Effects of different dietary soybean oil levels on growth, lipid deposition, tissues fatty acid composition and hepatic lipid metabolism related gene expressions in blunt snout bream (Megalobrama amblycephala) juvenile

Aquaculture 451 (2016) 16–23

Contents lists available at ScienceDirect

Aquaculture journal homepage: www.elsevier.com/locate/aqua-online

Effects of different dietary soybean oil levels on growth, lipid deposition, tissues fatty acid composition and hepatic lipid metabolism related gene expressions in blunt snout bream (Megalobrama amblycephala) juvenile Yang Li, Xiao Liang, Yin Zhang, Jian Gao ⁎ a b

College of Fisheries, Key Lab of Agricultural Animal Genetics, Breeding and Reproduction, Ministry of Education, Huazhong Agricultural University, Wuhan 430070, China College of Fisheries, Key Lab of Freshwater Animal Breeding, Ministry of Agriculture, Huazhong Agricultural University, Wuhan 430070, China

a r t i c l e

i n f o

Article history: Received 21 June 2015 Received in revised form 23 August 2015 Accepted 24 August 2015 Available online 29 August 2015 Keywords: Megalobrama amblycephala Soybean oil Growth performance Fatty acids composition Lipid metabolism

a b s t r a c t Soybean oil (SO) is widely used in freshwater aqua-feeds in China. However, little information is available about the effects of dietary SO levels on lipid deposition and hepatic lipid metabolism in fish. This study evaluated effects of different dietary soybean oil (SO) levels on growth performance, lipid deposition, tissues fatty acid compositions and hepatic lipid metabolism related gene expressions in blunt snout bream (Megalobrama amblycephala). Fish (average weight 0.34 ± 0.01 g) were fed five experimental diets containing 0% (0%SO), 20% (20%SO), 32% (32%SO), 56% (56%SO) and 100% (100%SO) SO in dietary lipid, and a diet containing 100% fish oil (100%FO). The body weight gain of fish fed 20%SO and 100%FO diets were significantly higher than in the other groups. Hepatic lipid content increased with incremental dietary SO level. The percentages of 18:2n−6 in the liver and muscle significantly increased with increasing dietary SO level. In the fish fed 56%SO and 100%SO diets 20:4n−6 content significantly increased in the liver and muscle suggesting the capacity of blunt snout bream to convert C18 fatty acids (PUFAs) to C20/22 fatty acids. However, increasing dietary SO level up-regulated acyl-CoA delta-9 desaturase and down-regulated peroxisome proliferator-activated receptors-α and -β, which might be responsible for the high 18:2n−6 content. It is suggested that supplementation of 20% soybean oil (8% lipid in diet) could improve blunt snout bream juvenile growth. However, an excess of 18:2n−6 in SO supplemented diets modified the expressions of lipid metabolism-related genes which induced lipid deposition. Statement of relevance: The present study was conducted to evaluated the effects of different dietary soybean oil (SO) levels on growth performance, lipid deposition, tissues fatty acid compositions and hepatic lipid metabolism related gene expressions in blunt snout bream (M. amblycephala). Fish (average weight 0.34 ± 0.01 g) were fed five experimental diets containing the following inclusion levels of SO: 0% (0%SO), 20% (20%SO), 32% (32%SO), 56% (56%SO) and 100% (100%SO) in dietary lipid, and a diet contained 100% fish oil (100%FO) was also used here. The percentages of 18:2n −6 in the liver and muscle significantly increased with increasing dietary SO level, and the fish fed 56%SO and 100%SO diets significantly increased 20:4n−6 contents in the liver and muscle, suggesting blunt snout bream has the capacity to convert C18 fatty acids (PUFAs) to C20/22 fatty acids. However, increasing dietary SO level up-regulated acyl-CoA delta-9 desaturase and down-regulated peroxisome proliferator-activated receptors-α and -β, which might be related associated with high level of 18:2n−6 in SO. It suggested that supplementation of 20% soybean oil (8% lipid in diet) could improve growth of blunt snout bream juvenile. However, an excess of 18:2n − 6 in SO would modify the expressions of lipid metabolismrelated genes, which induced lipid deposition in fish. © 2015 Elsevier B.V. All rights reserved.

1. Introduction Fatty acids (FAs) are known to play an important role in lipid metabolism in fish (Tocher, 2003). Because fish do not possess the Δ12 and Δ15 desaturase enzymes, they cannot produce 18:2n − 6 (linoleic acid, LA) and 18:3n − 3 (linolenic acid, LNA) from 18:1n − 9 (oleic ⁎ Corresponding author. E-mail address: [email protected] (J. Gao).

http://dx.doi.org/10.1016/j.aquaculture.2015.08.028 0044-8486/© 2015 Elsevier B.V. All rights reserved.

acid, OA). However, it is well-documented that freshwater fish have an innate capacity to convert LA and LNA to n − 6 and n −3 LC-PUFA, respectively (Sargent et al., 2002). Dietary LA has been found to be beneficial for growth performance and to maintain the membranes and eicosanoid metabolism in fish (Bautista and De la Cruz, 1988; Tan et al., 2009). Fish oil (FO) is traditionally used in aquaculture feeds because of its high n−3 long chain polyunsaturated fatty acids (LC-PUFA) content especially eicosapentaenoic acid (EPA) and docosahexaenoic acid (DHA),

Y. Li et al. / Aquaculture 451 (2016) 16–23

which are essential to maintain the normal cell membranes function (Sargent et al., 1999). However, the global FO production may not be enough to cover the increasing demand for animal feed. At present, soybean oil (SO) is widely used in freshwater aqua-feeds in China because its production is steadily increasing and its reasonable prices. Furthermore, SO is rich in PUFAs, especially LA which is EFAs for freshwater fish. However, Du et al. (2008) found that the hepatic lipid deposition of grass carp (Ctenopharyngodon idella) increased with incremental dietary lipid level. A previous study also found that the fish fed FO and SO group diets had no significant effect on growth performance but the hepatic lipid content was significantly higher in SO fed fish compared to those fed FO (Li et al., 2015b). However, the mechanism of lipid deposition in liver of fish fed diets with higher SO level is still uncertain. Lipid deposition in liver represents a complex process, including hepatic secretion, oxidation, transport and uptake of lipid (Lu et al., 2013), and many key enzymes and transcription factors are involved in these processes. These enzymes include fatty acid synthase (FAS), elongase of very long chain fatty acids-5 (elovl5), delta-6 fatty acyl desaturase (Δ 6 FAD), acyl-CoA delta-9 desaturase (SCD) and lipoprotein lipase (LPL) (Jakobsson et al., 2006; Xue et al., 2014; Zhang et al., 2014; Zheng et al., 2014). In addition, several transcription factors, i.e. peroxisome proliferator-activated receptors (PPAR-α, PPAR-β, PPAR-γ) and fatty acid binding protein (FABP) play an intermediary role in orchestrating the gene transcription involved in lipid homeostasis (Lu et al., 2014). Although many studies have investigated the effects of higher dietary SO levels on lipid deposition in fish, the underlying molecular processes involved in the alteration of lipid deposition as a response to higher dietary SO levels are not yet known. Blunt snout bream (Megalobrama amblycephala) is an herbivorous native Chinese freshwater finfish with high potential for aquaculture. According to 2013 China Fishery Statistical yearbook, the production of blunt snout bream reached 705,821 tons in China in 2012 (Fisheries Bureau, Ministry of Agriculture of China, 2013). However, little is known about the physiological effects of SO and optimal dietary SO levels for blunt snout bream during their early development stage. Therefore in the present study, the different dietary SO levels were designed to evaluate the effects of dietary SO levels on growth performance, fatty acid composition, and the mechanism of hepatic lipid metabolism in blunt snout bream juvenile. 2. Materials and methods 2.1. Experimental diets Six iso-nitrogenous (50.0%) and iso-lipidic (8.1%), semi-purified diets were formulated to contain 0, 20, 32, 56, and 100% SO or 100% fish oil as the dietary lipid source (Table 1). The lipid levels of the diets were balanced by adjusting the lard oil concentration. Since lard oil contains high saturated fatty acid and low PUFA. All the ingredients were finely ground and sieved with an 80-mesh sieve, then thoroughly mixed with different SO levels respectively in a feed mixer (SM-168; Muren Corp., Shenzhen, China). An appropriate amount of water was added to produce stiff dough. The dough was then passed through a meat grinder with an appropriate diameter to prepare pellets. The pellets were air dried, broken up and sieved into proper pellet size. All experimental diets were stored at − 20 °C until the time of feeding. The fatty acid composition of the test diets are given in Table 2. 2.2. Experimental fish and feeding trial Blunt snout bream juvenile were obtained from Haida Co., Ltd., Tuanfeng County, Hubei Province, China). Before the experiments, the fish were acclimatized for 2 weeks and healthy, homogenous-sized fish (average initial body weight 0.34 ± 0.01 g) were stocked in 18 tanks with 30 fish per tank in triplicates per dietary treatment. All fish were hand-fed the test diets to the satiation level three times per day

