Effects of folic acid and sodium selenite on growth performance, nutrient digestion, ruminal fermentation and urinary excretion of purine derivatives in Holstein dairy calves

Livestock Science 231 (2020) 103884

Contents lists available at ScienceDirect

Livestock Science journal homepage: www.elsevier.com/locate/livsci

Effects of folic acid and sodium selenite on growth performance, nutrient digestion, ruminal fermentation and urinary excretion of purine derivatives in Holstein dairy calves

T

⁎

G.W. Zhang, C. Wang, H.S. Du, Z.Z. Wu, Q. Liu , G. Guo, W.J. Huo, J. Zhang, Y.L. Zhang, C.X. Pei, S.L. Zhang College of Animal Science and Veterinary Medicine, Shanxi Agricultural University, Taigu, 030801 Shanxi, PR China

A R T I C LE I N FO

A B S T R A C T

Keywords: Folic acid Sodium selenite Growth performance Ruminal fermentation Microflora Dairy calves

This study evaluated the effects of folic acid (FA) and sodium selenite (SS) supplements on growth performance, nutrient digestion, ruminal fermentation, microbial enzyme activity, microflora and urinary excretion of purine derivatives (PD) in dairy calves. Thirty-six Holstein calves (63 ± 3.4 days of age and 83 ± 2.1 kg of body weight) were randomly assigned to four treatments in a 2 × 2 factorial arrangement. Two levels of FA (0 or 3.0 mg/kg of FA) and SS (0 or 0.3 mg/kg of Se from SS) were added into diets on a dry matter (DM) basis. Nutrient intake and average daily gain increased with FA addition, but were not affected by SS addition. Both supplements increased total tract digestibility of DM, organic matter and neutral detergent fiber. Ruminal pH and ammonia N concentration decreased, but total volatile fatty acids concentration increased with FA or SS addition. Acetate molar proportion and acetate to propionate ratio increased, while propionate molar proportion decreased with FA addition. The unchanged acetate molar proportion, higher propionate molar proportion and lower acetate to propionate ratio were observed with SS addition compared with the control. Activities of xylanase, pectinase, α-amylase and protease as well as populations of total bacteria, protozoa and methanogens were higher for both supplements compared with the control. Carboxymethyl-cellulase activity and Prevotella ruminicola population increased with FA addition. The Ruminobacter amylophilus population decreased with SS addition. The FA×SS interaction was significant for total tract digestibility of crude protein and acid detergent fiber, populations of total fungi, Ruminococcus (R.) albus, R. flavefaciens, Fibrobacter succinogenes and Butyrivibrio fibrisolvens as well as urinary total PD excretion; these variables increased with SS addition and the increase was greater when the diet was not supplemented with FA than with FA supplemented diet. The results indicated that dietary FA and/or SS addition stimulated nutrient digestion, ruminal fermentation, microbial growth and urinary total PD excretion.

1. Introduction The major function of folic acid (FA) is to accept and donate one carbon unit in amino acid metabolism, purine and pyrimidine synthesis, and the formation of the primary methylating agent, S-adenosylmethionine (SAM) (Bailey and Gregory, 1999). The ingested FA is firstly reduced to dihydrofolic, and then tetrahydrofolate which accepts methyl group to form 5-methyltetrahydrofolate (Bailey and Gregory, 1999). La et al. (2019) found that dietary FA addition increased average daily gain (ADG) and hepatic mRNA expression of

genes related to protein synthesis in calves. Slyter and Weaver (1977) reported that the growth rate of ruminal Ruminococcus (R.) flavefaciens was not affected when its essential nutrient tetrahydrofolate was substituted with 5-methyltetrahydrofolate, but decreased when tetrahydrofolate was replaced by dihydrofolic. Other studies found that ruminal relative abundance of R. albus, R. flavefaciens, Fibrobacter (F.) succinogenes and Butyrivibrio (B.) fibrisolvens and microbial protein synthesis increased with FA addition in calves (Wang et al., 2019b; La et al., 2019). The results indicated that dietary FA stimulated ruminal microbial growth by participating in one carbon unit metabolism.

Abbreviations: ADG, average daily gain; ADF, acid detergent fiber; CMC, carboxymethyl-cellulase; CP, crude protein; DM, dry matter; DMI, dry matter intake; FA, folic acid; FCR, feed conversion ratio; MTHFR, methylene tetrahydrofolate reductase; NDF, neutral detergent fiber; OM, organic matter; PD, purine derivative; RPFA, rumen-protected FA; SAH, S-adenosylhomocysteine; SAM, S-adenosylmethionine; SS, sodium selenite; TMR, total mixed ration; VFA, volatile fatty acids ⁎ Corresponding author. E-mail address: [email protected] (Q. Liu). https://doi.org/10.1016/j.livsci.2019.103884 Received 15 June 2019; Received in revised form 22 October 2019; Accepted 25 November 2019 Available online 26 November 2019 1871-1413/ © 2019 Elsevier B.V. All rights reserved.

