Effect of thymoquinone on the resistance of Cronobacter sakazakii to environmental stresses and antibiotics

Food Control 109 (2020) 106944

Contents lists available at ScienceDirect

Food Control journal homepage: www.elsevier.com/locate/foodcont

Effect of thymoquinone on the resistance of Cronobacter sakazakii to environmental stresses and antibiotics

T

Yifei Chena, Qiwu Wena, Shan Chena, Du Guoa, Yunfeng Xub, Sen Liangc, Xiaodong Xiaa, Baowei Yanga, Chao Shia,∗ a

College of Food Science and Engineering, Northwest A&F University, Yangling, Shaanxi, 712100, China College of Food and Bioengineering, Henan University of Science and Technology, Luoyang, Henan, 471023, China c Beijing Advanced Innovation Center for Food Nutrition and Human Health, Beijing Technology and Business University, Beijing, 100048, China b

A R T I C LE I N FO

A B S T R A C T

Keywords: Thymoquinone Cronobacter sakazakii Infant formula Environmental stress Antibiotic Stress-tolerance genes

Cronobacter sakazakii is a foodborne bacterial pathogen with resistance to a wide range of stress conditions. Here, we investigated the effects of thymoquinone (TQ) on the environmental and antibiotic stress tolerance of C. sakazakii. After determining the subinhibitory concentrations (SICs) of TQ against C. sakazakii, changes in the percent survival of bacteria under heat, acid, desiccation, and hyperosmotic stress following exposure to TQ were investigated in tryptone soya broth (TSB) and reconstituted infant formula (RIF). We also monitored changes in the expression of stress tolerance-associated genes in the TQ-treated bacteria, and used a minimum inhibitory concentration assay to examine changes in the antibiotic sensitivity of C. sakazakii following TQ treatment. SICs of TQ of 200, 400, and 600 μM were selected for use in the assays. TQ-treated C. sakazakii strains showed a significant decrease in survival following exposure to high temperatures (50°C, 55°C, and 60°C), acidic pH (~3.3), high osmotic pressure (aw = 0.81), and desiccation (P < 0.05) compared with untreated controls in both TSB and RIF. TQ treatment also increased the sensitivity of C. sakazakii to ampicillin and cefoxitin. Moreover, real-time quantitative polymerase chain reaction (RT-qPCR) analysis revealed that the transcription levels of 15 genes associated with stress tolerance was downregulated following TQ treatment (600 μM). Therefore, our findings suggest that TQ has a significant negative impact on the stress tolerance of C. sakazakii, and provide a theoretical basis for the practical application of TQ as a natural antimicrobial agent in food production.

1. Introduction Cronobacter sakazakii, a Gram-negative, peritrichously flagellated, facultatively anaerobic, nonspore-forming bacterium, was classified as a member of the Cronobacter spp. in 2012 (Joseph et al., 2012). This pathogen mainly affects neonates and infants, causing life-threatening illnesses such as meningitis, bacteremia, and necrotizing enterocolitis (NEC) (Hunter & Bean, 2013). Between 2012 and 2016, several outbreaks of disease caused by C. sakazakii were reported globally (Henry & Fouladkhah, 2019). Alarmingly, the mortality rates of C. sakazakiiassociated infections in infants are extremely high, ranging from 50% to 80% (Healy et al., 2010). Although C. sakazakii is widely isolated from meat, vegetables, dairy products, and food processing equipment, powdered infant formula (PIF) is considered as the major vehicle of contamination and transmission (Jaradat, Ababneh, Saadoun, Samara, & Rashdan, 2009; Yan et al., 2012). During the manufacture, transport,

∗

and storage of PIF, as well as within the infected host, C. sakazakii encounters various environmental stresses including desiccation, heat, acid and high osmotic that can negatively impact survival. The resistance of C. sakazakii to unfavorable environmental conditions is a critical factor in its ability to survive and proliferate in PIF (Dancer, Mah, & Kang, 2009). In the food production industry, water activity (aw) is an important parameter affecting food quality and the survival and growth of microorganisms, especially bacteria. C. sakazakii has repeatedly been isolated from various dry foods such as PIF despite the low water activity (Yan et al., 2012). According to the literature, C. sakazakii displays a high tolerance to desiccation and can survive for at least 2 years in PIF (Osaili & Forsythe, 2009). High osmotic pressure is another ordeal to C. sakazakii during liquid milk concentration process in PIF manufacturing (Vogl, Knoblauch, & Beermann, 2011). C. sakazakii has been shown to reduce its metabolic rate under conditions of

Corresponding author. College of Food Science and Engineering, Northwest A&F University, 22 Xinong Road, Yangling, Shaanxi, 712100, China. E-mail address: [email protected] (C. Shi).

https://doi.org/10.1016/j.foodcont.2019.106944 Received 23 June 2019; Received in revised form 4 October 2019; Accepted 6 October 2019 Available online 07 October 2019 0956-7135/ © 2019 Elsevier Ltd. All rights reserved.

Food Control 109 (2020) 106944

Y. Chen, et al.

TQ at sub-inhibitory concentrations (SICs) on the resistance of C. sakazakii to various environmental stresses, including acid, heat, desiccation, and high osmotic pressure in TSB or RIF. In addition, the effects of TQ on the susceptibility of C. sakazakii to various antibiotics was also evaluated. Finally, changes in the relative transcription of environmental stress-associated genes in response to TQ treatment were also determined to identify the mechanism of inhibition.

hyperosmolality by shutting down amino acid biosynthesis and transport protein production (Burgess et al., 2016), in order to prevents too many transporters from transporting extracellular macromolecular osmolyte into cells and thereby damaging intracellular osmotic pressure (Begley & Hill, 2015). Another study showed that C. sakazakii could accumulate abundant trehalose, K+ and glutamate and uptake/ biosnthesis of compatible solutes such as polyols, sulfate esters, quaternary amines and their sulfonium analogs (Du, Wang, Dong, Li, & Wang, 2018), making it more resistant to osmotic and desiccation stress than other Enterobacteriaceae, including E. coli and Salmonella (Koseki, Nakamura, & Shiina, 2015). In general, Cronobacter spp. are more thermotolerant than most other members of the Enterobacteriaceae (Chang, Chiang, & Chou, 2010). In early study, the D-values at 72°C for C. sakazakii, S. Typhimurium, Shigella dysenteriae, Yersinia enterocolitica and E. coli were 1.30, 0.22, 0.13, 0.46 and 0.16 s, respectively (NazarowecWhite & Farber, 1997). C. sakazakii can grow at temperatures ranging from 6 to 45°C, with optimal growth observed at 37–43°C (Ueda, 2017). Huertas et al. (2015) examined the thermotolerance of C. sakazakii at different temperatures (50, 55, 60, 65 and 70°C), and found no significant bacterial inactivation in rehydrated PIF at 50–65°C. These studies confirm that C. sakazakii is highly resistant to heat stress. The acid environment of the human stomach is one of the principal defenses against pathogen invasion, protecting healthy individuals from the dangers of foodborne diseases (Smith, 2003). However, C. sakazakii exhibits a strong tolerance of acidic environments, surviving in media with pH values ranging from 2.5 to 4.5 for 5 h (Jang & Bang, 2011). A previous report showed that the pH of gastric juices from 6-day-old infants ranged from 2.9 to 5.3 before and after feeding, but increased to 4.6–5.8 in 7–15-day-old infants (Sondheimer, Clark, & Gervaise, 1985). Thus, the acidity of the stomach is lower in infants than in adults, further contributing to the increased incidence of C. sakazakii infection in newborns. In recent years, the prevention and treatment of C. sakazakii infection has attracted much attention worldwide. The traditional treatment for C. sakazakii infection is ampicillin combined with gentamicin or chloramphenicol, which was referred to as the gold standard of C. sakazakii treatments by Willis and Robinson (1988). Unfortunately, many bacteria, including C. sakazakii, have evolved high-level resistance to multiple antibiotics (Stock & Wiedemann, 2002). Dennison and Morris (2002) found that C. sakazakii was resistant to a variety of antibiotics, including ampicillin and gentamicin, while Shinnick and Varela (2002) detected multiple antibiotic resistance operons in the genome of C. sakazakii. Thus, researchers have focused on natural plant-based essential oils, which are non-antibiotic substances with antimicrobial activity. The incorporation of these alternative therapeutic compounds into treatment regimens has been proved proven to enhance the antimicrobial activity of traditional antibiotics (Bush et al., 2011). Thymoquinone (TQ) is the main biologically-active component of the volatile oil extracted from Nigella sativa seeds, which have been used for thousands of years as a spice and food preservative, and more recently in functional foods, nutraceuticals, and pharmaceutical products (Hassanien, Assiri, Alzohairy, & Oraby, 2015). Importantly, N. sativa has been designated a generally recognized as safe (GRAS) food ingredient by the Food and Drug Administration (GRAS 182.10). Studies have shown that TQ has antitumor, anti-inflammatory, antiparasitic, antioxidant, antihyperglycemic, and anticancer properties using animal- and cell-based models (Guan et al., 2018; Kus et al., 2018; Samarghandian, Azimi-Nezhad, & Farkhondeh, 2019). Our previous studies have demonstrated that TQ has good antibacterial activity against C. sakazakii in reconstituted infant formula (Shi et al., 2015), and can inhibit the motility, quorum sensing, endotoxin production, and biofilm formation of C. sakazakii (Shi et al., 2017). However, less is known about the effects of TQ on the environmental stress tolerance of C. sakazakii. The objective of the current study was to investigate the effects of