17

Table 1 Formulation and proximate composition of the experimental diets. Experimental diets (dietary SO level) 0%SO

20%SO

32%SO

56%SO

100%SO

100%FO

Ingredients (%) Defatted fishmeala Soya concentrate Casein Activated gluten CMCb α-Starch Dextrin Soybean oil Lard oil Fish oil Ca(H2PO4) Minerals mixturec Vitamins mixtured

10.0 35.0 10.0 10.0 5.0 10.0 8.0 0 8.0 0 2.0 1.0 1.0

10.0 35.0 10.0 10.0 5.0 10.0 8.0 1.6 6.4 0 2.0 1.0 1.0

10.0 35.0 10.0 10.0 5.0 10.0 8.0 2.6 5.4 0 2.0 1.0 1.0

10.0 35.0 10.0 10.0 5.0 10.0 8.0 4.5 3.5 0 2.0 1.0 1.0

10.0 35.0 10.0 10.0 5.0 10.0 8.0 8.0 0 0 2.0 1.0 1.0

10.0 35.0 10.0 10.0 5.0 10.0 8.0 0 0 8.0 2.0 1.0 1.0

Proximate composition (%) Crude protein (dry mass) Ash (dry mass) Moisture Total lipid (dry mass)

50.0 7.1 12.5 8.0

50.2 7.2 12.5 8.1

50.1 7.3 12.3 8.2

49.7 7.3 12.3 8.1

50.3 7.1 11.7 8.0

49.8 7.1 11.7 8.1

a

Fishmeal had been skimmed. Carboxy methyl cellulose. Mineral mixture (mg/kg diet): MgSO4, 3380 mg; Na2HPO4, 2153.33 mg; K2HPO4, 5913.33 mg; Fe citrate, 733.33 mg; Ca lactate, 8060 mg; Al(OH)3, 6.67 mg; ZnSO4, 86.67 mg; CuSO4, 2.67 mg; MnSO4, 20 mg; Ca(IO3)2, 6.67 mg; and CoSO4, 26.67 mg. d Vitamin mixture (mg/kg diet): β-carotene, 32.12 mg; vitamin C, 230 mg; vitamin D3, 3.24 mg; menadione NaHSO3·3H2O (K3), 15.28 mg; DL-α-tocopherol acetate (E), 12.68 mg; thiamine-nitrate (B1), 19.24 mg; riboflavin (B2), 64.12 mg; pyridoxine-HCl (B6), 15.28 mg; cyanocobalamin (B12), 0.04 mg; d-biotin, 1.92 mg; inositol, 1283.04 mg; niacin (nicotic acid), 256.56 mg; Ca pantothenate, 89.34 mg; folic acid, 4.8 mg; choline chloride, 2623.12 mg; and ρ-aminobenzoic acid, 127.76 mg. b c

(at 08:00, 14:00 and 20:00 h) for 9 weeks. Any dead fish were weighed and removed when necessary. Uneaten feed was collected by siphoning at 0.5 h post-feeding and dried at 60 °C to calculate the exact feed intake. All experiments in the present study were conducted according to the principles of good laboratory animal care, and were approved by the Huazhong Agricultural University Ethical Committee for Laboratory Animals Care and Use. 2.3. Sampling collection At the end of the feeding trial, all fish were fasted for 24 h prior to final sampling and were sacrificed in an ice-slurry. The fish were counted, weighed and the length measured. Five fish per tank were randomly selected and frozen at −80 °C for determination of whole body composition. The liver and muscle from ten fish in each tank were pooled together respectively and then kept at −80 °C for fatty acid compositions. Liver from 5 fish were dissected and frozen in liquid nitrogen and stored at −80 °C for molecular analyses. 2.4. Proximate and lipid analysis Moisture, crude protein, crude lipid and ash of the experimental diets and whole body samples were determined using standard methods (AOAC, 1995). Total lipid of the diets and tissues were measured following the method of Gao et al. (2012). Fatty acid methyl esters (FAME) were produced from total lipid aliquots and methylated with boron trifluoride (BF3) in methanol. The fatty acid composition of total lipid in the diets, liver and muscle were determined using gas chromatography (Agilents Technologies Inc., Santa Clara, CA, USA) according to the method of Gao et al. (2012). The temperatures of the injector and detector (FID) were set at 250 °C and 260 °C respectively. The temperature program was 200 °C (40 min) to 240 °C (15 min) at 4 °C/min. Highpurity helium was used as the carrier gas at a flow rate of 1 ml/min. The

18

Y. Li et al. / Aquaculture 451 (2016) 16–23

Table 2 Main fatty acid composition (% of total fatty acids) of experimental diets. Fatty acids

Experimental diets (dietary SO level) 0%SO

20%SO

32%SO

56%SO

100%SO

100%FO

14:0 16:0 18:0 Σ SFA 16:1n−7 18:1n−7 18:1n−9 20:1n−9 20:1n−11 22:1n−11 Σ MUFA 18:2n−6 (LA) 20:2n−6 Σ n−6 PUFA 18:3n−3 20:5n−3 (EPA) 22:5n−3 22:6n−3 (DHA) Σ n−3 PUFA Σ SFA/Σ PUFA n−3/n−6 PUFA

2.6 ± 0.1b 32.7 ± 0.2d 16.0 ± 0.5d 51.4 ± 0.7f nd nd 36.9 ± 0.4d nd nd nd 36.9 ± 0.4c 8.3 ± 0.3a nd 8.3 ± 0.3a 0.0 ± 0.0a nd nd nd 0.0 ± 0.0a 6.2 ± 0.2e 0.0 ± 0.0a

1.9 ± 0.1b 27.4 ± 0.5c 13.0 ± 0.2c 42.4 ± 0.7e nd nd 37.3 ± 0.4d nd nd nd 37.3 ± 0.4c 17.2 ± 0.3b nd 17.2 ± 0.3b 0.9 ± 0.0b nd nd nd 0.9 ± 0.0b 2.4 ± 0.1d 0.1 ± 0.0a

2.2 ± 0.4b 24.6 ± 0.6bc 11.9 ± 0.5bc 38.7 ± 1.6d nd nd 34.3 ± 1.2c nd nd nd 34.3 ± 1.2b 23.5 ± 0.3c nd 23.5 ± 0.3c 1.5 ± 0.1c nd nd nd 1.5 ± 0.1c 1.6 ± 0.1c 0.1 ± 0.0a

