Effects of background adaptation on the skin color of Malaysian red tilapia

Aquaculture 521 (2020) 735061

Contents lists available at ScienceDirect

Aquaculture journal homepage: www.elsevier.com/locate/aquaculture

Effects of background adaptation on the skin color of Malaysian red tilapia a

b

b

a

a

Lan-mei Wang , Ming-kun Luo , Hao-ran Yin , Wen-bin Zhu , Jian-jun Fu , Zai-jie Dong

a,b,⁎

T

a Freshwater Fisheries Research Center of Chinese Academy of Fishery Sciences, Key Laboratory of Freshwater Fisheries and Germplasm Resources Utilization, Ministry of Agriculture and Rural Affairs, Wuxi 214081, China b Wuxi Fisheries College, Nanjing Agricultural University, Wuxi 214081, China

A R T I C LE I N FO

A B S T R A C T

Keywords: Red tilapia Background Body color L* a* and b* values Gene expression

The effects of changes in background color, between white and black, on the apparent body color, the skin L*, a* and b* values, the MSH levels in the serum and the melanin-concentrating hormone (mch), proopiomelanocortin (pomc), melanocortin 1 receptor (mc1r) and tyrosinase (tyr) gene mRNA expressions of Malaysia red tilapia were investigated. After rearing in black (B) or white (W) background tanks for 27 days, the rest fishes were transferred to the same (WW and BB) or opposite (WB and BW) background tanks for another 27 days. The apparent body color of fish was paler in white background and darker in black background, and the body color was reversibly variable in response to transfer to the opposite background color. Correspondingly, the L* and b* values were higher and a* values were lower in white background groups than that in black background groups in the skin of fish (P < .05). The expression of mch gene mRNA in the brain were higher in W fish than in B fish (P < .05). In contrast, the pomc mRNA levels were higher in B group than that in W group in the pituitary of fish (P < .05). However, the MSH levels in the serum of fish were not significantly different between W and B group (P > .05) and peaked in WW group (P < .05). Interestingly, the expressions of pomc in pituitary, mc1r and tyr in dorsal skin of fish on day 27 were higher than that on day 54 (P < .05). The mc1r mRNA expressions in the skin of W and B fish were not significantly different (P > .05). However, BB fish showed significantly higher skin mc1r mRNA expressions than WW and BW fish (P < .05). The tyr mRNA in the ventral skin of red tilapia was highest in B group. And the expression of tyr mRNA in BB group was higher than that in BW, WW and WB groups in the skin of fish (P < .05). Present results will facilitate understanding the mechanism of fish skin color determination.

1. Introduction The red tilapia is becoming more popular for aquaculture in certain markets of the world, such as China, Malaysia and Thailand, primarily because of its uniform red color skin and the absence of black peritoneum (Pradeep et al., 2011, 2014). However, the pigmentation differentiation in the process of genetic breeding, which is found at birth and is not reversible, and skin color variation in low temperature environments which is reversible with the environmental temperature increasing are the main problems limiting the development of commercial red tilapia culture (Wang et al., 2018a, 2018b, 2018c; Zhu et al., 2016;). Although extensive studies have been done on molecular mechanisms of melanin biosynthesis in mammals (Logan et al., 2006; Li et al., 2012a, 2012b), the skin color of which is primary determined by the melanin, the genetic molecular mechanisms of skin color differentiation and variation in fish are not well understood yet. In contrast to mammals, which possess the only melanocyte, fish

⁎

possess six types of pigment cells including melanocytes, xanthophores, erythrophores, iridophores, leucophores and cyanophores (Braasch et al., 2007). In many teleosts, background adaptation is regulated by physiological response, aggregation and dispersion of pigment triggered by neural stimuli, and morphological response, involving variations in skin pigment concentrations or the density and distribution of chromatophores in the integument under hormonal control (Van Eys and Peters, 1981; Fujii, 2000; Sugimoto, 2002). Thus, background adaptation is often regulated by both neural and hormonal processes in teleosts (Van Eys and Peters, 1981). In medaka (Oryzias latipes), chemical sympathectomy suppresses the apoptosis of melanophores on a white background (Sugimoto et al., 2000). In nile tilapia (Oreochromis niloticus), there is influence of the background color on the concentration of the hormone cortisol (Merighe et al., 2004), and fish reared in black backgrounds were distinctively darker compared to those reared in the blue and clear background (Opiyo et al., 2014). In mozambique tilapia (Oreochromis mossambicus), the increased sensitivity to

Corresponding author at: Freshwater Fisheries Research Center of Chinese Academy of Fishery Sciences, East Shanshui Road 9, Wuxi 214081, China. E-mail address: dongzj@ffrc.cn (Z.-j. Dong).

https://doi.org/10.1016/j.aquaculture.2020.735061 Received 28 October 2019; Received in revised form 31 January 2020; Accepted 2 February 2020 Available online 04 February 2020 0044-8486/ © 2020 Elsevier B.V. All rights reserved.