Livestock Science 231 (2020) 103884

G.W. Zhang, et al.

However, knowledge about the influences of FA addition on ruminal total bacteria, fungi, protozoa and methanogens is limited. Selenium (Se), as a component of glutathione peroxidase, plays a major role in improving the antioxidant status of calves (NRC, 2001). Ruminal microbes incorporate Se from the feed to form their protein or cell wall components (Hidiroglou et al., 1968), and the antioxidant status of the rumen and microbes were improved due to Se addition (Cobanova et al., 2017). Salles et al. (2014) reported that the immune system function was improved, and feed conversion ratio (FCR) tended to be more efficient with daily addition of 0.8 mg of Se from yeast in calves. Cobanova et al. (2017) found that dietary addition of 0.4 mg Se/ kg dry matter (DM) from sodium selenite (SS) increased Se content in ruminal mucosa and microbes as well as glutathione peroxidase activity in bacteria and protozoa of sheep. Other studies reported that dietary Se addition increased ruminal total microbial count (Hidiroglou et al., 1968) and sitmulated protozoa growth in sheep (Mihalikova et al., 2005). Wang et al. (2009a) observed that ruminal total volatile fatty acids (VFA) concentration increased and the ratio of acetate to propionate decreased when 0.3 mg Se/kg DM from Se yeast was supplemented in dairy cows. The results indicated that dietary Se addition was necessary for promoting ruminal microbial growth. However, knowledge about the effects of Se addition on ruminal microflora and enzyme activity was limited. In addition, recent studies demonstrated that dietary supplemented Se increased hepatic DNA methylation and interacted with FA to modulate one carbon unit metabolism in rats (Davis and Uthus, 2003; Speckmann et al., 2017). Based on the results above, it was hypothesized that the combined addition of FA and Se might be more efficient in promoting ruminal microbial growth than FA or Se supplement alone in calves. Sodium selenite is a generally used Se supplement in dairy cows (NRC, 2001). Therefore, this study was conducted to evaluate the effects of FA and SS addition on growth performance, nutrient digestion, rumen fermentation, microflora and urinary excretion of purine derivatives (PD) in dairy calves.

Table 1 Ingredient and chemical composition of the basal diet. Ingredients

Contents [g/kg]

Corn silage Corn grain, ground Wheat bran Soybean meal Cottonseed cake Calcium carbonate Salt Sodium bicarbonate Mineral and vitamin premix1 Chemical composition Dry matter Organic matter Crude protein Ether extract Neutral detergent fiber Acid detergent fiber Non-fiber carbohydrate2 Calcium Phosphorus Selenium (mg kg−1) Folate (mg kg−1) NEg (MJ/kg)

500 250 26.5 180 15 12.5 5.0 10 1.0 615.3 917.2 165.3 30.4 409.8 198.1 404.3 6.6 4.7 0.085 0.36 5.85

1 Contained per kg premix: 50,000 mg Fe, 8500 mg Cu, 30,000 mg Mn, 30,000 mg Zn, 300 mg I, 100 mg Co, 7500,000 IU vitamin A, 1200, 000 IU vitamin D, and 40, 000 IU vitamin E. 2 Non-fiber carbohydrate (NFC), calculated by 1000-CP-NDF-Fat-Ash.