1.4 ± 0a 20.8 ± 0b 9.6 ± 0.1b 31.8 ± 0.1c nd nd 34.1 ± 0.7c nd nd nd 34.1 ± 0.7b 29.2 ± 0.5d nd 29.2 ± 0.5d 2.7 ± 0.1d nd nd nd 2.7 ± 0.1d 1.0 ± 0.0b 0.1 ± 0.0a

1.3 ± 0a 9.5 ± 0.3a 3.5 ± 0.1a 14.3 ± 0.3a nd nd 26.9 ± 0.4b nd nd nd 26.9 ± 0.4a 51.6 ± 0.5e nd 51.6 ± 0.5e 4.8 ± 0.2e nd nd nd 4.8 ± 0.2e 0.3 ± 0.0a 0.1 ± 0.0a

5.1 ± 0.3c 15.8 ± 0.4ab 2.5 ± 0.1a 23.3 ± 0.4b 5.8 ± 0.2 3.3 ± 0.1 16.4 ± 0.8a 8.5 ± 1.0 1.9 ± 0.8 12.4 ± 0.5 48.4 ± 0.8d 5.7 ± 0.1a 0.5 ± 0.0 6.2 ± 0.1a 2.3 ± 0.1d 7.5 ± 0.3 1.1 ± 0.2 7.1 ± 0.9 17.9 ± 1 1.0 ± 0.1b 2.9 ± 0.2b

Values are mean ± SE of three replicates. Means in the same row with different superscripts are significantly different (P b 0.05). LA, linoleic acid; ARA, arachidonic acid; LNA, linolenic acid; EPA, eicosapentaenoic acid; DHA, docosahexaenoic acid; SFAs, saturated fatty acid; MUFAs, monounsaturated fatty acids; PUFAs, polyunsaturated fatty acids. nd, not detected.

samples (1.0 μl) were manually injected into the injection port and identified FAs were presented as area percentage of total FAs. 2.5. Gene expression analysis by real-time quantitative RT-PCR (qRT-PCR) Total RNA was extracted from the liver using RNAiso Plus (Takara, Tokyo, Japan). RNA samples were treated by RQ1 RNase-Free DNase prior to RT-PCR (Takara, Tokyo, Japan) to avoid genomic DNA amplification. cDNA was generated from 500 ng DNase-treated RNA using ExScript™ RT-PCR kit (Takara, Tokyo, Japan). Real-time PCR assays were carried out in a quantitative thermal cycler (Bio-Rad CFX96, Hercules, CA, USA) with a 20 μl reaction volume containing 10 μl SYBR® Green Real-time PCR Master Mix (Bio-Rad, Hercules, CA, USA), 2 μl of cDNA, and 0.2 μM of each primer. Primers sequences are given in Table 3. The thermal program included 1 min at 95 °C, 40 cycles at 95 °C for 10 s, 59 °C for 30 s, and a melt curve step from 65 °C gradually increasing 0.5 °C s− 1 to 95 °C, with acquisition data every 6 s. All amplicons were initially separated by agarose gel electrophoresis to ensure that they were of correct size. The amplification efficiencies of all genes were approximately equal and ranged from 97.3% to 102.8%. Relative quantification of the target gene transcripts was done using β-actin gene and EF1α as the reference, which was stably expressed. Normalized gene expression of the control group (0%SO) was set to 1, and the expressions of each target gene for the other groups were

expressed relative to the control group. Optimized comparative Ct (2− ΔΔCt) value method (Livak and Schmittgen, 2001) was used here to estimate gene expression levels. All amplifications were performed in triplicate for each RNA sample. 2.6. Statistical analyses All data were subjected to Levene's test of equality of error variances and one-way ANOVA followed by Tukey's test using SPSS 19.0 (SPSS 19.0, Michigan Avenue, Chicago, IL, USA). Probability values of b0.05 were considered statistically significant. 3. Results 3.1. Growth performance Growth performance of fish is shown in Table 4. The final body weight, body weight gain (BWG) and specific growth rate (SGR) in fish fed 20%SO diet and 100%FO diet were significantly higher than in the 0%SO, 32%SO, 56%SO and 100%SO groups (P b 0.05). The feed conversion ratio (FCR) in fish fed 20%SO diet and 100%FO diet was significantly lower than that in other groups. The survival of fish fed test diets did not show any significant differences among the treatments (P N 0.05). Fish in all treatment groups showed more than 94% survival.

Table 3 Nucleotide sequences of the primers used to assay gene expression by real-time PCR. Target gene

Forward (5′-3′)

Reverse (5′-3′)

Tm (°C)

Elovl5 LPL FAS Δ6 FAD SCD FABP PPAR-α PPAR-β PPAR-γ β-actin EF1α

ATGTCAGTGTATCAGGGCGGA TAGCGAAGAGCCCGAAGAAGA GACCTGGAGGCTCGTGT TCAATGCGTTTGTAGTGGGAA GGAATCCTACCAAACCCAG GCTTTCCCTCCCTCCAGT GTGCCAATACTGTCGCTTTCAG CATCCTCACGGGCAAGAC AGCTTCAAGCGAATGGTTCTG TCGTCCACCGCAAATGCTTCTA CTGGAGGCCAGCTCAAAYAT

ATGTTGAGCATGGTGGCGTG GTTACCAGTTTGGGAACCCAGC GGATGATGCCTGAGATGG TTGTGCTGATGGTTGTAAGGC TGTCACGCAGCCTCTACC AAACCGTCACTAACACCTT CCGCCTTTAACCTCAGCTTCT TGGCAGCGGTAGAAGACA AGGCCTCGGGCTTCCA CCGTCACCTTCACCGTTCCAGT ATCAAGAAGAGTARYACCRCTAGCATTWC

59.0 59.0 59.0 59.0 59.0 59.0 59.0 59.0 59.0 59.0 59.0

elovl5, elongase of very long chain fatty acids; LPL, lipoprotein lipase; FAS, fatty acid synthase; Δ6 FAD, delta-6 fatty acyl desaturase; SCD, acyl-CoA delta-9 desaturase; FABP, fatty acid binding protein; PPAR: peroxisome proliferator-activated receptor; EF1a: elongation factor 1.

Y. Li et al. / Aquaculture 451 (2016) 16–23

19

Table 4 Growth performances of blunt snout bream juvenile fed diets containing different levels of soybean oil (SO) for 9 week. Experimental diets (dietary SO level)

Initial body weight (g) Final body weight (g) BWG (%)1 SGR2 FCR3 FI (g/fish/63 day)4 Survival (%)

0%SO

20%SO

32%SO

56%SO

100%SO

100%FO

0.3 ± 0.0 2.3 ± 0.1ab 575.5 ± 8.7ab 3.0 ± 0.0a 3.9 ± 0.1c 7.7 ± 0.1ab 97.8 ± 2.2

0.3 ± 0.0 2.7 ± 0.1c 710.7 ± 34.3c 3.4 ± 0.1c 3.3 ± 0.2a 8.0 ± 0.2ab 95.6 ± 2.9

0.3 ± 0.0 2.5 ± 0.1b 636.2 ± 23.4b 3.2 ± 0.1b 3.6 ± 0.1b 7.8 ± 0.2ab 94.3 ± 2.0

0.3 ± 0.0 2.2 ± 0.2a 548.0 ± 42.4a 3.0 ± 0.1a 4.1 ± 0.2d 7.7 ± 0.2ab 94.4 ± 5.6

0.3 ± 0.0 2.2 ± 0.1a 547.0 ± 6.8a 3.0 ± 0.1a 4.0 ± 0.2cd 7.4 ± 0.3a 95.5 ± 2.2

0.3 ± 0.0 2.7 ± 0.1c 707.8 ± 5.2c 3.3 ± 0.0c 3.4 ± 0.0a 8.3 ± 0.2b 94.4 ± 2.9

Values are means ± SE of three replicates (30 fish/tank). Means in the same row with different superscripts are significantly different (P b 0.05). 1 BWG, body weight gain = (final body weight − initial body weight) × 100/initial body weight. 2 SGR, specific growth rate = (LnWt − LnW0) × 100/T, where W0 and Wt are the initial and final body weight, respectively; T is the culture period. 3 FCR, feed conversion ratio = total diet fed (g)/total wet weight gain (g). 4 FI, feed intake = total feed intake (g)/number of fishes/T (day), where T is the culture period.