Aquaculture 521 (2020) 735061

L.-m. Wang, et al.

melanocyte-stimulating hormone (MSH) is most likely a result of changes in the intracellular signaling system in melanophores of black background adapted fish, rather than up-regulation of the melanocortin (MC)-1 receptor (MC1R) (Salm et al., 2005). In goldfish (Carassius auratus), the pigment aggregation induced by white background adaptation has been associated to increased hypothalamic melaninconcentrating hormone (MCH) expression (Cerdá-Reverter et al., 2006). The ɑ-MSH, which is contained in a precursor protein called proopiomelanocortin (POMC) (Cerdá-Reverter et al., 2003), was shown to stimulate pigment dispersion (Kobayashi et al., 2011). The agouti-signaling protein (ASIP), generated in the ventral part of skin, antagonized the pigment-dispersing activity of ɑ-MSH by binding to melanocortin receptor (MC1R and MC4R) (Cerdá-Reverter et al., 2005). The melanocortin system regulates body pigmentation and social behaviour in Astatotilapia burtoni (Dijkstra et al., 2017). In our previous study, the melanogenesis pathway and candidate genes and microRNAs involved in the skin pigmentation process were identified by transcriptome and microRNA-seq analysis of different color varieties of Malaysia red tilapia (Zhu et al., 2016; Wang et al., 2018a). Effects of temperature (Wang et al., 2018c) and dietary cysteine and tyrosine (Wang et al., 2018b) on the skin color of red tilapia were assessed. We also did the characterization and functional analysis of slc7a11 gene, involved in skin color differentiation in the red tilapia (Wang et al., 2019). To further understand the molecular mechanisms of skin pigmentation in red tilapia, here we investigated the effects of changes in background color, between white and black, on the apparent body color, the skin L*, a* and b* values, the MSH levels in the serum and gene expressions of Malaysian red tilapia. The results will advance our knowledge of skin color genetics in fish and provide important guide for breeding of the specific strain with consistent skin color of red tilapia.

Table 1 Procedures for acclimation and transferring of red tilapia in/between different background.

2. Materials and methods

2.5. Sampling

2.1. Fish

On the first and second 27th day, blood samples were taken from the caudal vein of three fishes from each tank by using syringes and serum samples were obtained after centrifugation (3000 g for 15 min) at 4 °C for MSH analysis. Then tissue samples including whole brains, pituitaries, dorsal and ventral skin of the above three fishes from each tank were excised and then stored at −80 °C for gene mRNA expression analysis. Next, we randomly chose 6 fishes from each tank to measured the L*, a* and b* values of dorsal and ventral skin on the first and second 27th day. Photographs were taken with six fishes per group on the first and second 27th day.

Group W1 W2 W3 B1 B2 B3 W1-B1 W2-B2 W3-W3 B1-W1 B2-W2 B3-B3

Background color

W

B WB WB WW BW BW BB

White (27 days) White (27 days) White (27 days) Black (27 days) Black (27 days) Black (27 days) Black (27 days) Black (27 days) White (27 days) White (27 days) White (27 days) Black (27 days)

Acclimation period

Transferring period

2015, 2018). Aeration was supplied to each aquarium 24 h per day and photoperiod was natural condition. During the experimental period, fishes were fed diets twice daily at 09:00 and 16:30. We changed 1/3 water of each aquarium every three days. 2.4. Experiment 2: transfer of red tilapia to different backgrounds Procedures for acclimation and transferring are summarized in Table 1. After acclimation experiment for 27 days, the rest of fishes in W3 and B3 tanks were kept for another 27 days. The rest of fishes in B1 and W1, B2 and W2 tanks were exchanged with each other for another 27 days adaptation. The grous were named as W, B, WW, BB, BW and WB respectively. The rearing conditions were same to that in experiment 1.

This study was approved by the Bioethical Committee of Freshwater Fisheries Research Center (FFRC) of Chinese Academy of Fishery Sciences (CAFS) (2013863 BCE, 9/2013). We carried out the methods of all experiments in accordance with the Guide for the Care and Use of Experimental Animals of China. Malaysian red tilapia were obtained from the Qiting Pilot Research Station (Yixing, Jiangsu, China), which is affiliated to the FFRC, CAFS. The fishes acclimated to indoor conical fiberglass tanks (diameter 90 cm × depth 80 cm) in a flow-through water system for one week. The background color of the acclimating tanks is blue. We used immature fish to minimize the effects of reproductive cycles on endocrine profifiles (Cerdá-Reverter et al., 2006; Mizusawa et al., 2018).

2.6. Biochemical analysis We measured the L*, a* and b* values in the dorsal and ventral skin of fishes with a ColorQuest XE (Hunterlab, USA). After the instrument correction, we placed the dorsal and ventral skin (above and below the lateral line) of fish on reflectance port to obtain the L*, a* and b* values. The L (brightness) axis (0−100): 0 for black, 100 for white. The a (red-green) axis: positive value is red, negative value is green, 0 is neutral. The b (blue-yellow) axis: positive value is yellow, negative is blue, 0 is neutral. The MSH level in the serum of fish was determined by Fish MSH ELISA kit (Jianglai, Shanghai, China) by double antibody sandwich method. We used purified fish MSH antibody to coat microtiter plate wells to make into solid-phase antibody. Then we added MSH to wells, combined MSH antibody with horseradish peroxidase (HRP) labeled to become antibody-antige-enzyme-antibody complex. After washing completely, we added 3,3′,5,5’-Tetramethylbenzidine (TMB) substrate solution to display color. The stop solution changed the color from blue to yellow and the intensity of the color was measured at 450 nm using a spectrophotometer. The concentration of MSH in the samples was then determined by comparing the O.D. of the samples to the standard curve.