2. Materials and methods 2.1. Reagents TQ (Tokyo Chemical Industry Co., Tokyo, Japan; CAS: 490-91-5) stock solutions were prepared in 1% (v/v) dimethyl sulfoxide (DMSO) prior to use. DMSO is frequently used as an oil solubilizer for measuring the activity of natural antimicrobial agent (Hili, Evans, & Veness, 1997). The stock solutions were vortexed for 30 s at room temperature to dissolve the TQ. Antibiotics strips were purchased from Liofilchem Co., Ltd, Italy. The sorbitol is analytical reagent, purchased from Tianjin Kemio chemical reagent co., LTD. All other chemicals were of analytical grade. 2.2. Bacterial strains and culture conditions Three C. sakazakii strains (ATCC 29544, ATCC 12868, and CS 329) were used in the study. C. sakazakii ATCC 29544 and ATCC 12868 were purchased from the American Type Culture Collection (ATCC, Manassas, VA, USA). CS 329 is from our laboratory strain collection and was originally isolated from infant formula in China. All strains were stored in TSB with 20% (v/v) glycerol at −80°C. Before each experiment, stock cultures were streaked onto tryptone soya agar (TSA) and incubated at 37°C for 18 h. A loopful of each strain was inoculated into 30 mL of sterile TSB and incubated for 18 h at 37°C. Following incubation, the cultures were sedimented by centrifugation (8000×g for 10 min), washed twice, and resuspended in sterile TSB to an optical density at 600 nm (OD600) of 0.5. Aliquots (2 mL) of each strain suspension were then mixed. 2.3. Determination of the SICs of TQ The SICs of TQ were determined as previously described (Amalaradjou, Kim, & Venkitanarayanan, 2014), with some modifications. The SICs is defined as the highest concentration just below the MIC that does not inhibit growth of C. sakazakii. Sterile tubes containing TSB were inoculated with 6.0 log CFU of C. sakazakii, followed by the addition of TQ. TQ concentrations ranged from 0.2 to 2.4 mM, in increments of 0.2 mM. The tubes were incubated at 37°C for 24 h, and bacterial suspensions were plated on TSA directly or diluted appropriately to determine the CFU counts following incubation at 37°C for 24 h. The three highest concentrations (in mM) of TQ that did not inhibit bacterial growth after 24 h of incubation were selected as subinhibitory concentrations in subsequent assays. Duplicate tubes were inoculated for each TQ concentration and the experiment was repeated three times. 2.4. Growth curves The growth curves in TSB at 37°C were determined as previously described (Silva-Angulo et al., 2015). C. sakazakii strains ATCC 29544, ATCC 12868 and CS 329 were grown to an OD600 value of 0.2 in TSB respectively, then 125 μL of the culture was transferred into each well of a 96-well microtiter plate (Nunc, Copenhagen, Denmark). TQ was added to the cultures to obtain final concentrations of MIC, 1/2 MIC, 1/ 4 MIC, 1/8 MIC, and 1/16 MIC, and TSB was used as a negative control. Bacteria were further cultured at 37°C, and cell growth was monitored at 600 nm using a multimode plate reader (Tecan, Infinite™ M200 PRO, 2

Food Control 109 (2020) 106944

Y. Chen, et al.

Männedorf, Switzerland).

Table 1 Primers used for RT-qPCR analyses.

2.5. Preparation of RIF Commercial brand PIF was purchased from a supermarket in Yangling (Shaanxi, China) and reconstituted as per the instructions on the label. The formula (25.5 g) was rehydrated in 180 mL of sterile distilled water with agitation. The formula was then pasteurized at 63°C for 30 min to remove any bacterial contaminants. TQ was added to the formula to obtain the experimental SICs.

Genes

Sequence of primers (5′-3′)

ESA-04030a

Forward: GCCGCTGCGGACTGTATC Reserve: GCCGTCGGCATTGAATTC Forward: TCGATTGCGGCAAAGTGA Reserve: ACGCTGACGCGCTTCAA Forward: CGGTCAGCCAGATGGTTTAT Reserve: TCGGCGTCTTCGCTATCC Forward: GCTGGCTGTTGGCAATGG Reserve: CACATCCAGCGGCTTCACT Forward: ATGTCCAGCGATGACGAAG Reserve: GCAGCAGCAGGCGGTTA Forward: GCGAAATCGTGATCGAAACC Reserve: TCGCAGCCGGGTACGT Forward: AACCACCGGCGAATCTTTC Reserve: CGCGCCAACATCAACGTAT Forward: ACCCGCGAGTCCTTCCA Reserve: CCGTCTTCACCAGGAAGCAT Forward: CGCGAAGGAACGATGTCAT Reserve: CCACCACCAGCGAAATCAA Forward: TGAGCAACCTGGATCCGAAA Reserve: GGAGATCTTGTTGGACGGGA Forward: CGCGAAAGCCATACCATTG Reserve: TCCGCCTGGATTTTTTTACG Forward: TCGGCGCTGAATAAGGTCTAC Reserve: CGAAATATCGAGCGTGATGCT Forward: CTGGTGGATTCGTCAGACCAT Reserve: GCGAATCGTACGGGTTTGG Forward: TGCTTGAACAAACCGACAT Reserve: GCTCCACCTGCCACATCA Forward: CGTTATCCTGGTCGGTGG Reserve: GGCTGTGCTTGGTCGGG Forward: GCATTCGTCTGGCTGGTG Reserve: CGTCGGAACTTCAATCTCG

fur hfq groES grxB

2.6. Desiccation tolerance assay

Mfla-1165

C. sakazakii was grown to stationary phase in the presence (400 and 600 μM) or absence of TQ before being washed with phosphate-buffered saline (PBS) and resuspended in TSB or RIF. Aliquots (100 μL, 6.0 log CFU) of the cell suspensions were then transferred to 6-well culture plates (Nunclon; Nunc, Roskilde, Demark). After being air-dried at 40 °C in an incubator for 4 h, the plates were placed in a 25°C desiccator for 7 days. After desiccation, the bacteria would form a plaque on the 6-well plate. 1 mL TSB was extracted with pipette and the plaque was repeatedly cleaned so that it was suspended in TSB. At the specified time points, the dried bacterial suspensions were reconstituted in 1 mL of TSB and appropriate dilutions were plated onto TSA.