FI of fish fed FO diet was significantly higher (P b 0.05) than those fed 100%SO diet. The whole body composition such as total lipid, moisture, ash and crude protein were not influenced by increasing levels of dietary SO. The hepatic lipid content significantly increased (P b 0.05) with incremental dietary SO levels (Fig. 1).

3.2. Fatty acid compositions in liver and muscle The fatty acid compositions of liver and muscle are presented in Tables 5 and 6 respectively. In the liver, dietary SO supplementation significantly increased the percentage of LA, arachidonic acid (ARA) and total n − 6 PUFAs and significantly decreased the percentage of 18:1n − 9, and monounsaturated fatty acids (MUFAs) but the fatty acid profiles did not differ between the 100%FO and 0%SO. The 100%FO treatment significantly increased (P b 0.05) the liver LNA, EPA, DHA and total n − 3 PUFAs compared to the SO groups. These fatty acids in the liver were significantly lower (P b 0.05) in the 56%SO and 100%SO groups compared to the 0%SO group. A similar trend was observed in the muscle FA composition (Table 6).

Fig. 1. Effects of different dietary SO levels on lipid content in the liver of juvenile blunt snout bream for 9 weeks. Values are means ± SE, n = 3 replicate tanks, three fish were sampled for each tank; different letters above the bars showed there were significant differences among different treatments (P b 0.05).

3.3. Gene expression in liver Dietary SO levels significantly influenced expressions of some hepatic lipid metabolism related genes in the blunt snout bream (Fig. 2). The expressions of liver elovl5 and SCD increased in fish fed the higher dietary SO levels and the highest expression of these two genes were observed in fish fed the 100%SO diet. Relative expressions of liver PPAR-α and PPAR-β were significantly decreased in fish fed increasing dietary SO levels from 20%SO to 100%SO. However, the fish fed 20%SO diet exhibited significantly higher expressions of liver PPAR-α and PPAR-β than the 0%SO group (P b 0.05). The expression of FABP in 56%SO and 100%SO groups were significantly higher (P b 0.05) than those fed the lower dietary SO groups (P b 0.05). The highest expression of FAS was observed in the 100%SO group (P b 0.05). However, dietary SO levels did not markedly affect the expressions of Δ 6 FAD, PPAR-γ and LPL (P N 0.05). The 100%FO diets did not significantly affect the mRNA levels of these genes compared with 0%SO diet.

4. Discussion In the present trial, a significantly improved BWG and a significant reduction in FCR was observed in the 20%SO group compared to all experimental groups except the FO group. It can suggest that supplementation of 20% SO in dietary lipid could maintain the normal physiological function for blunt snout bream juvenile. This would be related to dietary appropriate levels of LA. Indeed, the LA content in the 20%SO group was 1.5%, which met the EFA requirements and improved growth in blunt snout bream juvenile. This is in agreement with Wang et al. (2014) who reported that the optimal amount of dietary LA level for this type of fish (initial weight 0.80 ± 0.02 g) was 1.0% to 1.5%. The requirement of LA for most freshwater fish species range from 0.5 to 1.8% of the diet, such as 0.5% for milkfish (Chanos chanos) (Bautista and De la Cruz, 1988), 1.0% for grass carp (Ctenopharyngodon) (Takeuchi et al., 1991) and tilapia (Tilapia zilli) (Kanazawa et al., 1980), and 1.8% for silver perch (Bidyanus bidyanus) (Smith et al., 2004). It is interesting to note that increasing the levels of SO above 20% resulted in a reduction in growth and an increase in FCR. It indicated that an excess of dietary SO results in poor BWG and high FCR which is similar to those reported by Li et al. (2010) who found significantly high FCR in the blunt snout bream fed dietary SO levels above 4%. Smith et al. (2004) found that increasing the LA level above 1.8% can significantly decrease the BWG of silver perch (B. bidyanus). Reduced growth with incremental dietary SO could be attributed to an imbalance of fatty acid composition in the diet. The ratios of Σ SFA/Σ PUFA and n−6/n−3 PUFA in test diets substantially changed with incremental dietary SO level. This has been attributed to the effect of the fatty acid balance on the energy intake from the catabolism of those FAs through β oxidation (Caballero et al., 2002; Stubhaug et al., 2007).

20

Y. Li et al. / Aquaculture 451 (2016) 16–23

Table 5 Fatty acid composition (% of total fatty acids) in the liver of blunt snout bream juvenile fed diets with different levels of soybean oil (SO) for 9 weeks. Fatty acids

14:0 16:0 17:0 18:0 Σ SFA 16:1n−7 17:1n−9 18:1n−7 18:1n−9 20:1n−9 20:1n−11 Σ MUFA 18:2n−6 (LA) 20:2n−6 20:4n−6 (ARA) Σ n−6 PUFA 18:3n−3(LNA) 20:4n−3 20:5n−3 (EPA) 22:5n−3 22:6n−3 (DHA) Σ n−3 PUFA Σ SFA/Σ PUFA n−3/n−6 PUFA

Experimental diets (dietary SO level) 0%SO

20%SO

32%SO

56%SO

100%SO

100%FO

1.0 ± 0.1a 22.6 ± 0.9 0.8 ± 0.1 7.4 ± 0.5bc 31.8 ± 0.5b 3.7 ± 0.2b 0.6 ± 0.1a 3.8 ± 0.2b 42.9 ± 0.9c 1.2 ± 0.1ab 0.6 ± 0.1a 52.7 ± 1.1c 2.9 ± 0.2a 0.4 ± 0.0 0.9 ± 0.1a 4.2 ± 0.3a 0.8 ± 0.1a 1.2 ± 0.1 2.0 ± 0.5b 2.3 ± 0.2 2.3 ± 0.1b 8.6 ± 0.4b 2.5 ± 0.1d 2.0 ± 0.1c

0.9 ± 0.1a 21.8 ± 0.7 1.0 ± 0.1 8.2 ± 0.3cd 31.9 ± 0.2b 3.3 ± 0.4b 1.0 ± 0.1b 3.1 ± 0.3a 39.6 ± 0.5b 0.9 ± 0.1a 0.6 ± 0.1a 48.4 ± 0.4b 5.5 ± 0.1b 0.5 ± 0.1 1.5 ± 0.2a 7.5 ± 0.2b 0.9 ± 0.1a 1.3 ± 0.2 2.0 ± 0.2b 2.3 ± 0.2 2.3 ± 0.2b 8.7 ± 0.7b 2.0 ± 0.1c 1.2 ± 0.1b

1.0 ± 0.1a 21.7 ± 0.6 0.6 ± 0.1 8.4 ± 0.3d 31.6 ± 0.4b 3.3 ± 0.1b 0.5 ± 0.0a 3.1 ± 0.2a 39.6 ± 0.6b 0.9 ± 0.1ab 0.4 ± 0.0a 47.8 ± 0.9b 6.6 ± 0.1c 0.6 ± 0.1 2.0 ± 0.4ab 9.2 ± 0.3c 0.8 ± 0.1a 1.3 ± 0.3 1.9 ± 0.2b 2.4 ± 0.3 2.3 ± 0.2b 8.8 ± 0.6b 1.8 ± 0.1bc 1.0 ± 0.1b