2.2. Experimental tanks Six experimental aquariums (length × width × depth = 60 cm × 30 × 30 cm) were pasted black (B1, B2 and B3) and white (W1, W2 and W3) opaque glass film. Fishing nets were placed over the aquariums to prevent escape. 2.3. Experiment 1: acclimation of red tilapia to black or white backgrounds At the beginning of the experiment, we randomly chose 12 fishes to measure the L*, a* and b* values of the dorsal and ventral skin. A photograph was taken with six fishes. Then healthy acclimated fishes (initial weight (IW) = 44.3 ± 0.14 g) were randomly stocked in the six experimental aquariums, with fifteen fishes per aquarium on May 21, 2019. The fishes were reared in the B and W aquariums for 27 days based on the results of background color study in goldfish and barfin flounder (Verasper moseri) (Cerdá-Reverter et al., 2006; Mizusawa et al., 2

Aquaculture 521 (2020) 735061

L.-m. Wang, et al.

On the second 27th day, the body color of BW fish was almost no difference to WW fish (Fig. 1 C). And BW fish exhibited paler body color compared to WB fish (Fig. 1 E). BB fish still exhibited darker body color to WB fish (Fig. 1 D).

Table 2 Primer sequences. Primers

Sequences (5′-3′)

Amplicon size (bp)

mch Forward mch Reverse pomc Forward pomc Reverse mc1r Forwar mc1r Reverse tyr Forward tyr Reverse β-actin Forward β-actin Reverse

CGCCTGTCCATCATCTTTGC TTTTCCGTGGCCTCATCGTT ATCAGACGCCTCCTCACCTT GCCAGCAGCTCATTGGTAAG ACTATCCTGCTCGGGGTCTT AGGTTTTACGCAGCTCCTGG CACTTCAGACGGACTGCGGA CCTGCGCACTGACTCTCTGT ATGGTGGGTATGGGTCAGAAAG TCGTTGTAGAAGGTGTGATGCC

140

3.2. L*, a* and b* values of skin

189

The L*, a* and b* values in the dorsal and ventral skin of red tilapia are shown in Table 3. The average of L* values in the ventral skin was higher than that in the dorsal skin. The L* values of fish skin in WW, which were not significantly different to the W and BW (P > .05), were higher than that in other four groups (P < .05). The L* value of the ventral skin in BB, which was not significantly different to the WB (P > .05), was lower than that in other five groups (P < .05). The a* values in the dorsal and ventral skin of red tilapia were all negative. The a* values in the initial and BB groups, which were not significantly different to the B and WB (P > .05), were higher than that in other groups in the dorsal skin of fish (P < .05). The a* values in B group were higher than that in WW and BW groups in the ventral skin of fish (P < .05). The average of b* values in the ventral skin was also higher than that in the dorsal skin. For the dorsal skin, the b* value in W, which was not significantly different to the WW and BW (P > .05), was higher than that in other four groups (P < .05). For the ventral skin, the b* values in W and WW, which was not significantly different to the BW (P > .05), was higher than that in other four groups (P < .05).

195 287 149

2.7. Gene mRNA expression analysis The mch, pomc, mc1r and tyrosinase (tyr) gene mRNA expressions of fish were analyzed in this study. Total RNA was extracted from the brains, pituitaries, dorsal and ventral skins of Malaysian red tilapia using an EASY spin Tissue/cell ultra-pure RNA rapid extraction kit (Yuanpinghao Biotech Co., Ltd., Tianjin, China) according to the manufacturer's protocol. The concentration of total RNA was measured with a UV-spectrophotometer (NanoDrop 2000, Thermo, Wilmington, DE, USA) and the quatity and quality was examined by UV-spectrophotometry (OD 260/280) and 1% agarose gel electrophoresis, respectively. Total RNA (500 ng) from various tissues were reverse transcribed into cDNA using the Prime-Script RT Master Mix Perfect Real Time Kit (TaKaRa, Japan). A real-time quantitative PCR (RT-qPCR) assay was carried out with a CFX96 Real-Time PCR Detection System (Bio-Rad, Hercules, CA, USA) using SYBR Premix Ex Taq II (Takara) according to the manufacturer's protocol. The gene-specific RT-qPCR primers (Table 2) were designed based on the ORF of original expressed sequence tag (EST) sequence from the Malaysian red tilapia transcriptome library (NCBI SRA database SRP076062). Red tilapia β-actin cDNA was also amplified as the internal control gene. The final volume of each RT-qPCR reaction was 25 μL, which contained 12.5 μL 2× SYBR Premix Ex Taq II, 1.0 μL of diluted cDNA template (150 ng RNA), 9.5 μL of PCR-grade water, and 1.0 μL of each 10 μM primer. All reactions were run in triplicate for each sample with an initial denaturation at 95 °C for 30s, followed by 40 cycles at 95 °C for 5 s, and the optimized annealing temperature for 30 s. The relative expression levels of gene mRNAs were normalized against β-actin using the comparative CT (2−ΔΔCt) method (Livak and Schmittgen, 2001).

