in the presence of mycobacterial hsp60 or synthetic antigenic peptides. Both recombinant Mhsp60 (a kind gift from Dr. M. J. Colston, NIMR, Mill Hill, London) and PPD (Statenserumsinstitut, Copenhagen) were used as sources of hsp60; peptides were synthesized by fmoc chemistry (Alta Biosciences, Birmingham, UK) as previously described [21]. In some experiments APC were pulsed with antigens by incubation for 60 min at 37°C in 5% CO2 followed by thorough washing. T cells were cocultured with APC 6 antigen for 72 h; 3H-thymidine (0.2 mCi/well) was added for the last 18 h of culture and incorporation measured by harvesting and scintillation counting. Tcell proliferation is expressed as D c.p.m., i.e., after subtraction of the c.p.m. is obtained by culture of APC alone. Analysis of HLA-DP Alpha and Beta Chains Total RNA was isolated from 2 3 106 EBV LCL using RNAzol B (Biogenesis, Dorset, Poole, UK). One microgram of the total RNA was used for oligo(dT)12–18 primed cDNA synthesis. The reactions were performed using Superscript reverse transcriptase and supplied buffers (Life Technologies, Renfrewshire, Scotland) in a total reaction volume of 20 ml containing 1 mM dNTPs (Ultrapure DNA set; Pharmacia, Herts, UK), 10 mM Tris-HCl (pH 8.3), 10 mM DTT, 50 mM KCl, 6 mM MgCl2, and 200 U reverse transcriptase, and incubated at 42°C for 60 min. cDNA coding for the variable region of the N-terminal domain of the HLA-DP alpha or beta chains was amplified by PCR as follows; PCR was performed in 50 ml volumes containing 2 ml of the cDNA preparation, 0.2 mM dNTPs, 1.5 U Amplitaq polymerase (Perkin Elmer Cetus, Warrington, Cheshire, UK) in 10 mM Tris-HCl pH 7.8, 50 mM KCl, and 1.5 mM MgCl2 and 0.5 mM oligonucleotide primers (alpha chain forward primer 59GCGGACCATGTGTCAACTTAT39 and reverse primer 59CGTTCCAACCACACTCAG GCC39; beta chain forward primer 59AGGGCCACTCC AGAGAAT39, and reverse primer 59CTCGGCGCT GCAGGGTCA39). PCR amplification was performed for 30 cycles using the following parameters; 95°C for 45 seconds, 55°C for 30 seconds, and 72°C for 1 min. Polymerase chain reaction products were electrophoresed on a 1.5% low melting point gel and the DNA purified using the Qiaex DNA extraction method (Qiagen, Dork-

42

J. S. H. Gaston et al.

TABLE 1 Proliferative responses (Dc.p.m. 3H-thymidine incorporation) of T-cell clones to PPD, or amino acids of Mhsp60, presented by various EBLCL whose expression of DP alleles is as showna EBLCL

DPB1 alleles

CFEB LS40 DBB LZL AL10 BM92 PF97387 YAR

0301 1 0401 0301 1 0201 0401 0402 0401 0402 0401 1 0402 0401

CFB39 PPD 10 mg/ml

CF13 PPD 20 mg/ml

CFB39 peptide 92 10 mg/ml

CFB39 PPD 5 mg/ml

38619 57167 906 550 184

12301 36604 20 282 287

13629 20525

8599 10148

1211 714 790

2194 2504 2595

a c.p.m. for EBLCL cultured alone varied from experiment to experiment but was normally ,2,000. Dc.p.m. for T cells cocultured with LCL in the absence of antigen was always ,210. The sequence of peptide 9 is NSGLEPGVVAEK and of peptide 92 is GMEPGVVAEKVRNLSV (core epitopes for CF13 and CFB39 respectively are underlined).