0.8 ± 0.0a 22.0 ± 0.7 0.6 ± 0.0 7.5 ± 0.6bc 31.0 ± 0.8b 3.0 ± 0.1b 0.5 ± 0.0a 2.6 ± 0.1a 38.4 ± 0.1b 1.7 ± 0.1bc 0.5 ± 0.1a 46.6 ± 0.3b 9.6 ± 0.1d 0.6 ± 0.1 2.5 ± 0.2b 12.5 ± 0.2d 0.7 ± 0.1a 1.3 ± 0.3 1.3 ± 0.1a 2.3 ± 0.1 1.8 ± 0.2a 7.4 ± 0.7a 1.6 ± 0.1b 0.6 ± 0.1a

1.0 ± 0.1a 21.9 ± 0.6 0.9 ± 0.1 7.1 ± 0.4b 31.0 ± 0.8b 2.1 ± 0.3a 1.9 ± 0.1c 3.3 ± 0.3ab 30.5 ± 0.3a 1.0 ± 0.1ab 1.5 ± 0.3b 40.3 ± 0.2a 13.9 ± 0.4e 0.9 ± 0.3 3.5 ± 0.6c 18.2 ± 0.8e 0.7 ± 0.1a 1.2 ± 0.1 1.1 ± 0.1a 2.2 ± 0.2 1.8 ± 0.1a 7.0 ± 0.8a 1.2 ± 0.1a 0.4 ± 0.1a

1.8 ± 0.0b 20.8 ± 0.5 0.6 ± 0.0 4.9 ± 0.1a 28.2 ± 0.7a 4.6 ± 0.1c 0.6 ± 0.1a 4.0 ± 0.1b 39.2 ± 1.4b 2.2 ± 0.2c 2.4 ± 0.3c 53.0 ± 2.4c 2.8 ± 0.2a 0.5 ± 0.3 1.1 ± 0.2a 4.4 ± 0.3a 1.4 ± 0.1b 1.1 ± 0.1 3.2 ± 0.0c 2.3 ± 0.1 4.8 ± 0.4c 12.8 ± 0.5c 1.6 ± 0.1b 2.9 ± 0.2d

Values are means ± SE of three replicates (10 fish/tank). Means in the same row with different superscripts are significantly different (P b 0.05). LA, linoleic acid; ARA, arachidonic acid; LNA, linolenic acid; EPA, eicosapentaenoic acid; DHA, docosahexaenoic acid; SFAs, saturated fatty acid; MUFAs, monounsaturated fatty acids; PUFAs, polyunsaturated fatty acids. nd, not detected.

FO is widely used in fish feed formulation because of its n − 3 LCPUFA that are EFAs for the fish. Although dietary n−3 LC-PUFA concentrations were not detected in experiment diets except in the 100%FO diet, 20%SO and FO group showed similar BWG. These results suggested that blunt snout bream had no or very low demand of n − 3 LC-PUFA content for growth performance. Radunz Neto et al. (1996) reported that the optimal dietary level of n − 3 LC-PUFA for common carp Cyprinus carpio larvae was about 0.05%. Takeuchi and Watanabe

(1976) reported that the requirement level for n − 3 LC-PUFA was 0.4–0.5% in rainbow trout Oncorhynchus mykiss. These results show that freshwater fish had an innate capacity to desaturate and elongate LNA to n−3 LC-PUFA (Sargent et al., 2002). In the present study, the hepatic lipid deposition increased with dietary SO supplementation and the value in 100%SO group was 1.6-fold higher than that in the 0%SO group. Increased hepatic lipid might be due to a high dose of dietary LA in SO diet. The detrimental effects of

Table 6 Fatty acid composition (% of total fatty acids) in the muscle of blunt snout bream juvenile fed diets with different levels of soybean oil (SO) for 9 weeks. Fatty acids

Experimental diets (dietary SO level) 0%SO

14:0 16:0 17:0 18:0 Σ SFA 16:1n−7 17:1n−9 18:1n−7 18:1n−9 20:1n−9 20:1n−11 Σ MUFA 18:2n−6 (LA) 20:2n−6 20:4n−6 (ARA) Σ n−6 PUFA 18:3n−3(LNA) 20:4n−3 20:5n−3 (EPA) 22:5n−3 22:6n−3 (DHA) Σ n−3 PUFA Σ SFA/Σ PUFA n−3/n−6 PUFA

20%SO b

1.3 ± 0.1 22.1 ± 0.3c 0.6 ± 0.0 5.1 ± 0.1c 29.0 ± 0.4b 4.1 ± 0.1c 1.2 ± 0.1ab 3.6 ± 0.1bc 42.2 ± 0.5e 0.9 ± 0.1a 0.8 ± 0.7ab 52.8 ± 0.5d 6.2 ± 0.1a 0.4 ± 0.0 1.2 ± 0.2a 7.7 ± 0.3a 0.5 ± 0.1a 1.0 ± 0.0 2.5 ± 0.1b 1.4 ± 0.1a 2.3 ± 0.1b 7.9 ± 0.6b 1.9 ± 0.1d 1.0 ± 0.1d

32%SO ab

1.2 ± 0.1 20.1 ± 0.6b 1.2 ± 0.1 4.9 ± 0.3c 27.4 ± 0.9b 4.0 ± 0.1c 1.3 ± 0.1ab 3.2 ± 0.1ab 40.7 ± 0.1d 1.2 ± 0.1ab 1.2 ± 0.1ab 51.6 ± 0.8cd 7.9 ± 0.2b 0.5 ± 0.0 1.6 ± 0.1abc 10.0 ± 0.7b 0.5 ± 0.1a 1.0 ± 0.1 2.4 ± 0.2b 1.5 ± 0.2a 2.4 ± 0.1b 7.8 ± 0.6b 1.5 ± 0.1c 0.8 ± 0.1cd

56%SO ab

1.0 ± 0.1 20.7 ± 1.0bc 0.4 ± 0.0 5.1 ± 0.3c 27.1 ± 0.9b 3.2 ± 0.2ab 0.7 ± 0.0a 3.3 ± 0.3ab 41.0 ± 0.1d 1.0 ± 0.0a 0.4 ± 0.0a 49.5 ± 1.0bc 10.7 ± 0.3c 0.5 ± 0.0 1.3 ± 0.0ab 12.6 ± 0.2c 0.4 ± 0.1a 1.0 ± 0.0 2.3 ± 0.2b 1.3 ± 0.0a 2.5 ± 0.1b 7.8 ± 0.4b 1.3 ± 0.1b 0.6 ± 0.1b

100%SO ab

0.9 ± 0.1 20.8 ± 0.4bc 0.4 ± 0.0 4.7 ± 0.1bc 26.8 ± 0.5b 3.3 ± 0.2b 0.7 ± 0.0a 2.9 ± 0.2ab 39.4 ± 0.2c 1.0 ± 0.1a 1.1 ± 0.1ab 48.5 ± 0.8b 12.6 ± 0.6d 0.4 ± 0.0 2.2 ± 0.1bc 15.2 ± 0.6d 0.3 ± 0.1a 1.4 ± 0.0 1.5 ± 0.1a 1.5 ± 0.1a 1.5 ± 0.1a 6.2 ± 0.3a 1.2 ± 0.1b 0.4 ± 0.1ab