3.3. MSH levels in serum As shown in Fig. 2, the MSH levels in serum were not significantly different between W and B fish on the first 27th day (P > .05). On the second 27th day, the MSH level in serum of red tilapia peaked in WW group. The MSH level in BB was lower than that in W and WW groups (P < .05). 3.4. The expressions of mch and pomc gene The mch, pomc, mc1r and tyr gene was most expressed in the brain, pituitary, dorsal and ventral skin tissue respectively among the brain, pituitary, dorsal and ventral skin tissues in red tilapia by preliminary test. The results of mch expression in brain and pomc expression in pituitary of fish are shown in Table 4. Because most of the values of gene expressions in W and B groups were very high, the statistical significances were further investigated among experiment 2 groups (WB, WW, BW and BB) (Fig. 3). The expression of mch mRNA in brain of the W fish was higher than that in other groups (P < .05). The expression of pomc mRNA in pituitary of the W and B fish was also higher than that in other groups (P < .05), and the pomc mRNA expression in B group was higher than that in W group (P < .05) (Table 4). As shown in Fig. 3, the expression of mch mRNA in WW group was significantly higher than that in other groups in the brain of fish (P < .05). The pomc mRNA in the pituitary of fish was lowest in WW group, with a higher level observed at WB group, and the highest level was in BB group.

2.8. Statistical analysis All the data was reported as means ± standard error of mean (SEM) and were calculated by SPSS 22.0 (SPSS Inc., Chicago, IL, USA). All data was analyzed by one-way ANOVA after homogeneity of variance test. The data was analyzed statistically with fish individual repetition. The n = 9 in W and B groups, the n = 6 in WB and BW groups and the n = 3 in WW and BB groups. Statistical significance was determined at P < .05. When significant differences were found, Duncan's multiple range test were used to identify differences between experimental groups. Significant differences for means of L*, a* and b* values between dorsal skin and ventral skin groups were analyzed by t-test.

3.5. The expressions of mc1r and tyr gene The results of mc1r and tyr expression in the dorsal and ventral skin of fish were shown in Table 4, Fig. 4 and Fig. 5. The expressions of mc1r and tyr gene mRNA in W and B groups were higher than that in other groups in the dorsal skin of fish (P < .05). The mc1r mRNA expression in B was higher than that in WB and WW groups in the ventral skin of fish (P < .05). The tyr mRNA in the ventral skin of fish was highest in B group, with a lower level observed at W and BB group, and the lowest levels were in WB, WW and BW groups. As shown in Fig. 4 and Fig. 5, the expressions of mc1r and tyr mRNA in BB group was significantly

3. Results 3.1. Apparent body color The apparent body color of red tilapia in the study was shown in Fig. 1. On the first 27th day, W fish exhibited paler and B fish exhibited darker body color compared to the initial body color of fish (Fig. 1 A B). 3

Aquaculture 521 (2020) 735061

L.-m. Wang, et al.

Fig. 1. The apparent body color of Malaysia red tilapia rearing in different background tanks. A: body color of initial fish before experiment; B: body color of W fish and B fish; C: body color of BW fish and WW fish; D: body color of WB fish and BB fish; E: body color of WB fish and BW fish. W: fish was kept in white background tanks for 27 days; B: fish was kept in black background tanks for 27 days; WW: fish was kept in white background tank for another 27 days; BB: fish was kept in black background tank for another 27 days; WB: fish was kept in black background tanks from white background tanks for another 27 days; BW: fish was kept in white background tanks from black background tanks for another 27 days. The same below. (For interpretation of the references to color in this figure legend, the reader is referred to the web version of this article.)

Table 3 Effects of background on the L*, a* and b* values of the skin in Malaysian red tilapia. Groups

Dorsal skin L*

Initial W B WB WW BW BB

60.91 67.73 62.55 65.74 69.37 68.01 61.47

Ventral skin a*

± ± ± ± ± ± ±

0.69Aa1 0.64Abc 0.50Aa 0.76Ab 0.66Ac 0.68Abc 1.50Aa

−0.78 −2.93 −1.22 −1.00 −2.89 −1.93 −0.70

± ± ± ± ± ± ±

0.13c 0.25a 0.19bc 0.34bc 0.34a 0.26ab 0.46c

b*

L*

−1.33 ± 0.53Ac 0.79 ± 0.30Ad −3.1 ± 0.40Ab −3.26 ± 0.68Ab −0.53 ± 0.42Acd −0.47 ± 0.55Acd −5.34 ± 0.95Aa

74.07 78.22 71.82 69.96 78.63 76.89 67.46

a* ± ± ± ± ± ± ±

0.59Bc 0.69Bd 0.63Bbc 0.91Bab 1.01Bd 0.53Bd 1.00Ba

−1.26 −1.51 −1.22 −1.63 −2.25 −2.00 −1.55

b* ± ± ± ± ± ± ±

0.29bc 0.12abc 0.15c 0.23abc 0.22a 0.27ab 0.48abc

1.30 ± 0.41Bc 3.62 ± 0.32Bd −0.32 ± 0.38Bb −1.35 ± 0.42Bab 3.54 ± 0.76Bd 2.64 ± 0.55Bcd −2.32 ± 0.99Ba

1

Significant differences for means within experimental groups are indicated with different lower case letters superscripts (P < .05); Significant differences for means between dorsal skin and ventral skin groups are indicated with different capital letters superscripts (P < .05).

higher than that in BW, WW and WB groups in the dorsal skin of fish (P < .05). The mc1r mRNA expression in BB was higher than that in BW and WW groups in the ventral skin of fish (P < .05). The expression of tyr mRNA in WB group was higher than that in BW and WW groups, but was lower than that in BB group in the ventral skin of fish (P < .05).