ing, Surrey, UK). The PCR products were phosphorylated by treatment with T4 polynucleotide kinase and ligated into the dephosphorylated SmaI site of M13 mp18. Recombinants were sequenced by the enzymatic chain termination method, using the Sequenase Version 2.0 kit (Amersham, Little Chalfont, Bucks, UK) according to the manufacturer’s instructions. HLA DP alpha and beta chain subtypes were assigned by comparison with the published HLA class II nucleotide sequences. Molecular Modeling The three dimensional coordinates for the human class II MHC/peptide complex were kindly provided by Dr. L. Stern (Harvard University, Cambridge, MA). Alignments between the DPA1*0201 and DPB1*0301 and the corresponding sequences for DR1 were made using QUANTA 96 Protein Workbench (Molecular Simulations, Burlington, MA). Alignments were made to take into account minor differences including the deletions at positions 24 and 25 in the DPB1 chain. Allowing for these gaps, there is a 62.9% identity between the alpha chains and a 66.5% identity between the beta chains. The mycobacterial hsp60 peptide sequence was used in place of the HA peptide in DR1, with the assumption (based on the known importance of this residue) that the glutamic acid in this peptide occupied the major specificity binding pocket. The DP sequence was then superimposed on the X-ray coordinates of DR1 and the sidechains, and the regions around the insert and the gap were regularized. The whole structure was then minimized (10,000 steps, steepest descent algorithm) using the programme CHARMM [23]. RESULTS We have previously reported the isolation of T-cell clones specific for Mhsp60 from a DR4 homozygous patient with rheumatoid arthritis (CF), and mapping of

the antigenic epitope recognized, using synthetic peptides [20 –22]. All of the clones were shown by inhibition studies with HLA-specific monoclonal antibodies to be restricted by HLA-DP rather than HLA-DR, and this also applied to polyclonal T-cell responses mounted by this donor to Mhsp60. In our previous report, investigation of DP expression by patient CF using oligotyping techniques only identified a single allele, HLA DPB1*0401 [20]. To investigate HLA-DP expression in more detail we sequenced HLA-DPB1 cDNAs from CF cells; this showed expression of not only HLA-DPB1*0401, but also *0301. When allogeneic LCL expressing different DPB alleles were tested for their ability to present antigen to CF clones, using two independently derived T-cell clones, only the DPB1*0301-expressing cell line, LS40, was effective in presentation (Table 1). For EBLCL, which failed to stimulate the T-cell clones, the same result was observed whether intact antigen (recombinant Mhsp60 or PPD, which contains Mhsp60) or antigenic peptides were used, suggesting that they were not defective in antigen processing. In addition two LCL (CFEB and BM92), which differed markedly in their ability to present to the DP-restricted clones, expressed DRB1*0401 and were equally good at presenting PPD to a DR4-restricted clone (results not shown). This initial analysis, which suggested restriction by DPB1*0301, was extended by testing other LCLs expressing this allele. Surprisingly, there was a marked variation in the ability of these LCL to stimulate the T-cell clones, as shown in Table 2. This was most evident when comparing stimulation by soluble peptides, soluble intact antigens, and LCL pulsed with antigenic peptides for 60 min, followed by thorough washing to remove unbound peptides. Thus the well-characterized typing cell line Priess (HLA-DPB1*0301/*0401) was an efficient stimulator in the presence of soluble peptide but consistently failed to stimulate in the presence of intact

43

HLA-DPA1 Subtypes Affect Antigen Presentation

TABLE 2 Proliferative responses (Dc.p.m. 3H-thymidine incorporation) to antigen presented by cell lines Priess and JFEB EBLCL None CFEB LS40 Priess JFEB

DPA/B alleles — 0201 1 01/0301 1 0401 0201 1 01/0301 1 0201 01/0401 1 0301 0201 1 01/0101 1 0301

ND, not determined.

FIGURE 1 Responses (3H-thymidine incorporation) of clone CFB39 to: (a) antigenic peptide presented by the autologous LCL, CFEB, and the DPB1*0301 1 allogeneic LCL, Priess. Peptide was either present throughout the period of coculture at 20 mg/ml or added at various concentrations to the EBLCL for 60 min followed by thorough washing (“pulse”). (b) antigenic peptide presented by two DPB1*0301 1 allogeneic LCL, JFEB, and Priess, when the peptide was present throughout the period of coculture at various concentrations. Responses of CFB39 to peptide in the absence of antigen presenting cells are also shown in each case.