100%FO a

0.9 ± 0.1 18.0 ± 0.2a 0.5 ± 0.0 4.1 ± 0.1ab 23.5 ± 0.4a 2.7 ± 0.1a 1.1 ± 0.1ab 2.8 ± 0.1a 34.4 ± 0.6b 0.4 ± 0.0a 1.0 ± 0.0ab 42.4 ± 0.7a 22.4 ± 0.2e 0.5 ± 0.0 2.1 ± 0.2bc 25.1 ± 0.4e 0.3 ± 0.1a 1.1 ± 0.1 1.4 ± 0.1a 1.5 ± 0.1a 1.4 ± 0.2a 5.7 ± 0.1a 0.8 ± 0.1a 0.2 ± 0.1a

2.0 ± 0.1c 20.7 ± 0.7bc 1.4 ± 0.1 3.5 ± 0.2a 27.6 ± 1.0b 6.1 ± 0.4d 1.9 ± 0.1b 4.1 ± 0.1c 32.0 ± 0.5a 2.0 ± 0.1b 2.2 ± 0.1b 48.4 ± 0.8b 6.3 ± 0.2a 0.6 ± 0.0 2.4 ± 0.0c 9.3 ± 0.3b 1.0 ± 0.1b 1.0 ± 0.1 3.2 ± 0.1c 2.6 ± 0.5b 3.7 ± 0.2c 11.5 ± 0.4c 1.3 ± 0.1b 1.2 ± 0.1e

Values are means ± SE of three replicates (10 fish/tank). Means in the same row with different superscripts are significantly different (P b 0.05). LA, linoleic acid; ARA, arachidonic acid; LNA, linolenic acid; EPA, eicosapentaenoic acid; DHA, docosahexaenoic acid; SFAs, saturated fatty acid; MUFAs, monounsaturated fatty acids; PUFAs, polyunsaturated fatty acids. nd, not detected.

Y. Li et al. / Aquaculture 451 (2016) 16–23

21

Fig. 2. Effects of graded dietary SO levels on relative mRNA expression of hepatic fatty acid metabolism-related genes (elovl5, Δ6 FAD, SCD, PPAR-α, PPAR-β, PPAR-γ, LPL, FABP and FAS) in juvenile blunt snout bream for 9 weeks. Values are means ± SE, n = 3 replicate tanks, three fish were sampled for each tank; different letters above the bars showed there were significant differences among different treatments (P b 0.05).

supplementation of high dose of dietary LA on hepatic lipid deposition in mammals have been demonstrated in a number of studies (Simopoulos, 1994; Pérez-Matute et al., 2007; Muhlhausler and Ailhaud, 2013). Alvheim et al. (2012) reported that lipogenesis increased with increasing dietary LA in rat. Furthermore, Gao et al. (2004) found that the insulin resistance occurred at high LA accumulation in rat adipocytes. Nevertheless, the molecular mechanisms underlying the effect of high dietary SO level on hepatic lipid deposition in fish requires further study. In this study, the liver and muscle FA profile of blunt snout bream generally reflected the dietary FA composition and is in agreement with other studies (Sun et al., 2011; Li et al., 2015a). The proportion of LA in liver and muscle of blunt snout bream increased with increasing SO in the diet. However, the ranges for percentages of LA in the liver and muscle were narrower than those for dietary lipids, suggesting that LA is used exclusively to the meet energy demands of the fish (Dosanjh et al., 1998; Luo et al., 2008). It should be noted that LA and LNA were the only two LC-PUFAs in the SO group diets. However, in the liver and muscle, other LC-PUFAs such as ARA, EPA and DHA were also found in fish fed the SO groups diets and the ARA content was significantly increased by the dietary SO supplementation. This suggested

that blunt snout bream was able to elongate and desaturate LA and LNA to their end products, which is in agreement with our previous studies on blunt snot bream fingerlings (Li et al., 2015a), and other studies with freshwater fish (Sargent et al., 2002; Ruyter et al., 2006; Turchini et al., 2006; Blanchard et al., 2008). On the other hand, in contrast to the ARA, the EPA, DHA and total n−3 PUFA content in the liver and muscle were significantly lower in the 56%SO and 100%SO groups compared to the other SO groups. Sargent et al. (2002) reported of a competitive inhibition between the n−3 and n−6 fatty acid PUFA because both of them were substrates for elongase and desaturase enzymes. This can also occur due to a substrate competition of n − 3 HUFA metabolites with n − 6 HUFA metabolites for the elongase and desaturase. It appears that the competition is between LNA and LA for the Δ6/Δ5 desaturase and elovl2/elovl5 elongase enzyme systems (Morais et al., 2009; Tan et al., 2009). The process of hepatic lipid metabolism is complex in fish and is not fully understood. In this study, the expression of most genes involved in lipid metabolism and lipid content maintenance in liver were affected by the dietary SO levels. Increasing dietary SO supplementation upregulated the mRNA levels of elovl5, which correlated well with the increase in ARA content of the liver. It suggested that fish fed high dietary

22

Y. Li et al. / Aquaculture 451 (2016) 16–23

SO have more available substrate (LA) for elongation of the n−6 PUFA series. In the present study, the Δ6 FAD expression was not affected by the dietary SO supplementation, which might be due to saturation of the desaturation reaction to transform the available substrate (LA) over time. It is well known that SCD plays an important role in fatty acid metabolism and cell membrane fluidity regulation (Guo et al., 2013) by catalyzing the conversion of saturated fatty acids to n−9 monounsaturated fatty acids (Eigenheer et al., 2002; Roongta et al., 2011; Zhang et al., 2014). In addition, increased SCD activity has been associated with increased fatty acid synthesis and decreased fatty acid oxidation (Sampath et al., 2007; Bjermo and Riserus, 2010). Thus, an increased SCD could be used as a marker for increased fat preference and lipid accumulation. In the present study, hepatic SCD mRNA expression significantly increased with incremental dietary SO supplementation level. It indicated that high dose of dietary SO supplementation up-regulated SCD expression, to increase adipose tissues of lipid accumulation, which is consistent with the results of hepatic lipid contents in this study. Upregulated SCD expression may be related to the high dose of LA in SO fed fish. In mammals, it has been previously reported that a high dose of dietary LA reduced triacylglycerol breakdown to increase triacylglycerol assembly and to provoke insulin resistance (Harant-Farrugia et al., 2014). PPAR-α and PPAR-β are two key transcription factors that are involved in lipid metabolism (Kersten, 2001; Dressel et al., 2003). PPARα plays an important role in the catabolism of fatty acids by regulating the expression of several key enzymes involved in fatty acid oxidation (Zheng et al., 2014; Li et al., 2015b). Meanwhile, PPAR-β activates lipid utilization by regulating the expression of target gene encoding enzymes involved in β-oxidation and energy uncoupling in various tissues (Dressel et al., 2003). In the present study, the highest expressions of PPAR-α and PPAR-β were detected in the liver of fish fed the 20%SO diet and was down-regulated in those fed dietary SO levels from 20% to 100%. Similarly, our previous study found the highest expression of PPAR-α in the liver of blunt snout bream fingerlings fed a diet with optimum level of phospholipid rich in LA (Li et al., 2015a). This indicates that the optimum level of LA increased the mRNA gene expressions of PPAR-α and incomplete or excessive intake of this n − 6 PUFA may suppress PPAR-α expression in fish. A similar trend was also found in hepatic PPAR-β expression. These indicate that the high percentage of SO in the diet would inhibit the expressions of PPAR-α and PPAR-β, which may be correlated with the down-regulation of the βoxidation-related genes (Lu et al., 2013). The decrease in liver PPAR-α and PPAR-β activity could to some extent explain the increase in lipid accumulation in the liver of blunt snout bream fed increasing SO levels in the diet. In this study, 56%SO and 100%SO groups had significantly higher FABP mRNA expression than in other SO groups. FABPs provide solubility and intracellular trafficking of long-chain fatty acids and other hydrophobic ligands (Coe and Bernlohr, 1998). Although some studies have focused on studying the function of FABP genes in fish (Venold et al., 2012; Bayır et al., 2015), compared with the mammals, the function of fish FABP in lipid metabolism is not clearly understood. Previous studies have demonstrated that PUFA can regulate the FABP gene expression (Distel et al., 1992). Moreover, FABPs can act specifically and cooperatively with LA to modulate the growth of hepatocytes (Keler et al., 1992). In conclusion, the results from this study clearly demonstrate that supplementation of 20% SO (8% dietary lipid) improved BWG in blunt snout bream juvenile. However, higher doses of SO supplementation in the diet reduced growth, increased hepatic lipid content, upregulated elovl5 and SCD gene expression, and down-regulated PPAR-α in the liver. These effects may be related to the high amount of LA in SO. To our knowledge, the present study is the first to explore the effect of different dietary SO levels on lipid metabolism in freshwater fish and provides new insights into the role of SO in the freshwater aquatic feed.