ompC ompR osmY ompA phoP phoQ rpoS

2.7. Osmotic stress tolerance assay

rpoN

Osmotic stress tolerance assays were conducted as described by Chang et al. (2010). Briefly, stationary-phase C. sakazakii cells grown in TSB containing TQ (0, 400 μM, 600 μM) were washed and resuspended in TSB or RIF containing 75% (w/v) sorbitol (aw = 0.81) to a final concentration of 6.0 log CFU/mL. The resuspended bacteria were then incubated at 25°C for 36 h. Samples were taken at specific intervals (0, 6, 12, 24, or 36 h) and diluted 10-fold with PBS for enumeration of surviving bacteria.

dnaK dnaJ

2.10. Minimum inhibitory concentration (MIC) of antibiotics to TQ-treated C. sakazakii assay The MICs of ampicillin and cefoxitin against C. sakazakii were evaluated using E-test® method, in accordance with the manufacturer's recommendations. Bacterial suspension was prepared as descried in 2.2 and then mixed with TQ (200, 400, or 600 μM) and incubated for 8 h at 37°C with agitation (100 rpm). Following centrifugation, the collected cells were washed twice with PBS and then resuspended in TSB to a final concentration of ~2 × 108 CFU/mL. A 100-μL volume of bacterial suspension was evenly plated on TSA and antibiotic strips (0.016–256 μg/mL) were placed onto the surfaces of the plates. The plates were then incubated at 37°C for 16 h. The MIC values were read directly from the test strip, with the elliptical zone of inhibition intersecting with the MIC scale on the strips.

2.8. Acid stress tolerance assay C. sakazakii was cultured in TSB supplemented with TQ (0, 400 μM, 600 μM) for 8 h at 37°C with agitation (100 rpm). Following incubation, bacterial cells were harvested by centrifugation at 5,000×g for 5 min, washed twice with PBS, and inoculated into TSB or RIF (pH adjust to 3.3) to a concentration of 6.0 log CFU/mL (Chang et al., 2010). Cultures were then incubated at 37°C for 0, 10, 20, 40, or 60 min. At specific time points during the incubation period, the number of surviving C. sakazakii cells was determined as before. 2.9. Heat stress tolerance assay The effect of TQ on the ability of C. sakazakii to survive heat stress was investigated at 50°C, 55°C, and 60°C as described previously (Amalaradjou & Venkitanarayanan, 2011), with some modifications. Bacterial cell pellets were resuspended in 30 mL of TSB containing 0, 400, or 600 μM TQ and then incubated at 37°C for 8 h to reach stationary phase. A 100-μL aliquot of the three-strain C. sakazakii mixture (6.0 log CFU) was added to a sterile pre-heated centrifuge tube containing 10 mL of TSB or RIF and then heated to 50°C, 55°C, or 60°C in a temperature-controlled shaking water bath. At different time points, sample tubes or aliquots of samples were removed and immediately cooled in an ice water bath. At 60°C, samples were removed at 0, 2, 4, 6, 8, and 10 min post-initiation of heat treatment. At 55°C, the samples were removed at 0, 20, 40, 60, 80, and 100 min, while at 50°C, aliquots were removed at 0, 30, 60, 90, and 120 min post-initiation of heat treatment. To determine the number of surviving bacteria, 100 μL aliquots of cooled sample were enumerated by plating directly or following serial dilution (1:10 in PBS) onto duplicate TSA plates.

2.11. RNA isolation and real-time quantitative polymerase chain reaction (RT-qPCR) assay Fifteen C. sakazakii genes associated with environmental stress tolerance were examined in this study (Table 1). These candidate genes were identified from the available literature and investigated using RTqPCR assays (Sobral et al., 2007). To obtain cDNA for RT-qPCR assays, the mixed C. sakazakii strains were incubated with SICs of TQ (0, 400 μM, or 600 μM) at 37°C for 8 h with agitation (100 rpm). Cells were pelleted by centrifugation at 5000×g for 5 min, washed twice, and then resuspended in PBS to OD600 = 0.5. Total RNA was extracted from the cell suspensions using an RNAprep Pure Cell/Bacteria Kit (TIANGEN, Beijing, China) according to the manufacturer's instructions. The quality, integrity, and concentration of the RNA were measured using a spectrophotometer (Nano-200; Aosheng Instrument Co., Hangzhou, China). RNA was then reverse transcribed into cDNA using a Takara PrimeScript RT Reagent Kit (Takara, Bio, Dalian, China) and stored at 3

Food Control 109 (2020) 106944

Y. Chen, et al.

−20°C until use. Specific primers and probes for each candidate gene (Table 1) were custom-synthesized by Takara Bio. Amplification and detection were carried out using an IQ5 Detection System (Bio-Rad Laboratories, Hercules, CA, USA). The cycling conditions consisted of 95°C for 30 s, 40 cycles of 95°C for 5 s and 60°C for 30 s, and a dissolution step of 95°C for 15 s and 60°C for 30 s. The resulting products were detected using SYBR Green. All samples were analyzed in triplicate. The transcription of the 16S rRNA gene was used to normalize gene transcription levels among samples.

3.4. Effect of TQ on C. sakazakii acid stress tolerance The effects of TQ on the acid stress tolerance of C. sakazakii are shown in Fig. 4. The percent survival of TQ-treated (400 and 600 μM) C. sakazakii cells in pH-adjusted TSB was two to three orders of magnitude lower than that of the control by 60 min post-inoculation (P < 0.05) (Fig. 4A). At 60 min post-inoculation, 600 μM TQ-treated C. sakazakii populations had dropped below the limits of detection. The observed survival trends were slightly different in pH-adjusted RIF (Fig. 4B). At 60 min post-inoculation, the percent survival of the 600 μM TQ-treated C. sakazakii cells decreased to 0.008% of the original inoculum (P < 0.01), compared with a value of 3% for the TQminus control.

2.12. Statistical analysis All experiments were carried out in triplicate. The mean value and standard deviation were calculated from the data obtained from the three separate experiments. Statistical analyses were performed using SPSS software (version 19.0; SPSS, Inc., Chicago, IL, USA). The data were presented as the mean values ± SD (n = 3) after applying an analysis of variance to the results using an independent Student's t-test. Differences between means were considered significant at P < 0.05.

3.5. Effect of TQ on C. sakazakii heat stress tolerance The efficacy of TQ in decreasing the thermotolerance of C. sakazakii at different temperatures in TSB and RIF is depicted in Fig. 5, and the Dvalues at different temperatures are shown in Table 2. In general, the survival rates of all three groups decreased over time. In TSB at 60°C, the percent survival of both of two TQ-treated groups dropped by five orders of magnitude (P < 0.01) (Fig. 5C). Similarly, the percent survival of the 600 μM TQ-treated C. sakazakii cells dropped by five orders of magnitude (P < 0.01) within 80 min of heating at 50°C and 55°C, and there was a 10-fold difference in the number of viable bacteria between the 400 μM TQ-treated and control groups (Fig. 5A and B). Compared with the control group, the D-values of TQ-treated C. sakazakii at three temperatures have remarkable difference (P < 0.05) (Table 2). The results of C. sakazakii heat tolerance assays in RIF are shown in Fig. 5D and E. The percent survival of the 600 μM TQ-treated bacteria was 0.0012%, 0.0015%, and 0.0016% of the initial inoculum at 50, 55, and 60°C, respectively. Similarly, the D-values of TQ-treated C. sakazakii in 600 μM at three temperatures were significantly different (P < 0.05) from that of the control group.