Mizusawa et al., 2018). Nile tilapia reared on black backgrounds were also distinctively darker compared to those reared in the blue and clear background (Opiyo et al., 2014). Corresponding the apparent body color, the higher L* and b* values of fish skin in white background showed the brighter, paler and more yellow body color than that in black background. And the higher a* values of fish skin in black background suggested the darker and more red body color than that in white background. The consistency between the apparent body color and the L*, a* and b* values of red tilapia indicates that the L*, a* and b* values are an effective indicator for apparent body color of fish (Song et al., 2017), and it has been frequently used in fish color quantifications (Border et al., 2019; Dijkstra et al., 2017; Sköld et al., 2008). In the experiment, the expression of mch mRNA in the brain was higher in W fish than in B fish. In contrast, the pomc mRNA level,

4. Discussion In this study, the apparent body color of red tilapia is paler in white background and darker in black background, and the body color is reversibly variable in response to transfer to the opposite background color. These results were consistent with the findings on goldfish adapted to black and white backgrounds (Cerdá-Reverter et al., 2006; 4

Aquaculture 521 (2020) 735061

L.-m. Wang, et al.

Interesting, the expressions of mch mRNA in brain, pomc mRNA in pituitary, mc1r and tyr mRNAs in dorsal skin of red tilapia on day 27 were all higher than that on day 54. The higher gene expressions on day 27 might be associated with the adaptation of body color to white or black background, and the remarkable decrease on day 54 might be the result of long-term adaptation to the black or white background and interchangeable between black and white background. In medaka and zebrafish (Danio rerio), apoptosis has been shown to be responsible for the decrease in the number of melanophores during adaptation to a white background (Sugimoto et al., 2000, 2005; Uchida-Oka and Sugimoto, 2001), which might be also one reason of the lowest pomc, mc1r and tyr mRNA expressions in WW red tilapia. The mc1r gene is a classical ɑ-msh receptor. The mc1r mRNA expressions in the skin of W and B fish were not significantly different in this study. In goldfish, no difference was also observed of mc1r mRNA in the dorsal and ventral scales between W fish and B fish (Mizusawa et al., 2018). However, BB fish showed significantly higher mc1r mRNA expression in the skin than WW and BW fish, which was consistent with the results of pomc expression in the pituitary of red tilapia. Scale content of mc1r mRNA in BB goldfish was also significantly higher than that in WW goldfish (Mizusawa et al., 2018). MC1R is expressed by melanocytes and its activation increases intracellular cAMP levels. The increases of cAMP levels activate the main melanogenic actions of ɑ-MSH and the transcriptional activation of tyr, the rate-limiting enzyme in melanin biosynthesis, which results in a switch from the production of phaeomelanin (yellow to red pigment) to eumelanin (brown to black pigment) (Agulleiro et al., 2014; García-Borrón et al., 2005). The results of pomc, mc1r and tyr gene expressions in this experiment may be associated with the synthesis of melanin. The tyr mRNA in the ventral skin of red tilapia was highest in B group. And the expression of tyr mRNA in BB group was significantly higher than that in BW, WW and WB groups in the skin of fish, which was nearly consistent with the pomc and mc1r expression results in this study. Fish skin color determination is a complicated process that involves six types of pigment cells, influenced by genetic, physiological, nutritional, environmental factors and so on (Colihueque, 2010). It has been found that interaction between xanthophores and melanophores is crucial to the development of the banding pattern in zebrafish (Colihueque, 2010). The mc1r gene was identified in isolated xanthophores of goldfish (Kobayashi et al., 2011; Mizusawa et al., 2018). The interaction between different types of chromatophores in the skin of fish should be noted and further studied.

Fig. 2. Effects of background on melanocyte-stimulating hormone (MSH) levels in the serum of Malaysian red tilapia. Statistical significance is represented by different letters (P < .05). (For interpretation of the references to color in this figure legend, the reader is referred to the web version of this article.)