Acknowledgements This study was supported by the Fundamental Research Funds for the Central Universities (Project 2013PY074). We thank Dr. Ravi Gooneratne from Lincoln University for editing the English grammar. References AOAC, 1995. Official methods of analysis of the association official analytical chemists. AOAC international. 16th edn. AOAC, Arlington VA. Alvheim, A.R., Malde, M.K., Osei-Hyiaman, D., Hong Lin, Y., Pawlosky, R.J., Madsen, L., Kristiansen, K., Frøyland, L., Hibbeln, J.R., 2012. Dietary linoleic acid elevates endogenous 2-AG and anandamide and induces obesity. Obesity 20, 1984–1994. Bautista, M.N., De la Cruz, M.C., 1988. Linoleic (ω6) and linolenic (ω3) acids in the diet of fingerling milkfish (Chanos chanos Forsskal). Aquaculture 71 (4), 347–358. Bayır, M., Bayır, A., Wright, J.M., 2015. Divergent spatial regulation of duplicated fatty acid-binding protein (fabp) genes in rainbow trout (Oncorhynchus mykiss). Comp. Biochem. Physiol. D 14, 26–32. Bjermo, H., Riserus, U., 2010. Role of hepatic desaturases in obesity-related metabolic disorders. Curr. Opin. Clin. Nutr. Metab. Care 13, 703–708. Blanchard, G., Makombu, J.G., Kesternont, P., 2008. Influence of different dietary 18: 3n−3/18:2n−6 ratio on growth performance, fatty acid composition and hepatic ultrastructure in Eurasian perch, Perca fluviatilis. Aquaculture 284, 144–150. Coe, N.R., Bernlohr, D.A., 1998. Physiological properties and functions of intracellular fatty acid-binding proteins. BBA 1391 (3), 287–306. Caballero, M.J., Obach, A., Rosenlund, G., Montero, D., Gisvold, M., Izquierdo, M.S., 2002. Impact of different dietary lipid sources on growth, lipid digestibility, tissue fatty acid composition and histology of rainbow trout, Oncorhynchus mykiss. Aquaculture 214 (1), 253–271. Distel, R.J., Robinson, G.S., Spiegelman, B.M., 1992. Fatty acid regulation of gene expression. Transcriptional and post-transcriptional mechanism. J. Biol. Chem. 267, 5937–5941. Dosanjh, B.S., Higgs, D.A., McKenzie, D.J., Randall, D.J., Eales, J.G., Rowshandeli, N., Rowshandeli, M., Deacon, G., 1998. Influence of dietary blends of menhaden oil and canola oil on growth, muscle lipid composition, and thyroidal status of Atlantic salmon (Salmo salar) in sea water. Fish Physiol. Biochem. 19, 123–134. Dressel, U., Allen, T.L., Pippal, J.B., Rohde, P.R., Lau, P., Muscat, G.E., 2003. The peroxisome proliferator-activated receptor β/δ agonist, GW501516, regulates the expression of genes involved in lipid catabolism and energy uncoupling in skeletal muscle cells. Mol. Endocrinol. 17 (12), 2477–2493. Du, Z.Y., Clouet, P., Huang, L.M., Degrace, P., Zheng, W.H., He, J.G., Tian, L.X., Liu, Y.J., 2008. Utilization of different dietary lipid sources at high level in herbivorous grass carp (Ctenopharyngodon idella): mechanism related to hepatic fatty acid oxidation. Aquac. Nutr. 14 (1), 77–92. Eigenheer, A.L., Young, S., Blomquist, G.J., Borgeson, C.E., Tillman, J.A., Tittiger, C., 2002. Isolation and molecular characterization of Musca domestica delta-9 desaturase sequences. Insect Mol. Biol. 11, 533–542. Fisheries Bureau, Ministry of Agriculture of China, 2013. China fishery statistical yearbook. China Agricultural Press, Beijing. Gao, J., Koshio, S., Ishikawa, M., Yokoyama, S., Mamauag, R.E.P., Han, Y., 2012. Effects of dietary oxidized fish oil with vitamin E supplementation on growth performance and reduction of lipid peroxidation in tissues and blood of Red sea bream Pagrus major. Aquaculture 356-357, 73–79. Gao, Z., Zhang, X., Zuberi, A., Hwang, D., Quon, M.J., Lefevre, M., Ye, J., 2004. Inhibition of insulin sensitivity by free fatty acids requires activation of multiple serine kinases in 3T3-L1 adipocytes. Mol. Endocrinol. 18, 2024–2034. Guo, Z.H., Yang, Z.G., Cheng, Y.X., Ji, L.Y., Que, Y.Q., Liu, Z.W., Zeng, Q.T., 2013. Molecular characterization, tissue expression of acyl-CoA Δ9-desaturase-like gene, and effects of dietary lipid levels on its expression in the hepatopancreas of the Chinese mitten crab (Eriocheir sinensis). Aquaculture 402, 58–65. Harant-Farrugia, I., Garcia, J., Iglesias-Osma, M.-C., Garcia-Barrado, M.J., Carpéné, C., 2014. Is there an optimal dose for dietary linoleic acid? Lessons from essential fatty acid deficiency supplementation and adipocyte functions in rats. J. Physiol. Biochem. 70, 615–627. Jakobsson, A., Westerberg, R., Jacobsson, A., 2006. Fatty acid elongases in mammals: their regulation and roles in metabolism. Prog. Lipid Res. 45 (3), 237–249. Kanazawa, A., Teshima, S., Sakamoto, M., Awal, M.A., 1980. Requirement of Tilapia zilli for essential fatty acids. Jpn. Soc. Sci. Fish. 46, 1353–1356. Keler, T., Barker, C.S., Sorof, S., 1992. Specific growth stimulation by linoleic acid in hepatoma cell lines transfected with the target protein of a liver carcinogen. Proc. Natl. Acad. Sci. U. S. A. 89 (11), 4830–4834. Kersten, S., 2001. Mechanisms of nutritional and hormonal regulation of lipogenesis. EMBO Rep. 2 (4), 282–286. Li, X.F., Liu, W.B., Jiang, Y.Y., Zhu, H., Ge, X.P., 2010. Effects of dietary protein and lipid levels in practical diets on growth performance and body composition of blunt snout bream (Megalobrama amblycephala) fingerlings. Aquaculture 303 (1), 65–70. Li, Y., Gao, J., Huang, S.Q., 2015a. Effects of different dietary phospholipid levels on growth performance, fatty acid composition, PPAR gene expressions and antioxidant responses of blunt snout bream Megalobrama amblycephala fingerlings. Fish Physiol. Biochem. 41, 423–426. Li, Y., Zhao, Y.T., Zhang, Y.K., Liang, X., Zhang, Y., Gao, J., 2015b. Growth performance, fatty acid composition, peroxisome proliferator activated receptors gene expressions and antioxidant abilities of Megalobrama amblycephala fingerlings fed different dietary oil sources. J. World Aquacult. Soc. http://dx.doi.org/10.1111/jwas.12203.