3. Results 3.1. SICs of TQ against C. sakazakii Growth curve analysis was used to examine the effects of TQ on the growth dynamics of the three C. sakazakii isolates. TQ had the greatest inhibitory effect on strain ATCC 29544, which was used as the representative strain in this study. The MIC of TQ against ATCC 29544 was 2.4 mM. At TQ concentrations of 1/2 MIC and below, there was very little inhibitory effect on the growth of C sakazakii. Therefore, 1/ 12 MIC (200 μM), 1/6 MIC (400 μM) and 1/4 MIC (600 μM) were selected as the SICs of TQ for use in the stress tolerance assays. Importantly, these concentrations of TQ also had no inhibitory effect on the growth of C. sakazakii strains ATCC 12868 and CS 329 (Fig. 1). 3.2. Effect of TQ on C. sakazakii desiccation tolerance

3.6. Effect of TQ on C. sakazakii antibiotic sensitivity At 6 h post-desiccation, the percent survival of C. sakazakii cultured in TSB with the two SICs of TQ decreased by two orders of magnitude (P < 0.01) to 0.185% (400 μM TQ-treated) and 0.167% (600 μM TQtreated) of the initial inoculum. Percent survival continued to decline over the experimental period, with values of 0.03% and 0.004%, respectively, at 7 days post-desiccation. In comparison, the TQ-minus control had a percent survival of 34.48% at 6 h post-desiccation, which decreased to 0.41% after 7 days (Fig. 2A). Similar results were obtained for C. sakazakii cultured in RIF supplemented with TQ. Overall, the TQ-treated cells showed a considerable decline (P < 0.05) in viability in the 12 h immediately after desiccation. The viability of all C. sakazakii cultures decreased slowly after 48 h. On day 7, percent survival values for the C. sakazakii control, 400 μM TQ-treated, and 600 μM TQ-treated groups were 0.4%, 0.02%, and 0.0037% of the initial inoculum, respectively (Fig. 2B).

The MICs of ampicillin and cefoxitin against TQ-treated and control C. sakazakii cultures are shown in Fig. 6 and Fig. 7. Compared with the control, the MICs of ampicillin against C. sakazakii treated with 200, 400, or 600 μM of TQ reduced by 0.5 μg/mL, 0.5 μg/mL, and 0.75 μg/ mL, respectively (Fig. 6B). For cefoxitin, the value of MIC was decreased correspondingly by 2 μg/mL, 2 μg/mL, and 3 μg/mL (Fig. 7B). 3.7. Effect of TQ on the expression of various C. sakazakii resistanceassociated genes The effects of TQ on C. sakazakii gene expression are shown in Table 3. TQ treatment resulted in a significant reduction (P < 0.05) in the transcription levels of all resistance-associated genes except rpoN. Importantly, the effect of TQ on gene expression appeared to be concentration-dependent, with 600 μM of TQ resulting in a greater decrease in gene expression compared with the 400 μM TQ treatment.

3.3. Effect of TQ on C. sakazakii osmotic stress tolerance

4. Discussion

After being cultured in TSB supplemented with 75% (w/v) sorbitol, the percent survival of C. sakazakii control-group cells decreased to 38% of the initial inoculum at 6 h post-inoculation but increased slightly to 44% at 36 h post-inoculation. The 400 μM TQ-treated cells showed a percent survival of 5.4% at 36 h post-inoculation (P < 0.05) (Fig. 3A). In RIF supplemented with 75% (w/v) sorbitol, the percent survival of the C. sakazakii control and 400 μM TQ-treated groups declined to 3.5% and 0.217% of the initial inoculum, respectively, at 36 h post-inoculation (Fig. 3B). Interestingly, the numbers of viable 600 μM TQ-treated C. sakazakii cells had fallen below detection limits in both the TSB and RIF media at 36 h post-inoculation.

Environmental tolerance of foodborne pathogenic bacteria is closely related to the contamination in food and the production of virulence factors in the host (Wesche, Gurtler, Marks, & Ryser, 2009). The abuse of antibiotics has led to the widespread emergence of antibiotic resistance amongst foodborne pathogens, making it increasingly difficult to treat cases of human foodborne bacterial infection (Truszczynski & Pejsak, 2013). Thus, eliminating the environmental stress tolerance of these pathogens will undoubtedly help in eliminating the threat to human health (Begley & Hill, 2015). Currently, a variety of natural 4

Food Control 109 (2020) 106944

Y. Chen, et al.

Fig. 1. Growth curves of C. sakazakii ATCC 29544 (A), ATCC 12868 (B), and CS 329 (C) cultured in TSB with various concentrations of TQ. Error bars represent the standard deviation (n = 3).

5

Food Control 109 (2020) 106944

Y. Chen, et al.

Fig. 2. Percent survival of C. sakazakii under desiccation stress. Panel (A) shows the survival of C. sakazakii cultured in TSB supplemented with TQ (0, 400, or 600 μM). Panel (B) shows the survival of C. sakazakii cultured in RIF supplemented with TQ (0, 400, or 600 μM). Error bars represent the standard deviation (n = 6).

transcription of both groES and mfla-1165 was downregulated by TQ. These findings confirmed that TQ has a negative effect on the expression of thermotolerance-associated genes in C. sakazakii, thus affecting the viability of bacteria at high temperatures. As a foodborne pathogen, C. sakazakii encounters the acidic environment of the host gastrointestinal tract. However, studies have shown that C. sakazakii can survive and grow under acidic conditions (Edelson-Mammel, Porteous, & Buchanan, 2006; Jang & Bang, 2011). In this study, we used hydrochloric acid to adjust the pH of the media to 3.3 to simulate the acidic environment in gastric juice of the susceptible population, and the culture period was based on the time required for digestion and absorption of food in the stomach (Calhoun, Lunoe, Du, Staba, & Christensen, 1999). As shown in Fig. 4, TQ treatment (600 μM) reduced the number of viable C. sakazakii cells by about 3 log CFU/mL, significantly reducing the acid resistance. Oliveira, Domingues, and Ferreira (2017) found that resveratrol, one of the natural products, reduced the resistance to heat and acid stresses of Staphylococcus aureus and Listeria monocytogenes. Iron acquisition protein Fur and signal transduction system PhoP/Q influence the acid stress responses of Enterobacteria (Bearson, Bearson, & Foster, 1997; Rowbury, 1995). Ling et al. (2018) constructed a ΔgrxB mutant of C. sakazakii and found that it had decreased resistance to acid stress. RT-qPCR results revealed that the transcription of phoP/phoQ, grxB, and fur was downregulated by TQ. Therefore, we hypothesize that TQ affects the acid tolerance of C. sakazakii in manifold ways, including the regulation of signal transduction via PhoP/Q, the expression of Fur, and the transcription of grxB.

antimicrobials have been reported to have good inhibitory effects on the survival and virulence factors of bacterial pathogens (Pisoschi et al., 2018; Silva, Zimmer, Macedo, & Trentin, 2016). However, less is known about how natural products reduce the resistance of foodborne pathogens to environmental stresses and antibiotics. This study focused on whether TQ could decrease the survival of the multi-stress-resistant bacterium C. sakazakii, providing useful information on this novel strategy for controlling foodborne pathogenic bacteria. Heat treatment is a typical method for controlling pathogenic bacteria in food while maintaining food quality and safety. The World Health Organization recommends that RIF should be standard pasteurized at least 70°C to alleviate the risk of C. sakazakii infection (WHO, 2007). However, in a real-life setting, it is unlikely that this guideline is followed by most parents when reconstituting PIF (Yang et al., 2015). Therefore, we chose three temperatures (50°C, 55°C, and 60°C) to simulate real-life conditions in our study of the effects of TQ on thermotolerance. The results showed that TQ could obviously reduce the heat tolerance of C. sakazakii at all three temperatures, and that the effect was positively correlated with the TQ concentration (Fig. 5). Esteban, Conesa, Huertas, and Palop (2015) reached similar conclusions when studying the effects of thymol on the heat tolerance of Bacillus, namely that thymol could reduce the heat tolerance and the effect depends on dose. Gene mfla-1165 is a biomarker for thermotolerance in C. sakazakii (Gajdosova et al., 2011), while groES codes for a heat-shock protein that enhances the thermotolerance of Bacillus subtilis (Dong et al., 2018). According to the RT-qPCR results, the

Fig. 3. Percent survival of C. sakazakii under osmotic stress. Panel (A) shows the survival of C. sakazakii cultured in TSB supplemented with TQ (0, 400, or 600 μM). Panel (B) shows the survival of C. sakazakii cultured in RIF supplemented with TQ (0, 400, or 600 μM). Error bars represent the standard deviation (n = 6). 6

Food Control 109 (2020) 106944

Y. Chen, et al.

Fig. 4. Percent survival of C. sakazakii under acid stress. Panel (A) shows the survival of C. sakazakii cultured in TSB supplemented with TQ (0, 400, or 600 μM). Panel (B) shows the survival of C. sakazakii cultured in RIF supplemented with TQ (0, 400, or 600 μM). Error bars represent the standard deviation (n = 6).