precursor protein of ɑ-msh, was higher in B group than that in W group in the pituitary of fish. These results were same to that on goldfish (Cerdá-Reverter et al., 2006; Mizusawa et al., 2018). The results of mch gene expression in W and B backgrounds were also comparable to those previously reported (Gröneveld et al., 1995; Suzuki et al., 1995; Takahashi et al., 2004; Mizusawa et al., 2015). However, the MSH levels in the serum of red tilapia were not significantly different between W and B group and peaked in WW group. In barfin flounder, the pomc mRNA expression in the pituitary was also not consistent with the plasma immunoreactive (ir)-ɑ-MSH (Kobayashi et al., 2008; Mizusawa et al., 2013). The translocation of barfin flounder from a white tank to another white tank increased plasma ir-ɑ-MSH levels on day 7 (Mizusawa et al., 2013). The results of MSH levels in blood of red tilapia and barfin flounder suggest that the secretion of MSH may also be influenced by other environmental or artificial factors in addition to the changes of background color (Mizusawa et al., 2013). In teleosts, background adaptation is a complex process regulated by nervous and endocrine systems (Van Eys and Peters, 1981; Fujii, 2000; Sugimoto, 2002), and endocrine systems uniformly affect the composition of the entire skin, while the neural systems exert region-specifific control (Mizusawa et al., 2011). The pigment-dispersing function of ɑ-MSH is usually overcome by the control of sympathetic nervous system (Mizusawa et al., 2013; Takahashi et al., 2014; Yamanome et al., 2007), so MSH does not always play a role on pigment dispersion in vivo (Kobayashi et al., 2010). In barfin flounder, the mch gene expression and tissue contents of MCH can be easily influenced by changes of environmental color, while gene expression and tissue contents related to MSH scarcely respond to background color changes (Mizusawa et al., 2013). The MSH secretion in the blood of red tilapia might be time adaptation, influenced by environmental or artificial factors.

5. Conclusions In general, background affects the apparent body color, the skin L*, a* and b* values, the serum MSH levels and the mch, pomc, mc1r and tyr gene mRNA expressions of Malaysia red tilapia. Fish exhibits reversible body color change with black or white background adaptation. The expression profiles of mch and pomc of fish are opposite in response to background color changes, and the MSH content in the serum of red tilapia may be influenced by other environmental or artificial factors in

Table 4 Effects of background on gene relative mRNA expression of Malaysian red tilapia. Groups

W B WB WW BW BB 1

Relative gene mRNA expression mch in brain

pomc in pituitary

mc1r in dorsal skin

mc1r in ventral skin

tyr in dorsal skin

tyr in ventral skin

36.79 ± 5.54b 15.66 ± 4.96a 3.3 ± 0.42a 5.24 ± 0.9a 2.61 ± 0.41a 2.58 ± 0.25a

358.74 ± 41.92b 624.33 ± 55.62c 22.05 ± 1.29a 20.08 ± 0.48a 25.40 ± 1.56a 37.13 ± 0.95a

152.2 ± 24.04b 175.8 ± 12.7b 14.49 ± 1.33a 4.29 ± 0.38a 12.2 ± 0.88a 37.60 ± 7.05a

107.5 ± 16.9bc 127.0 ± 37.4c 18.33 ± 3.54ab 5.86 ± 2.29a 44.77 ± 4.26abc 67.21 ± 12.8abc

64.02 ± 5.01b 74.00 ± 2.02b 6.21 ± 1.03a 3.96 ± 0.28a 8.25 ± 1.04a 16.69 ± 1.84a

25.00 ± 3.20b 34.46 ± 1.23c 6.91 ± 0.43a 6.30 ± 1.05a 12.35 ± 1.70a 21.37 ± 0.90b

Significant differences for means within experimental groups are indicated with different superscripts (P < .05). 5

Aquaculture 521 (2020) 735061

L.-m. Wang, et al.

Fig. 3. Effects of background on mch gene mRNA expressions in the brain and pomc mRNA expressions in the pituitary of Malaysia red tilapia on day 54. Statistical significance is represented by different letters (P < .05). (For interpretation of the references to color in this figure legend, the reader is referred to the web version of this article.)

Fig. 4. Effects of background on mc1r mRNA expressions in the skin of Malaysia red tilapia on day 54. Statistical significance is represented by different letters (P < .05). (For interpretation of the references to color in this figure legend, the reader is referred to the web version of this article.)

Fig. 5. Effects of background on tyr mRNA expressions in the skin of Malaysia red tilapia on day 54. Statistical significance is represented by different letters (P < .05). (For interpretation of the references to color in this figure legend, the reader is referred to the web version of this article.)

Declaration of Competing Interests

addition to background color. The results of pomc, mc1r and tyr gene expressions may be associated with the synthesis of melanin. The interaction of different types of chromatophores in the skin, especially between xanthophores and melanophores, should be further studied.

The authors declare that they have no conflict of interests.

6

Aquaculture 521 (2020) 735061

L.-m. Wang, et al.