No antigen

15 mg/ml peptide A1

Pulsed with 20 mg/ml peptide A1

PPD 50 mg/ml

150 2158 323 209 165

4693 8029 17545 15546 15515

ND 11035 20548 2314 18722

2285 10931 24398 1001 3866

44

J. S. H. Gaston et al.

TABLE 3 Proliferative responses (Dc.p.m. 3H-thymidine incorporation) to antigen presented by EBLCL expressing DPA1*0201 EBLCL

DPA/B alleles

No antigen

11 mg/ml peptide 1208

Pulsed with 20 mg/ml peptide 1208

None CFEB VAVY WIN FPAF

— 01 1 0201/0301 1 0401 0201/0101 01 1 0201/1301 1 0401 0201/0201

201 257 56 0 210

3303 10731 1780 798 1480

ND 11296 4 14 216

Peptide 1208 has the same sequence as peptide 92 in Table 1 except for the substitution of L for M at position 2.

antigens or when pulsed with peptides. As shown in Fig. 1a, pulsing CFEB with as little as 0.2 mg/ml peptide was sufficient to stimulate a near maximum response from the clone, whereas pulsing Priess with 20 mg/ml was ineffective. Note that in these experiments, as in most others involving clone CFB39, a lower, but significant, proliferative response was seen when the clone was cultured with a high concentration of peptides in the absence of APC. This was because of T-T cell presentation of peptide, because human T-cell clones strongly express class II MHC antigens. However, the response to peptide presented by Priess was substantially greater than the response to peptide in the absence of APC, and indistinguishable from the maximum response obtained using CFEB or LS40. Comparisons of the response generated by Priess or JFEB with different amounts of soluble peptides showed no significant difference except at the lowest concentration tested (Fig. 1b). The other three LCL were able to stimulate fully when pulsed with peptide, and both CFEB and LS40 presented intact antigen. Cell line JFEB, established from a local donor, gave an equivocal response using intact antigen, FIGURE 2 Responses (3H-thymidine incorporation) of clone CFB39 to antigenic peptide presented by the autologous LCL, CFEB, and the DPB1*0301 1 allogeneic LCLs, LWAGS, and Priess. Peptide was either present throughout the period of coculture at 10 mg/ml, or added at 10 mg/ml to the EBLCL for 60 min followed by thorough washing (“pulse”); pulsed LCL were also tested in the presence of added peptide.

but when PBMC from the same donor were tested they were able to present intact antigen efficiently and to stimulate when pulsed with peptides (data not shown). This result suggested that JFEB, as is commonly observed with certain LCL, was relatively inefficient in processing intact antigen, but possessed the correct restriction element. Although this argument could in principle be applied to Priess with respect to intact antigen, it would not explain its inability to stimulate when pulsed with peptide. This led us to consider whether there might be a difference between the restriction element expressed by Priess and LCL, which is able to stimulate when pulsed with peptides. One possible difference in the restriction element could concern the DPA1 chain that shows limited polymorphism. Accordingly, we sequenced the DPA cDNAs from LS40, CFEB, and JFEB, and revealed that they were all heterozygous, expressing both DPA1*01 and *0201. (Although at one time three subtypes of DPA1*01 were thought to exist, this has now been refuted [19] and we shall use DPA1*01 throughout). In contrast, Priess expresses only DPA1*01, a result previously reported, and

HLA-DPA1 Subtypes Affect Antigen Presentation

45

FIGURE 3 Amino acid sequences of DPA1 and DPB1 alleles. The complete sequence of the first 114 amino acids of DPA1 is given. For DPB1 alleles only the regions within the first 114 amino acids that are polymorphic are shown. Intervening sequences are identical in all cases except for DRB1*0301 which has two additional changes—positions 11G/L; and 65 I/L.

confirmed in our laboratory. Together these results suggest that the optimal restriction element is DPA1*0201/ DPB1*0301. To check that stimulation was not a function of the correct DPA1 allele paired with any DPB1 allele, several other LCL expressing DPA1*0201 were tested but none stimulated whether pulsed with peptides, or in the presence of soluble peptides (Table 3). Finally, we obtained an additional cell line, LWAGS, expressing DPA1*01/DPB1*0301 to determine whether it would have the same properties as Priess. As shown in Figure 2 LWAGS and Priess were identical in being able to stimulate T-cell proliferation in the presence of peptides, but not when pulsed with peptides and then washed. DISCUSSION This is the first report of the influence of the DPA1 chain sequence on the ability of a DP-restricted T-cell clone to recognize antigen. Previously reported DP-restricted clones [9 –14], including one clone whose restriction element included DPB1*0301 [10], have not been tested for their sensitivity to DPA1 chain polymorphisms. DPA1*0201 is more common in Oriental populations, and recently T-cells lines have been isolated from Japanese subjects specific for a streptococcal protein and restricted by DPA1*0201/DPB1*0901; again the ability of these cells to respond in the context of DPA1*01 has not been tested [24]. The majority of DPB1*03011 typing cell lines express DPA1*01, but in addition to LS40 we were fortunate to identify a local donor with both DPA1*0201 and DPB1*0301. Comparison of the different HLA-DP alpha chain sequences highlights 6 amino acid differences between DPA1*01 and DPA1*0201; three are in the N-terminal domain (positions 31, 50, and 83) (Fig. 3). Residue 31 is likely to be of particular importance in forming the