Fig. 5. Percent survival of C. sakazakii under heat stress. Panels (A), (B), and (C) show the survival of C. sakazakii cultured in TSB supplemented with TQ (0, 400, or 600 μM) following exposure to temperatures of 50, 55, and 60°C, respectively. Panels (D), (E), and (F) show the survival of C. sakazakii cultured in RIF supplemented with TQ (0, 400, or 600 μM) following exposure to temperatures of 50, 55, and 60°C, respectively. Error bars represent the standard deviation (n = 6). Table 2 D-values (min) of mixed C. sakazakii of 3 strains pre-exposed to different concentrations of TQ at 50°C, 55°C, 60°C. TQ concentration

D-values in TSB D55°C

D50°C 0 (Control) 400 μM 600 μM

D-values in RIF

a

34.20 ± 0.84 30.00 ± 0.86b 11.65 ± 1.80c

D60°C a

18.23 ± 0.73 7.32 ± 0.31b 4.90 ± 0.61c

D50°C a

2.34 ± 0.85 1.56 ± 0.21b 1.48 ± 0.12b

D55°C a

27.05 ± 2.02 16.59 ± 2.60b 10.62 ± 1.71c

Note: Data represent mean ± SD of 3 measurements; The different letter within a column are significantly (P < 0.05).

7

D60°C a

25.44 ± 0.93 13.13 ± 1.21b 9.68 ± 0.71c

2.98 ± 0.53a 2.61 ± 0.67a 1.32 ± 0.22b

Food Control 109 (2020) 106944

Y. Chen, et al.

Fig. 6. Panel (A) The inhibited ellipse of ampicillin strip against C. sakazakii treated with 0, 200, 400, or 600 μM of TQ. Panel (B) The MICs of ampicillin against C. sakazakii treated with 0, 200, 400, or 600 μM of TQ. Error bars represent the standard deviation of three replicates. *P < 0.05, **P < 0.01 versus the control.

Water activity is an important factor impacting the persistence of microorganisms in food (Chirife & Buera, 1996). Reducing water activity through desiccation is one of the general methods of preserving food (Leake, 2006). Dancer, Mah, Rhee, Hwang and Kang (2009) found that C. sakazakii exhibited unusual resistance to desiccation stress, which was dependent on the drying medium, while Breeuwer, Lardeau, Peterz, and Joosten (2003) showed that C. sakazakii could accumulate high concentrations of trehalose and betaine to help withstand osmotic stress. Further research revealed that C. sakazakii could decrease its metabolic rate by shutting down amino acid biosynthesis and transport protein production under hyperosmotic conditions (Riedel & Lehner, 2007). In this study, TQ significantly reduced the survival of C. sakazakii following desiccation and exposure to hyperosmotic conditions in a concentration-dependent manner (Figs. 2 and 3). Similar results have been obtained using trans-cinnamaldehyde to decreased the stress resistance of C. sakazakii (Amalaradjou & Venkitanarayanan, 2011). The sigma subunit of RNA polymerase (RpoS) is a general stress response regulator, regulating metabolism to protect C. sakazakii under various stress conditions (Alvarez-Ordonez, Begley, & Hill, 2012; Lombardo, Aponyi, & Rosenberg, 2004). Another sigma factor, RpoN, was reported to be the main signal factor regulating bacterial responses to hyperosmotic conditions (Alvarez-Ordonez et al., 2014). Three porins OmpC,

Table 3 Fold changes in the transcription of stress tolerance-associated genes in C. sakazakii in response to SICs of TQ. Genes

rpoS rpoN fur hfq phoP phoQ mfla ompR ompC ompA osmY dnaK dnaJ grxB groES

Gene transcription level 0 (Control)

400 μM TQ

600 μM TQ

1 1 1 1 1 1 1 1 1 1 1 1 1 1 1

−1.13 ± 0.19* 2.95 ± 0.12* −1.01 ± 0.64 −2.18 ± 0.46* −1.3 ± 0.29* −1.98 ± 0.62* −2.99 ± 0.4* −1.39 ± 0.32* −1.77 ± 0.56* −1.81 ± 0.23* −5.88 ± 0.84** −1.56 ± 0.33* −2.95 ± 0.76* −0.44 ± 0.21 −2.17 ± 0.67*

−3.53 ± 0.22** −4.19 ± 0.02** −4.64 ± 0.16** −8.75 ± 0.25** −2.3 ± 0.52* −2.25 ± 0.3* −3.35 ± 0.03** −2.77 ± 0.44* −2.44 ± 0.88* −7.35 ± 0.62** −8.05 ± 0.02** −5.05 ± 0.47** −6.06 ± 0.52** −1.65 ± 0.71* −2.69 ± 0.09*

Note: Data are expressed as the mean ± standard error (n = 3), *P < 0.05, **P < 0.01.

Fig. 7. Panel (A) The inhibited ellipse of cefoxitin strip against C. sakazakii treated with 0, 200, 400, or 600 μM of TQ. Panel (B) The MICs of cefoxitin against C. sakazakii treated with 0, 200, 400, or 600 μM of TQ. Error bars represent the standard deviation of three replicates. *P < 0.05, **P < 0.01 versus the control. 8

Food Control 109 (2020) 106944

Y. Chen, et al.

levels of 15 genes related to stress tolerance was altered in response to TQ treatment. Thus, our results suggest that TQ has a beneficial effect in reducing the multifaceted stress tolerance of C. sakazakii, providing a theoretical basis for controlling pathogenic bacteria in food production and the possibility of a combined antibiotic therapy to treat foodborne diseases.