Acknowledgements

between melanocyte-stimulating hormone and melanin-concentrating hormone in physiological body color change: roles emerging from barfin flounder Verasper moseri. Gen. Comp. Endocrinol. 181, 229–234. Mizusawa, K., Kawashima, Y., Sunuma, T., Hamamoto, A., Kobayashi, Y., Kodera, Y., Saito, Y., Takahashi, A., 2015. Involvement of melanin-concentrating hormone 2 in background color adaptation of barfin flounder Verasper moseri. Gen. Comp. Endocrinol. 214, 140–148. Mizusawa, K., Yamamura, Y., Kasagi, S., Cerdá-Reverter, J.M., Takahashi, A., 2018. Expression of genes for melanotropic peptides and their receptors for morphological color change in goldfish Carassius auratus. Gen. Comp. Endocrinol. 264, 138–150. Opiyo, M.A., Ngugi, C.C., Rasowo, J., 2014. Combined effects of stocking density and background colour on growth performance and survival of nile tilapia (Oreochromis niloticus, L.) fry reared in aquaria. J. Fisheries Sci..com 8 (3), 228–237. Pradeep, P.J., Srijaya, T.C., Jose, D., Papini, A., Hassan, A., Chatterji, A.K., 2011. Identification of diploid and triploid Red Tilapia by using erythrocyte indices. Caryologia 64, 485–492. Pradeep, P.J., Srijaya, T.C., Hassan, A., Chatterji, A.K., Withyachumnarnkul, B., Jeffs, A., 2014. Optimal conditions for cold-shock induction of triploidy in red tilapia. Aquac. Int. 22, 1163–1174. Salm, A.L.V.D., Metz, J.R., Bonga, S.E.W., Flik, G., 2005. Alpha-MSH, the melanocortin-1 receptor and background adaptation in the Mozambique tilapia, Oreochromis mossambicus. Gen. Comp. Endocrinol. 144, 140–149. Sköld, H.N., Amundsen, T., Svensson, P.A., Mayer, I., Bjelvenmark, J., Forsgren, E., 2008. Hormonal regulation of female nuptial coloration in a fish. Horm. Behav. 54 (4), 549–556. Song, X.L., Li, X.Q., Chen, Z.Z., Wang, L., Huan, D.Y., Leng, X.J., 2017. Effect of dietary xanthophyll on the growth and body color of discus fish (Symphysodon aequifasciata). J. Fish. China 41 (4), 566–572. Sugimoto, M., 2002. Morphological color changes in fish: regulation of pigment cell density and morphology. Microsc. Res. Tech. 58, 496–503. Sugimoto, M., Uchida, H., Hayayama, M., 2000. Apoptosis in skin pigment cells of the medaka, Oryzias latipes (Teleostei), during long-term chromatic adaptation: the role of sympathetic innervation. Cell Tissue Res. 301, 205–216. Sugimoto, M., Yuki, M., Miyakoshi, T., Maruko, K., 2005. The influence of long-term chromatic adaptation on pigment cells and striped pigment patterns in the skin of the zebrafish, Danio rerio. J. Exp. Zool. 303A, 430–440. Suzuki, M., Narnaware, Y.K., Baker, B.I., Levy, A., 1995. Influence of environmental colour and diurnal phase on MCH gene expression in the trout. J. Neuroendocrinol. 7, 319–328. Takahashi, A., Tsuchiya, K., Yamanome, T., Amano, M., Yasuda, A., Yamamori, K., Kawauchi, H., 2004. Possible involvement of melanin-concentrating hormone in food intake in a teleost, barfin flounder. Gen. Comp. Endocrinol. 25, 1613–1622. Takahashi, A., Mizusawa, K., Amano, M., 2014. Multifunctional roles of melanocytestimulating hormone and melanin-concentrating hormone in fish: evolution from classical body color change. Aqua-Biosci. Monogr. 7, 1–46. Uchida-Oka, N., Sugimoto, M., 2001. Norepinephrine induces apoptosis in skin melanophores by attenuating cAMP-PKA signals via alpha2-adrenoceptors in the medaka, Oryzias latipes. Pigment Cell Res. 14, 356–361. Van Eys, G.J., Peters, P.T., 1981. Evidence for a direct role of α-MSH in morphological background adaptation of the skin in Sarotherodon mossambicus. Cell Tissue Res. 217, 361–372. Wang, L.M., Zhu, W.B., Dong, Z.J., Song, F.B., Dong, J.J., Fu, J.J., 2018a. Comparative microRNA-seq analysis depicts candidate miRNAs involved in skin color differentiation in red tilapia. Int. J. Mol. Sci. 19, 1209. Wang, L.M., Zhu, W.B., Yang, J., Miao, L.H., Dong, J.J., Song, F.B., Dong, Z.J., 2018b. Effects of dietary cystine and tyrosine on melanogenesis pathways involved in skin color differentiation of Malaysian red tilapia. Aquaculture 490, 149–155. Wang, L.M., Song, F.B., Zhu, W.B., Dong, J.J., Fu, J.J., Dong, Z.J., 2018c. Effects of temperature on body color of Malaysian red tilapia during overwintering period. J. Fish. China 42 (1), 72–79. Wang, L.M., Bu, H.Y., Song, F.B., Zhu, W.B., Fu, J.J., Dong, Z.J., 2019. Characterization and functional analysis of slc7a11 gene, involved in skin color differentiation in the red tilapia. Comp. Biochem. Physiol. A 236, 110529. Yamanome, T., Chiba, H., Takahashi, A., 2007. Melanocyte-stimulating hormone facilitates hypermelanosis on the non-eye-side of the barfifin flounder, a pleuronectiform fish. Aquaculture 270, 505–511. Zhu, W.B., Wang, L.M., Dong, Z.J., Chen, X.T., Song, F.B., Liu, N., Yang, H., Fu, J.J., 2016. Comparative transcriptome analysis identifies candidate genes related to skin color differentiation in red tilapia. Sci. Rep. 6, 31347.