major specificity pocket, and the single amino acid change from glutamine in DPA1*0201 to methionine in DPA1*01 could have major effects. There is considerable conservation of sequence in MHC class II alpha chains, and in murine I-Ak a single mutation in the alpha chain involved in the equivalent pocket abolished stable binding of a hen egg lysozyme peptide [25, 26]. Among different HLA-DR alleles most of the features of the P1 major specificity pocket are conserved, mainly because of the contribution of amino acid residues from the invariant DRA chain. It has been suggested that critical differences between the alpha chain of HLA-DP and HLA-DR at positions a7, a31, a43, and a51 would contribute to different binding properties of the P1 pocket. From studies of the DP-restricted recognition of streptococcal M12 proteins, it was suggested that DPA1*0201 favored peptides with charged residues (arginine or lysine) as N-terminal anchor residues, in contrast to the hydrophobic amino acids that occupy P1 in HLA-DR. However, the peptides used in the current study contain no suitably positioned, positively-charged, residues suggesting that this “rule” may be incorrect. Only one crystal structure of a class II MHC protein binding an antigenic peptide has been published, that of DR1. However, recent evidence suggests that the folding of most antigenic peptides in class II MHC molecules may follow the same pattern of taking up a proline helix [27] and, in modeling the interaction between the Mhsp60 peptide and HLA-DP, we have made this assumption. The functional data on the effects of the DPA1 allele are in keeping with the predictions of the model, because the proline helix conformation of the peptide allows an interaction between the N-terminal glutamic acid of the peptide and the polymorphic glutamine residue at position 31 (Fig. 4a, b). Alanine substitution experiments have demonstrated two glutamic

46

FIGURE 4 Model of antigenic peptide (GLEPGVVAEKV) bound to DPA1*0201/DPB1*0301 viewed by (a) looking down on the peptide binding groove and (b) side view displaying the N-terminal glutamic acid residue of the antigenic peptide interacting with the P1 pocket containing the polymorphic glutamine residue of the DPA1 chain at position 31. The possible interaction between a second critical glutamic acid in the peptide with position 69 of the DPB1 chain is also marked.

acid residues in the Mhsp60 peptide that are critical for binding to HLA-DP or interaction with the T-cell receptor [21]. If the N-terminal glutamic acid occupies the P1 pocket, the second critical glutamic acid (P5) could interact with lysine at position 69 of the DPB1 chain. Alternatively, an interaction between a glutamic acid and T-cell receptor B-chain is also possible because we have shown a highly conserved arginine in the CDR3 sequence of clones recognizing this peptide [22]. One of the other differences between DPA1*01 and *0201 is a change from glutamine to arginine at position 50, so it is possible that this positively-charged amino acid also has an important interaction with one of the critical glutamic acids in the antigenic peptide. However, our model does not suggest that either of the other two polymorphic residues in DPA1*0201 are as likely as residue 31 to be involved with peptide binding and in particular the arginine at position 50 points well away from the peptide binding groove. Site-directed mutagenesis experiments on the HLA DPA1 chain will be required to determine directly the relative importance of the changes at positions 31, 50, or 83. In relation to the effect of the DPB1 chain on restriction, DPB1*0301 only differs in two regions from