OmpR, and OsmY were involved in transporting osmoprotectants across the bacterial cytoplasmic membrane under hyperosmotic conditions (Pratt, Hsing, Gibson, & Silhavy, 1996; Riedel & Lehner, 2007). Hfq, DnaK, DnaJ, and another outer membrane protein OmpA which is considered as a virulence factor have been proved to have relation to the survival of C. sakazakii under desiccation stress (Jameelah, Dewanti-Hariyadi, & Nurjanah, 2018). In our study, rpoN expression was upregulated by 400 μM TQ treatment, but was significantly downregulated following treatment with 600 μM of TQ. There is a competition between rpoN and rpoS which is about σ factors for core polymerase (Dong, Yu, & Schellhorn, 2011). We therefore speculate that the transcription of rpoS was inhibited by treatment with TQ at 400 μM, and that the increase in available core polymerase resulted in an increase in the transcription of rpoN. When the concentration of TQ increased, the synthesis of core polymerase was completely inhibited, so that the expression of rpoS and rpoN was significantly decreased. Thus, TQ treatment altered the expression of genes related to desiccation and hyperosmotic stress resistance in C. sakazakii. We found that the results from the two different experimental systems (RIF and TSB) were not always in agreement. In the heat and desiccation tolerance experiments, percent survival of the bacteria was higher in RIF than in TSB, which may be related to the different components of the media. Many studies have shown that the components of a culture medium affect bacterial growth (Dancer, Mah, & Kang, 2009; Stepanovic, Dakic, Opavski, Jezek, & Ranin, 2003). RIF contains lactose, protein, and lipids, which can protect bacterial cells from lysing during drying and heating (Lin & Beuchat, 2007), it also confirms our results from the side. The same results could be seen in the experiment of C. sakazakii's resistance to acid, when the proteins in RIF are hydrolyzed, consuming part of H+ ions and causing the pH of the solution to increase to the isoelectric point (pI) of the proteins, causing flocculation (Tangsuphoom & Coupland, 2008). We therefore surmise that the flocculated proteins may protect bacterial cells, thereby enhancing acid stress tolerance. Antibiotics are commonly used to treat bacterial infections. However, bacteria become less sensitive to antibiotics after prolonged and extensive exposure (Berkowitz, 1995). Recent studies have shown that some C. sakazakii strains are resistant to more than one antibiotic (Parra-Flores et al., 2018). Our results showed that TQ treatment increased the sensitivity of C. sakazakii to ampicillin and cefoxitin in a concentration-dependent manner (Figs. 6 and 7). Zanini, Silva-Angulo, Rosenthal, Rodrigo, and Martinez (2014) found that citral and carvacrol affect membrane permeability and integrity in L. monocytogenes, thereby increasing the sensitivity to erythromycin and colistin. Our previous studies have shown that TQ can change the permeability of C. sakazakii cell membranes and destroy their integrity (Shi et al., 2018). In addition, when bacteria form biofilms, the relative impermeability of antibiotics reduces the sensitivity of bacterial cells to antibiotics and leads to resistance (Lahiri, Dash, Dutta, & Nag, 2019). We also found that TQ has the anti-biofilm formation potential to C. sakazakii (Shi et al., 2017). Synergy between essential oil components and antibiotics has been the focus of much research in recent years, and combining existing antibiotics with phytochemicals could enhance the efficacy of antibiotics (Langeveld, Veldhuizen, & Burt, 2014). Our findings may contribute to reducing the dosage of antibiotics in preventing and treating the infection of C. sakazakii.

Declaration of competing interest The authors declare that there are no conflicts of interest. Acknowledgments This work was supported by National Natural Science Foundation of China (31801659), the Fundamental Research Funds for the Central Universities of China (2452017228) and General Financial Grant from the China Postdoctoral Science Foundation (No. 2017M623256). References Alvarez-Ordonez, A., Begley, M., Clifford, T., Deasy, T., Collins, B., & Hill, C. (2014). Transposon mutagenesis reveals genes involved in osmotic stress and drying in Cronobacter sakazakii. Food Research International, 55, 45–54. https://doi.org/10. 1016/j.foodres.2013.10.037. Alvarez-Ordonez, A., Begley, M., & Hill, C. (2012). Polymorphisms in rpoS and stress tolerance heterogeneity in natural isolates of Cronobacter sakazakii. Applied and Environmental Microbiology, 78(11), 3975–3984. https://doi.org/10.1128/aem. 07835-11. Amalaradjou, M. A. R., Kim, K. S., & Venkitanarayanan, K. (2014). Sub-inhibitory concentrations of trans-cinnamaldehyde attenuate virulence in Cronobacter sakazakii in vitro. International Journal of Molecular Sciences, 15(5), 8639–8655. https://doi.org/ 10.3390/ijms15058639. Amalaradjou, M. A. R., & Venkitanarayanan, K. (2011). Effect of trans-cinnamaldehyde on reducing resistance to environmental stresses in Cronobacter sakazakii. Foodborne Pathogens and Disease, 8(3), 403–409. https://doi.org/10.1089/fpd.2010.0691. Bearson, S., Bearson, B., & Foster, J. W. (1997). Acid stress responses in enterobacteria. FEMS Microbiology Letters, 147(2), 173–180. https://doi.org/10.1016/s03781097(96)00503-4. Begley, M., & Hill, C. (2015). Stress adaptation in foodborne pathogens. Annual Review of Food Science and Technology, 6, 191–210. https://doi.org/10.1146/annurev-food030713-092350. Berkowitz, F. E. (1995). Antibiotic-resistance in bacteria. Southern Medical Journal, 88(8), 797–804. https://doi.org/10.1097/00007611-199508000-00001. Breeuwer, P., Lardeau, A., Peterz, M., & Joosten, H. M. (2003). Desiccation and heat tolerance of Enterobacter sakazakii. Journal of Applied Microbiology, 95(5), 967–973. https://doi.org/10.1046/j.1365-2672.2003.02067.x. Burgess, C. M., Gianotti, A., Gruzdev, N., Holah, J., Knochel, S., Lehner, A., et al. (2016). The response of foodborne pathogens to osmotic and desiccation stresses in the food chain. International Journal of Food Microbiology, 221, 37–53. https://doi.org/10. 1016/j.ijfoodmicro.2015.12.014. Bush, K., Courvalin, P., Dantas, G., Davies, J., Eisenstein, B., Huovinen, P., et al. (2011). Tackling antibiotic resistance. Nature Reviews Microbiology, 9(12), 894–896. https:// doi.org/10.1038/nrmicro2693. Calhoun, D. A., Lunoe, M., Du, Y., Staba, S. L., & Christensen, R. D. (1999). Concentrations of granulocyte colony-stimulating factor in human milk after in vitro simulations of digestion. Pediatric Research, 46(6), 767–771. https://doi.org/10. 1203/00006450-199912000-00021. Chang, C. H., Chiang, M. L., & Chou, C. C. (2010). The effect of heat shock on the response of Cronobacter sakazakii to subsequent lethal stresses. Foodborne Pathogens and Disease, 7(1), 71–76. https://doi.org/10.1089/fpd.2009.0345. Chirife, J., & Buera, M. D. (1996). Water activity, water glass dynamics, and the control of microbiological growth in foods. Critical Reviews in Food Science and Nutrition, 36(5), 465–513. https://doi.org/10.1080/10408399609527736. Dancer, G. I., Mah, J. H., & Kang, D. H. (2009a). Influences of milk components on biofilm formation of Cronobacter spp. (Enterobacter sakazakii). Letters in Applied Microbiology, 48(6), 718–725. https://doi.org/10.1111/j.1472-765x.2009.02601.x. Dancer, G. I., Mah, J. H., Rhee, M. S., Hwang, I. G., & Kang, D. H. (2009b). Resistance of Enterobacter sakazakii (Cronobacter spp.) to environmental stresses. Journal of Applied Microbiology, 107(5), 1606–1614. https://doi.org/10.1111/j.1365-2672.2009. 04347.x. Dennison, S. K., & Morris, J. (2002). Multiresistant Enterobacter sakazakii wound infection in an adult. Infections in Medicine, 19(11), 533–535. Dong, Z. X., Chen, X. L., Cai, K., Shen, P. L., Tian, K. M., Jin, P., et al. (2018). Overexpression of the Bacillus licheniformis GroES enhances thermotolerance of Bacillus subtilis WB600. Biotechnology & Biotechnological Equipment, 32(6), 1527–1532. https://doi.org/10.1080/13102818.2018.1517029. Dong, T., Yu, R., & Schellhorn, H. (2011). Antagonistic regulation of motility and transcriptome expression by RpoN and RpoS in Escherichia coli. Molecular Microbiology, 79(2), 375–386. https://doi.org/10.1111/j.1365-2958.2010.07449.x. Du, X. J., Wang, X. Y., Dong, X., Li, P., & Wang, S. (2018). Characterization of the

5. Conclusion In this study, TQ-treated C. sakazakii strains were evaluated for heat, acid, desiccation, and hyperosmotic stress tolerance using an agar plate dilution method. Significant decreases in the tolerance of C. sakazakii to all tested stress conditions following TQ treatment were observed in both experimental systems (TSB and RIF). In addition, TQ treatment increased the sensitivity of C. sakazakii to ampicillin and cefoxitin. Further, RT-qPCR analysis indicated that the transcription 9