Y. Li et al. / Aquaculture 451 (2016) 16–23 Livak, K.J., Schmittgen, T.D., 2001. Analysis of relative gene expression data using realtime quantitative PCR and the 2−ΔΔCt method. Methods 25, 402–408. Lu, K.L., Xu, W.N., Li, X.F., Liu, W.B., Wang, L.N., Zhang, C.N., 2013. Hepatic triacylglycerol secretion, lipid transport and tissue lipid uptake in blunt snout bream (Megalobrama amblycephala) fed high-fat diet. Aquaculture 408-409, 160–168. Lu, K.L., Xu, W.N., Wang, L.N., Zhang, D.D., Zhang, C.N., Liu, W.B., 2014. Hepatic β-oxidation and regulation of carnitine palmitoyltransferase (CPT) I in blunt snout bream Megalobrama amblycephala fed a high fat diet. PLoS One 9 (3), e93135. Luo, Z., Li, X., Bai, H., Gong, S., 2008. Effects of dietary fatty acid composition on muscle composition and hepatic fatty acid profile in juvenile Synechogobius hasta. J. Appl. Ichthyol. 24 (1), 116–119. Morais, S., Monroig, O., Zheng, X., Leaver, M.J., Tocher, D.R., 2009. Highly unsaturated fatty acid synthesis in Atlantic salmon: characterization of ELOVL5-and ELOVL2-like elongases. Mar. Biotechnol. 11 (5), 627–639. Muhlhausler, B.S., Ailhaud, G.P., 2013. Omega-6 polyunsaturated fatty acids and the early origins of obesity. Curr. Opin. Endocrinol. Diabetes Obes. 20, 56–61. Pérez-Matute, P., Martinez, J.A., Marti, A., Moreno-Aliaga, M.J., 2007. Linoleic acid decreases leptin and adiponectin secretion from primary rat adipocytes in the presence of insulin. Lipids 42, 913–920. Radunz Neto, J., Corraze, G., Bergot, P., Kaushik, S.J., 1996. Estimation of essential fatty acid requirements of common carp larvae using semi-purified diets. Arch. Anim. Nutr. 49, 41–48. Roongta, U.V., Pabalan, J.G., Wang, X., Ryseck, R.P., Fargnoli, J., Henley, B.J., Yang, W.B., Zhu, J., Maireddi, M.T., Lawrence, R.M., Wong, T.W., Rupnow, B.A., 2011. Cancer cell dependence on unsaturated fatty acids implicates stearoyl-CoA desaturase as a target for cancer therapy. Mol. Cancer Res. 9 (11), 1551–1561. Ruyter, B., Moya-Falcón, C., Rosenlund, G., Vegusdal, A., 2006. Fat content and morphology of liver and intestine of Atlantic salmon (Salmo salar): effects of temperature and soybean oil. Aquaculture 252, 441–452. Sampath, H., Miyazaki, M., Dobrzyn, A., Ntambi, J.M., 2007. Stearoyl-CoA desaturase-1 mediates the pro-lipogenic effects of dietary saturated fat. J. Biol. Chem. 282, 2483–2493. Sargent, J.R., Bell, J.G., McEvoy, L., Tocher, D.R., Estevez, A., 1999. Recent developments in the essential fatty acid nutrition of fish. Aquaculture 177, 191–199. Sargent, J.R., Tocher, D.R., Bell, J.G., 2002. The lipids. In: Halver, J.E., Hardy, R.W. (Eds.), Fish Nutrition, 3rd edn Academic Press, SanDiego, pp. 181–257. Simopoulos, A.P., 1994. Is insulin resistance influenced by dietary linoleic acid and trans fatty acids? Free Radic. Biol. Med. 17, 367–372. Smith, D.M., Hunter, B.J., Allan, G.L., Roberts, D.C.K., Booth, M.A., Glencross, B.D., 2004. Essential fatty acids in the diet of silver perch (Bidyanus bidyanus): effect of linolenic and linoleic acid on growth and survival. Aquaculture 236 (1), 377–390.

23

Stubhaug, I., Lie, Ø., Torstensen, B.E., 2007. Fatty acid productive value and beta-oxidation capacity in Atlantic salmon (Salmo salar L.) fed on different lipid sources along the whole growth period. Aquac. Nutr. 13, 145–155. Sun, S., Ye, J., Chen, J., Wang, Y., Chen, L., 2011. Effect of dietary fish oil replacement by rapeseed oil on the growth, fatty acid composition and serum non-specific immunity response of fingerling black carp, Mylopharyngodon piceus. Aquac. Nutr. 17 (4), 441–450. Takeuchi, T., Watanabe, K., Yong, W.-Y., Watanabe, T., 1991. Essential fatty acids of grass carp (Ctenopharyngodon idella). Nippon Suisan Gakkaishi 57, 467–473. Takeuchi, T., Watanabe, T., 1976. Nutritive value of n−3 highly unsaturated fatty acids in pollock liver oil for rainbow trout. Bull. Jpn. Soc. Sci. Fish. 42, 907–919. Tan, X.Y., Luo, Z., Xie, P., Liu, X.J., 2009. Effect of dietary linolenic acid/linoleic acid ratio on growth performance, hepatic fatty acid profiles and intermediary metabolism of juvenile yellow catfish Pelteobagrus fulvidraco. Aquaculture 296 (1), 96–101. Tocher, D.R., 2003. Metabolism and functions of lipids and fatty acids in teleost fish. Rev. Fish. Sci. 11 (2), 107–184. Turchini, G.M., Francis, D.S., De Silva, S.S., 2006. Fatty acid metabolism in the freshwater fish Murray cod (Maccullochella peelii peelii) deduced by the whole body fatty acid balance method. Comp. Biochem. Physiol. 144B, 110–118. Venold, F.F., Penn, M.H., Krogdahl, A., Overturf, K., 2012. Severity of soybean meal induced distal intestinal inflammation, enterocyte proliferation rate, and fatty acid binding protein (Fabp2) level differ between strains of rainbow trout (Oncorhynchus mykiss). Aquaculture 364, 281–292. Wang, Y.H., Liu, W.B., Wang, H.C., Chen, J., Luo, G.L., Xing, J., 2014. Effects of dietary linoleic and linolenic acid levels on growth, body composition and digestive enzyme activities in juvenile blunt snout bream Megalobrama amblycephala. J. Dalian Ocean Univ. 4, 373–380. Xue, X., Feng, C.Y., Hixson, S.M., Johnstone, K., Anderson, D.M., Parrish, C.C., Rise, M.L., 2014. Characterization of the fatty acyl elongase (elovl) gene family, and hepatic elovl and delta-6 fatty acyl desaturase transcript expression and fatty acid responses to diets containing camelina oil in Atlantic cod (Gadus morhua). Comp. Biochem. Physiol. B Biochem. Mol. Biol. 175, 9–22. Zhang, D.D., Lu, K.L., Dong, Z.J., Jiang, G.Z., Xu, W.N., Liu, W.B., 2014. The effect of exposure to a high-fat diet on microRNA expression in the liver of blunt snout bream (Megalobrama amblycephala). PLoS One 9 (5), e96132. Zheng, J.L., Luo, Z., Zhuo, M.Q., Pan, Y.X., Song, Y.F., Hu, W., Chen, Q.L., 2014. Dietary L -carnitine supplementation increases lipid deposition in the liver and muscle of yellow catfish (Pelteobagrus fulvidraco) through changes in lipid metabolism. Br. J. Nutr. 112 (05), 698–708.