J. S. H. Gaston et al.

DPB1*0101, which fails to present (residues 35–36 and 55–57) (Fig. 4). Of these the valine at 36 and aspartic acid at 55 may prove to be of particular importance because the model suggests that their sidechains point into the antigen binding groove towards the peptide, whereas both glutamic acid at 56 and aspartic acid at position 57 point away from the groove on the outer face of the alpha helix. However, critical residues cannot be identified unequivocally within this region, because DPB1*0402, which is almost identical in sequence in these regions to DPB1*0301, also fails to present. Therefore the overall context of the DPB1 chain determines the effects of individual residues on antigen presentation. The combined effects of polymorphism in both the DPA1 and DPB1 chains are well illustrated by the results obtained using the cell line Priess. Priess expresses DPB1*0301, but paired with the “wrong” DPA1-chain; nevertheless presentation by this line was consistently seen, but only when peptide was present continuously throughout the proliferation assay. These results would be consistent with the DPA1*01/ DPB1*0301 heterodimer having a low affinity for peptides (hence the need for high concentrations, and the loss of peptides from pulsed APC), but retaining an ability to present to T cells. In an attempt to assess the binding of peptides to different HLA-DP heterodimers, we prepared two biotinylated antigenic peptides. Although these were efficient stimulators of T-cell clones (i.e. they were definitely capable of binding), flow cytometry could only detect minimal binding of peptides on cell lines expressing DPA1*0201/DPB1*0301, which could not be reliably distinguished from binding to DPA1*01/ DPB1*0301 ( J. Goodall, unpublished observations). In conclusion, in this study we have shown that the relatively limited polymorphism shown by DPA1 alleles can have important functional effects on T-cell recognition. This will need to be taken into account in future studies of HLA-DP restriction. It is also possible that some of the controversy related to whether DP mismatching is important in graft-versus-host disease might be solved by taking into account polymorphisms in DPA1 alleles, because in previous studies donors and recipients have only been investigated for their degree of matching at the DPB1 locus. A better understanding of the structural basis of interactions between HLA-DP and both antigenic peptides and T-cell receptors may also help to clarify whether there are aspects of these interactions that are not common to HLA-DR. These in turn may point to a unique role for antigen presentation by HLA-DP in immune responses. ACKNOWLEDGEMENTS

This work was supported by grants from MRC and the Wellcome Trust. We thank Ms. Sue Ramsey for excellent technical assistance.

47

HLA-DPA1 Subtypes Affect Antigen Presentation

REFERENCES 1. Moller G: HLA and disease susceptibility. Immunol Rev 70:1, 1983. 2. Stern L, Brown J, Jardetzky T, Gorga J, Urban R, Strominger J, Wiley D: Crystal structure of the human class II MHC protein HLA-DR1 complexed with an influenza peptide. Nature 368:215, 1994. 3. Odum N, Morling N, Friis J, Platz P, Ryder L, Svejgaard A: Increased frequency of HLA-DPw2 in pauciarticular chronic arthritis. Tissue Antigens 28:245, 1986. 4. MelinAldana H, Giannini E, Glass D: Immunogenetics of Early Onset pauciarticular juvenile rheumatoid arthritis. J Rheumatol 26(Suppl.):2, 1990. 5. Begovich A, Bugawan T, Nepom B, Klitz W, Nepom G, Erlich H: A specific HLA-DPb allele is associated with pauciarticular juvenile arthritis but not adult rheumatoid arthritis. Proc Natl Assoc Sci USA 86:9489, 1989. 6. Richeldi L, Sorrentino R, Saltini C: HLA-DPB1 glutamate 69: a genetic marker of beryllium disease. Science 262:242, 1993. 7. Young R, Wordsworth B, Pile K: HLA-DPB1*0401 is increased in atopic disease. Eur J Allergy Clin Immunol 47:8, 1992. 8. Kato Y, Mitsuishi Y, Cecka M, Hopfield J, Hunt L, Champlin R, Terasaki P, Gajewski J: HLA-DP incompatibilities and severe graft-versus-host disease in non-related bone marrow transplants. Transplantation 52:374, 1991. 9. Petersdorf E, Smith A, Mickelson E, Longton G, Anasetti C, Choo S, Martin P, Hansen J: The role of HLA-DPB1 disparity in the development of acute graft-versus-host disease following unrelated donor marrow transplantation. Blood 81:1923, 1993. 10. deKoster H, Anderson D, Termijtelen A: T cells sensitized to synthetic HLA-DR3 peptide give evidence of a continuous presentation of denatured HLA-DR3 molecules by HLA-DP. J Exp Med 169:1191, 1989. 11. Eckels D, Lake P, Lamb J, Johnson A, Shaw S, Woody J, Hartzman R: SB-restricted presentation of influenza and herpes simplex antigen to human T-lymphocyte clones. Nature 301:716, 1983. 12. Celis E, Karr R: Presentation of an immunodominant T-cell epitope of hepatitis B surface antigen by the HLADPw4 molecule. J Virol 63:747, 1989. 13. Higgins JA, Lamb JR, Marsh SGE, Tonks S, Hayball JD, Rosenbronson S, Bodmer JG, O’Hehir RE: Peptide-induced nonresponsiveness of HLA-DP restricted human T-cells reactive with dermatophagoides. J Allergy Clin Immunol 90:749, 1992. 14. Higgins JA, Thorpe CJ, Hayball JD, O’Hehir RE, Lamb JR: Overlapping T-cell epitopes in the group I allergen of dermatophagoides species restricted by HLA-DP and HLA-DR class II molecules. J Allergy Clin Immunol 93:891, 1994. 15. Hessner MJ, Baxterlowe LA: Characterization of novel