Food Control 109 (2020) 106944

Y. Chen, et al.

https://doi.org/10.1016/j.foodcont.2016.11.011. Osaili, T., & Forsythe, S. (2009). Desiccation resistance and persistence of Cronobacter species in infant formula. International Journal of Food Microbiology, 136(2), 214–220. https://doi.org/10.1016/j.ijfoodmicro.2009.08.006. Parra-Flores, J. P., Aguirre, J., Juneja, V., Jackson, E. E., Cruz-Cordova, A. C., SilvaSanchez, J. S., et al. (2018). Virulence and antibiotic resistance profiles of Cronobacter sakazakii and Enterobacter spp. involved in the diarrheic hemorrhagic outbreak in Mexico. Frontiers in Microbiology, 9, 2206. https://doi.org/10.3389/fmicb.2018. 02206. Pisoschi, A. M., Pop, A., Georgescu, C., Turcus, V., Olah, N. K., & Mathe, E. (2018). An overview of natural antimicrobials role in food. European Journal of Medicinal Chemistry, 143, 922–935. https://doi.org/10.1016/j.ejmech.2017.11.095. Pratt, L. A., Hsing, W. H., Gibson, K. E., & Silhavy, T. J. (1996). From acids to osmZ: Multiple factors influence synthesis of the OmpF and OmpC porins in Escherichia coli. Molecular Microbiology, 20(5), 911–917. https://doi.org/10.1111/j.1365-2958.1996. tb02532.x. Riedel, K., & Lehner, A. (2007). Identification of proteins involved in osmotic stress response in Enterobacter sakazakii by proteomics. Proteomics, 7(8), 1217–1231. https:// doi.org/10.1002/pmic.200600536. Rowbury, R. J. (1995). An assessment of environmental-factors influencing acid tolerance and sensitivity in Escherichia coli, Salmonella spp. and other Enterobacteria. Letters in Applied Microbiology, 20(6), 333–337. https://doi.org/10.1111/j.1472-765x.1995. tb01314.x. Samarghandian, S., Azimi-Nezhad, M., & Farkhondeh, T. (2019). Thymoquinone-induced antitumor and apoptosis in human lung adenocarcinoma cells. Journal of Cellular Physiology, 234(7), 10421–10431. https://doi.org/10.1002/jcp.27710. Shi, C., Jia, Z., Chen, Y., Yang, M., Liu, X., Sun, Y., et al. (2015). Inactivation of Cronobacter sakazakii in reconstituted infant formula by combination of thymoquinone and mild heat. Journal of Applied Microbiology, 119(6), 1700–1706. https://doi. org/10.1111/jam.12964. Shinnick, S. G., & Varela, M. F. (2002). Altered sugar selection and transport conferred by spontaneous point and deletion mutations in the lactose carrier of Escherichia coli. Journal of Membrane Biology, 189(3), 191–199. https://doi.org/10.1007/s00232-0021013-9. Shi, C., Sun, H., Sun, Z., Guo, D., Zhang, W., Sun, Y., et al. (2018). Antimicrobial activity of thymoquinone against Cronobacter sakazakii. Shipin Kexue/Food Science, 39(1), 58–64. https://doi.org/10.7506/spkx1002-6630-201801009. Shi, C., Yan, C. H., Sui, Y., Sun, Y., Guo, D., Chen, Y. F., et al. (2017). Thymoquinone inhibits virulence related traits of Cronobacter sakazakii ATCC 29544 and has antibiofilm formation potential. Frontiers in Microbiology, 8, 2220. https://doi.org/10. 3389/fmicb.2018.00290. Silva-Angulo, A. B., Zanini, S. F., Rosenthal, A., Rodrigo, D., Klein, G., & Martinez, A. (2015). Comparative study of the effects of citral on the growth and injury of Listeria innocua and Listeria monocytogenes cells. PLoS One, 10(2). Silva, L. N., Zimmer, K. R., Macedo, A. J., & Trentin, D. S. (2016). Plant natural products targeting bacterial virulence factors. Chemical Reviews, 116(16), 9162–9236. https:// doi.org/10.1021/acs.chemrev.6b00184. Smith, J. L. (2003). The role of gastric acid in preventing foodborne disease and how bacteria overcome acid conditions. Journal of Food Protection, 66(7), 1292–1303. https://doi.org/10.4315/0362-028x-66.7.1292. Sobral, R. G., Jones, A. E., Etages, S. G. D., Dougherty, T. J., Peitzsch, R. M., Gaasterland, T., et al. (2007). Extensive and genome-wide changes in the transcription profile of Staphylococcus aureus induced by modulating the transcription of the cell wall synthesis gene murF. Journal of Bacteriology, 189(6), 2376–2391. https://doi.org/10. 1128/JB.01439-06. Sondheimer, J. M., Clark, D. A., & Gervaise, E. P. (1985). Continuous gastric pH measurement in young and older healthy preterm infants receiving formula and clear liquid feedings. Journal of Pediatric Gastroenterology and Nutrition, 4(3), 352–355. https://doi.org/10.1097/00005176-198506000-00005. Stepanovic, S., Dakic, I., Opavski, N., Jezek, P., & Ranin, L. (2003). Influence of the growth medium composition on biofilm formation by Staphylococcus sciuri. Annals of Microbiology, 53(1), 63–74. Stock, I., & Wiedemann, B. (2002). Natural antibiotic susceptibility of Enterobacter amnigenus, Enterobacter cancerogenus, Enterobacter gergoviae and Enterobacter sakazakii strains. Clinical Microbiology and Infections, 8(9), 564–578. https://doi.org/10.1046/j. 1469-0691.2002.00413.x. Tangsuphoom, N., & Coupland, J. N. (2008). Effect of pH and ionic strength on the physicochemical properties of coconut milk emulsions. Journal of Food Science, 73(6), E274–E280. https://doi.org/10.1111/j.1750-3841.2008.00819.x. Truszczynski, M., & Pejsak, Z. (2013). Sources and routes of spread of antibiotic resistance of bacteria. Medycyna Weterynaryjna, 69(4), 203–207. Ueda, S. (2017). The effects of temperature on the growth and heat resistance of Cronobacter spp. Biocontrol Science, 22(2), 125–129. https://doi.org/10.4265/bio.22. 125. Vogl, N., Knoblauch, A., & Beermann, C. (2011). Risk-assessment of Cronobacter sakazakii contamination of spray-drying processes within infant milk formula production: DValue examination, biofilm formation; decontamination models. International Journal of Medical Microbiology, 301 58-58. Wesche, A. M., Gurtler, J. B., Marks, B. P., & Ryser, E. T. (2009). Stress, sublethal injury, resuscitation, and virulence of bacterial foodborne pathogens. Journal of Food Protection, 72(5), 1121–1138. https://doi.org/10.4315/0362-028x-72.5.1121. Willis, J., & Robinson, J. E. (1988). Enterobacter sakazakii meningitis in neonates. The Pediatric Infectious Disease Journal, 7(3), 196–199. https://doi.org/10.1097/ 00006454-198803000-00012. Yan, Q. Q., Condell, O., Power, K., Butler, F., Tall, B. D., & Fanning, S. (2012). Cronobacter species (formerly known as Enterobacter sakazakii) in powdered infant formula: A