This work was supported by the Central Public-interest Scientific Institution Basal Research Fund, CAFS (NO. 2019ZY21) and National Natural Science Foundation Younth Fund of China (Grant No. 31802290). References Agulleiro, M.J., Cortés, R., Leal, E., Ríos, D., Sánchez, E., Cerdá-Reverter, J.M., 2014. Characterization, tissue distribution and regulation by fasting of the agouti family of peptides in the sea bass (Dicentrarchus labrax). Gen. Comp. Endocrinol. 205, 251–259. Border, S.E., Piefke, T., Fialkowski, R., Tryc, M., Funnell, T., DeOliveira, G., Dijkstra, P.D., 2019. Color change and pigmentation in a color polymorphic cichlid fish. Hydrobiologia 832, 175–191. Braasch, I., Schartl, M., Volff, J.N., 2007. Evolution of pigment synthesis pathways by gene and genome duplication in fish. BMC Evol. Biol. 7, 162–173. Cerdá-Reverter, J.M., Schiöth, H.B., Peter, R.E., 2003. The central melanocortin system stimulates food intake in goldfish. Regul. Pept. 115, 101–113. Cerdá-Reverter, J.M., Haitina, T., Schiöth, H.B., Peter, R.E., 2005. Gene structure of the goldfish agouti-signaling protein: a putative role in the dorsal-ventral pigment pattern of fish. Endocrinology 146, 1597–1610. Cerdá-Reverter, J.M., Canosa, L.F., Peter, R.E., 2006. Regulation of the hypothalamic melanin-concentrating hormone neurons by sex steroids in the goldfish: possible role in the modulation of luteinizing hormone secretion. Neuroendocrinology 84, 364–377. Colihueque, N., 2010. Genetics of salmonid skin pigmentation: clues and prospects for improving the external appearance of farmed salmonids. Rev. Fish Biol. Fish. 20, 71–86. Dijkstra, P.D., Maguire, S.M., Harris, R.M., Rodriguez, A.A., DeAngelis, R.S., Flores, S.A., Hofmann, H.A., 2017. The melanocortin system regulates body pigmentation and social behaviour in a colour polymorphic cichlid fish. Proc. Biol. Sci. 284, 20162838. Fujii, R., 2000. The regulation of motile activity of fish chromatophores. Pigment Cell Res. 13, 300–319. García-Borrón, J.C., Sánchez-Laorden, B.L., Jiménez-Cervantes, C., 2005. Melanocortin-1 receptor structure and functional regulation. Pigment Cell Res. 18, 393–410. Gröneveld, D., Balm, P.H., Martens, G.J., Wendelaar Bonga, S.E., 1995. Differential melanin-concentrating hormone gene expression in two hypothalamic nuclei of the teleost tilapia in response to environmental changes. J. Neuroendocrinol. 7, 527–533. Kobayashi, Y., Chiba, H., Amiya, N., Yamanome, T., Mizusawa, K., Amano, M., Takahashi, A., 2008. Transcription elements and functional expression of proopiomelanocortin genes in the pituitary gland of the barfin flounder. Gen. Comp. Endocrinol. 158, 259–267. Kobayashi, Y., Tsuchiya, K., Yamanome, T., Schiöth, H.B., Takahashi, A., 2010. Differential expressions of melanocortin receptor subtypes in melanophores and xanthophores of barfin flounder. Gen. Comp. Endocrinol. 168, 133–142. Kobayashi, Y., Chiba, H., Mizusawa, K., Suzuki, N., Cerdá-Reverter, J.M., Takahashi, A., 2011. Pigment-dispersing activities and cortisol-releasing activities of melanocortins and their receptors in xanthophores and head kidneys of the goldfish. Gen. Comp. Endocrinol. 173, 438–446. Li, H.S., He, X., Zhou, Z.Y., Diao, S.H., Zhang, W.X., Liu, G., Diao, Z.Q., Gu, B., 2012a. Expression levels of Slc7a11 in skin of kazakh sheep with different coat color. Hereditas 34, 1314–1319. Li, S., Wang, C., Yu, W., Zhao, S., Gong, Y., 2012b. Identification of genes related to white and black plumage formation by RNA-Seq from white and black feather bulbs in ducks. PLoS One 7, e36592. Livak, K.J., Schmittgen, T.D., 2001. Analysis of temporal gene expression data using real time quantitative PCR and the 2 (−Delta Delta C (T)) method. Methods 25, 402–408. Logan, D.W., Burn, S.F., Jackson, I.J., 2006. Regulation of pigmentation in zebrafish melanophores. Pigment Cell Res. 19, 206–213. Merighe, G.K.F., Pereira-Da-Silva, E.M., Negrão, João Alberto, Ribeiro, S., 2004. Effect of background color on the social stress of nile tilapia (oreochromis niloticus). Rev. Bras. Zootec. 33 (4), 828–837. Mizusawa, K., Kobayashi, Y., Sunuma, T., Asahida, T., Saito, Y., Takahashi, A., 2011. Inhibiting roles of melanin-concentrating hormone for skin pigment dispersion in barfin flounder, Verasper moseri. Gen. Comp. Endocrinol. 171, 75–81. Mizusawa, K., Kobayashi, Y., Yamanome, T., Saito, Y., Takahashi, A., 2013. Interrelation

7