16.

17.

18.

19.

20.

21.

22.

23.

24.

25.

26.

27.

HLA-DPB1 alleles by oligotyping and nucleotide sequencing. Tissue Antigens 40:261, 1992. Tait B, Bodmer J, Erlich H, Ferrara G, Albert E, Begovich A, Kimura A, Varney M, Klitz W: DNA typing: DPA and DPB analysis. In HLA 1991, Vol 1, Tsuji K, Aizawa M, Sasaski T eds: Oxford, Oxford Scientific Publications, 1992, p 485. Bugawan T, Horn G, Long C, Mickelson E, Hansen J, Ferrara G, Angelini G, Erlich H: Analysis of HLA-DP allelic sequence polymorphism using the in vitro enzymatic DNA amplification of DPa and DPb loci. J Immunol 141:4024, 1988. Harada H, Kimura A, Dong RP, Xu XP, Bhatia K, Sasazuki T: Sequencing and population analysis of 4 novel HLA-DPA1 alleles. Hum Immunol 35:173, 1992. Rozemuller EH, Bouwens AGM, Vanoort E, Versluis LF, Marsh SGE, Bodner JG, Tilanus MGJ: Sequencing-based typing reveals new insight in HLA-DPA1 polymorphism. Tissue Antigens 45:57, 1995. Gaston J, Life P, van der Zee R, Jenner P, Colston M, Tonks S, Bacon P: Epitope specificity and MHC restriction of rheumatoid arthritis synovial T cell clones which recognize a mycobacterial 65 kDa heat shock protein. Int Immunol 3:965, 1991. Henwood J, Loveridge J, Bell JI, Gaston JSH: Restricted T-cell receptor expression by human T-cell clones specific for mycobacterial 65-kDa heat-shock protein—selective in vivo expansion of T-cells bearing defined receptors. Eur J Immunol 23:1256, 1993. Goodall JC, Henwood J, Bacon PA, Gaston JSH: Marked conservation of complementarity-determining region 3 of the beta-chain of TCRs recognizing a mycobacterial heat shock protein 60-derived peptide with strong sequence similarity to human heat shock protein 60. J Immunol 155:2329, 1995. Brooks B, Bruccoleri R, Olafson B, States D, Swaminathan S, Karplus M: CHARMM. a program for macromolecular energy minimization and dynamics calculations. J Comp Chem 4:187, 1983. Dong R-P, Kamikawaji N, Toida N, Fujita Y, Kimura A, Sasazuki T: Characterization of T cell epitopes restricted by HLA-DP9 in stretococcal M12 protein. J Immunol 154:4536, 1995. Nelson C, Viner N, Young S, Petzold S, Benoist C, Mathis D, Unanue E: Amino acid residues o the I-Ak alpha chain required for the binding and stability of two antigenic peptides. J Immunol 156:176, 1996. Lambert L, Unanue E: Analysis of the interaction of peptide hen egg white lysozyme (34 – 45) with the I-Ak molecule. J Immunol 143:802, 1989. Jardetzky T, Brown J, Gorga J, Stern L, Urban R, Strominger J, Wiley D: Crystallographic analysis of endogenous peptides associated with HLA-DR1 suggests a common polyproline ii-like conformation for bound peptides. Proc Natl Acad Sci USA 93:734, 1996.