desiccation tolerance of Cronobacter sakazakii strains. Frontiers in Microbiology, 9, 2867. https://doi.org/10.3389/fmicb.2018.02867. Edelson-Mammel, S., Porteous, M. K., & Buchanan, R. L. (2006). Acid resistance of twelve strains of Enterobacter sakazakii, and the impact of habituating the cells to an acidic environment. Journal of Food Science, 71(6), M201–M207. https://doi.org/10.1111/j. 1750-3841.2006.00101.x. Esteban, M. D., Conesa, R., Huertas, J. P., & Palop, A. (2015). Effect of thymol in heating and recovery media on the isothermal and non-isothermal heat resistance of Bacillus spores. Food Microbiology, 48, 35–40. https://doi.org/10.1016/j.fm.2014.11.016. FAO/WHO (2007). Safe preparation, storage and handling of powdered infant formula: Guidelines. Geneva World Health Organization, 1(3), 265. http://www.who.int/ foodsafety/publications/powdered-infant-formula/en/. Gajdosova, J., Orieskova, M., Kaclikova, E., Tothova, L., Drahovska, H., & Turna, J. (2011). Molecular characterisation of region conferring increased thermotolerance of Cronobacter sakazakii strains. FEBS Journal, 278 78-78. Guan, D., Li, Y., Peng, X., Zhao, H., Mao, Y., & Cui, Y. (2018). Thymoquinone protects against cerebral small vessel disease: Role of antioxidant and anti-inflammatory activities. Journal of Biological Regulators & Homeostatic Agents, 32(2), 225–231. Hassanien, M. F. R., Assiri, A. M. A., Alzohairy, A. M., & Oraby, H. F. (2015). Healthpromoting value and food applications of black cumin essential oil: An overview. Journal of Food Science and Technology-Mysore, 52(10), 6136–6142. https://doi.org/ 10.1007/s13197-015-1785-4. Healy, B., Cooney, S., O'Brien, S., Iversen, C., Whyte, P., Nally, J., et al. (2010). Cronobacter (Enterobacter sakazakii): An opportunistic foodborne pathogen. Foodborne Pathogens and Disease, 7(4), 339–350. https://doi.org/10.1089/fpd.2009.0379. Henry, M., & Fouladkhah, A. (2019). Outbreak history, biofilm formation, and preventive measures for control of Cronobacter sakazakii in infant formula and infant care settings. Microorganisms, 7(3), 77. https://doi.org/10.3390/microorganisms7030077. Hili, P., Evans, C. S., & Veness, R. G. (1997). Antimicrobial action of essential oils: The effect of dimethylsulphoxide on the activity of cinnamon oil. Letters in Applied Microbiology, 24(4), 269–275. https://doi.org/10.1046/j.1472-765X.1997.00073.x. Huertas, J. P., Alvarez-Ordonez, A., Morrissey, R., Ros-Chumillas, M., Esteban, M. D., Mate, J., et al. (2015). Heat resistance of Cronobacter sakazakii DPC 6529 and its behavior in reconstituted powdered infant formula. Food Research International, 69, 401–409. https://doi.org/10.1016/j.foodres.2015.01.010. Hunter, C. J., & Bean, J. F. (2013). Cronobacter: An emerging opportunistic pathogen associated with neonatal meningitis, sepsis and necrotizing enterocolitis. Journal of Perinatology, 33(8), 581–585. https://doi.org/10.1038/jp.2013.26. Jameelah, M., Dewanti-Hariyadi, R., & Nurjanah, S. (2018). Expression of rpoS, ompA and hfq genes of Cronobacter sakazakii strain Yrt2a during stress and viable but nonculturable state. Food Science and Biotechnology, 27(3), 915–920. https://doi.org/10. 1007/s10068-018-0313-5. Jang, S. R., & Bang, W. S. (2011). Acid resistance of Cronobacter sakazakii. Korean Journal for Food Science of Animal Resources, 31(4), 551–556. https://doi.org/10.5851/kosfa. 2011.31.4.551. Jaradat, Z. W., Ababneh, Q. O., Saadoun, I. M., Samara, N. A., & Rashdan, A. M. (2009). Isolation of Cronobacter spp. (formerly Enterobacter sakazakii) from infant food, herbs and environmental samples and the subsequent identification and confirmation of the isolates using biochemical, chromogenic assays, PCR and 16S rRNA sequencing. BMC Microbiology, 9(1), 225. https://doi.org/10.1186/1471-2180-9-225. Joseph, S., Cetinkaya, E., Drahovska, H., Levican, A., Figueras, M. J., & Forsythe, S. J. (2012). Cronobacter condimenti sp. nov., isolated from spiced meat, and Cronobacter universalis sp. nov., a species designation for Cronobacter sp. genomospecies 1, recovered from a leg infection, water and food ingredients. International Journal of Systematic and Evolutionary Microbiology, 62, 1277–1283. https://doi.org/10.1099/ ijs.0.032292-0. Koseki, S., Nakamura, N., & Shiina, T. (2015). Comparison of desiccation tolerance among Listeria monocytogenes, Escherichia coli O157:H7, Salmonella enterica, and Cronobacter sakazakii in powdered infant formula. Journal of Food Protection, 78(1), 104–110. https://doi.org/10.4315/0362-028x.jfp-14-249. Kus, G., Ozkurt, M., Kabadere, S., Erkasap, N., Goger, G., & Demirci, F. (2018). Antiproliferative and antiapoptotic effect of thymoquinone on cancer cells in vitro. Bratislava Medical Journal-Bratislavske Lekarske Listy, 119(5), 312–316. https://doi. org/10.4149/bll2018059. Lahiri, D., Dash, S., Dutta, R., & Nag, M. (2019). Elucidating the effect of anti-biofilm activity of bioactive compounds extracted from plants. Journal of Biosciences, 44(2), 1–19. https://doi.org/10.1007/s12038-019-9868-4. Langeveld, W. T., Veldhuizen, E. J. A., & Burt, S. A. (2014). Synergy between essential oil components and antibiotics: A review. Critical Reviews in Microbiology, 40(1), 76–94. https://doi.org/10.3109/1040841x.2013.763219. Leake, L. L. (2006). Water activity and food quality. Food Technology, 60(11), 62–67. Lin, L. C., & Beuchat, L. R. (2007). Survival of Enterobacter sakazakii in infant cereal as affected by composition, water activity, and temperature. Food Microbiology, 24(7–8), 767–777. https://doi.org/10.1016/j.fm.2007.02.001. Ling, N., Zhang, J. M., Li, C. S., Zeng, H. Y., He, W. J., Ye, Y. W., et al. (2018). The glutaredoxin gene, grxB, affects acid tolerance, surface hydrophobicity, auto-aggregation, and biofilm formation in Cronobacter sakazakii. Frontiers in Microbiology, 9, 133. https://doi.org/10.3389/fmicb.2018.00133. Lombardo, M. J., Aponyi, I., & Rosenberg, S. M. (2004). General stress response regulator RpoS in adaptive mutation and amplification in Escherichia coli. Genetics, 166(2), 669–680. https://doi.org/10.1534/genetics.166.2.669. NazarowecWhite, M., & Farber, J. M. (1997). Thermal resistance of Enterobacter sakazakii in reconstituted dried-infant formula. Letters in Applied Microbiology, 24(1), 9–13. Oliveira, A. R., Domingues, F. C., & Ferreira, S. (2017). The influence of resveratrol adaptation on resistance to antibiotics, benzalkonium chloride, heat and acid stresses of Staphylococcus aureus and Listeria monocytogenes. Food Control, 73, 1420–1425.

10

Food Control 109 (2020) 106944

Y. Chen, et al.

50, 336–341. https://doi.org/10.1016/j.foodcont.2014.09.012. Zanini, S. F., Silva-Angulo, A. B., Rosenthal, A., Rodrigo, D., & Martinez, A. (2014). Effect of citral and carvacrol on the susceptibility of Listeria monocytogenes and Listeria innocua to antibiotics. Letters in Applied Microbiology, 58(5), 486–492. https://doi.org/ 10.1111/lam.12218.

review of our current understanding of the biology of this bacterium. Journal of Applied Microbiology, 113(1), 1–15. https://doi.org/10.1111/j.1365-2672.2012. 05281.x. Yang, H. Y., Kim, S. K., Choi, S. Y., You, D. H., Lee, S. C., Bang, W. S., et al. (2015). Effect of acid, desiccation and heat stresses on the viability of Cronobacter sakazakii during rehydration of powdered infant formula and in simulated gastric fluid. Food Control,

11