2.3. Measurement and samples collection During the collection period BW of all calves were recorded on two consecutive days at d 1, 30 and 60, and ADG was calculated as BW changes divided by days in trial of calves. The TMR offered and refusals were recorded daily during the collection period to estimate DMI. The FCR was calculated as daily DMI divided by ADG for each calf. Both TMR and refusals were sampled daily, frozen at –20 °C, composited weekly by calf, dried in an oven at 55 °C for 48 h, and then ground with a cutting mill (G1-400B, Renxian smooth machinery factory, Hebei, China) to pass a 1 mm sieve. During d 61 to 68 of the collection period, the excretion of feces and urine were determined. All calves were set on a fecal collection bag and urine funnel. The output of feces and urine were recorded daily. Feces was sampled by 1/15 of wet weight, and then mixed with tartaric acid solution (100 g/L) according to 1/4 of fecal samples. After being dried at 55 °C, the fecal samples were ground to pass a 1-mm screen and composited by calf for further analysis. Urine was gathered daily for each calf and was sampled according to 1% of the total urine output. The urinary samples were kept in a reagent bottle with 30 mL sulphuric acid (10%) to maintain pH lower than 3.0. Urinary samples were composited by calf, diluted five times with distilled water, and separated into two subsamples, then were kept at −20 °C before analysis. Ruminal fluid from all calves were sampled by using a stomach tube via esophagus from day 31 to day 32 and day 69 to 70 of the collection period at 6:00, 12:00, 18:00 and 24:00 h. The initial 150 mL of ruminal fluid was discarded, and the subsequent 150 mL was collected. After evaluating pH using a portable pH meter (Sartorius Basic pH Mete rPB20, Sartorius AG, Goettingen, Germany) rumen fluid was filtered through four layers of cheesecloth. A 5 mL of filtrate was kept by adding 1 mL of 250 g/L meta-phosphoric acid to analyze VFA and another 5 mL of filtrate was kept by adding 1 mL of 20 g/L (w/v) H2SO4 to analyse NH3eN, and then stored frozen at –20 °C. A 10 mL and 5 mL of filtrates were stored in centrifuge tubes for microbial enzyme activity determination and DNA extraction, respectively, and then stored frozen at –80 °C. Ruminal fluid from four sampling times were mixed by equal volume for each calf per day before chemical analysis.

2. Materials and methods 2.1. Dairy calves and housing The calf use protocol was authorized by the Animal Care and Use Committee of Shanxi Agriculture University. The experiment was carried out at Shanxi Agricultural University Research Farm, Taigu, Shanxi, China from May 23, 2018 to August 20, 2018. The experimental region is located between 37.41° and 37.43° North, and 112.57° and 112.60° East, at an altitude range of 790 to 794 m over sea level. Thirtysix Holstein post-weaned calves (63 ± 3.4 days of age and 83 ± 2.1 kg of body weight [BW]) were selected, and housed in individual pens (2.5 m × 3 m). 2.2. Feeding and experimental design Calves were fed a total mixed ration (TMR) ad libitum and had free access to drinking water. The TMR was formulated to meet the nutrient requirement of dairy calves (NRC, 2001; Table 1). The amount of TMR offered was adjusted for a target of 5% refusals according to previous DM intake (DMI). Calves were randomly assigned to four treatments according to a 2 × 2 factorial arrangement, 9 calves per treatment. Four treatments were: (FA-SS-) neither FA nor SS supplements, (FA-SS +) no FA but with 0.3 mg/kg of Se from SS supplement, (FA+SS-) with 3.0 mg/kg of FA but no SS supplement, (FA+SS+) both FA and SS supplements. Supplemental FA (980 g/kg of FA) and SS (10 mg/kg of Se) were calculated on DM basis and mixed into TMR by mixing in premix with a mixer wagon (Storti Husky DS 70, Storti International, Belfiore VR, Italy). The experiment lasted 86 days with 16-d of adaptation followed by 70-d of data and sample collection. 2

Livestock Science 231 (2020) 103884

G.W. Zhang, et al.

analysis of PCR end products by increasing the temperature at a rate of 1 °C every 30 s from 60 to 95 °C. The condition of R. albus was 30 s at 94 °C for denaturing, 30 s at 55 °C for annealing and 30 s at 72 °C for extension (48 cycles), except for 9 min denaturation in the first cycle and 10 min extension in the last cycle. Real-time PCR amplification and detection were performed in a Chromo 4™ system (Bio-Rad, USA). Biotools QuantiMix EASY SYG KIT (B&M Labs, S. A., Spain) was used for real-time PCR amplification. Samples were assayed in duplicate in a 20 μL reaction mixture containing 4–6 mmol MgCl2, 10 μL of Mastermix (including; Taq DNA polymerase, reaction buffer, dNTP mixture, MgCl2 and SybrGreen), 2 μL of DNA template and 0.8 μL of each primer (10 μmol/μL).

2.4. Chemical analysis The ground samples (TMR, refusals and feces) were measured DM by drying at 135 °C for 3 h, crude ash by complete combustion at 550 °C for 6 h and N by using kjeldahl method (AOAC, 2000). Organic matter (OM) was calculated by the difference between DM and crude ash. Content of neutral detergent fiber (NDF) was analyzed based on the method of Van Soest et al. (1991) and acid detergent fiber (ADF) was measured according to AOAC (2000; method 973.18). Folate concentration of TMR and refusals were measured according to the method of Alaburda et al. (2008). Rumen VFA concentration was analyzed by gas chromatography (Trace 1300; Thermo Fisher Scientific Co., Ltd., Shanghai, China) with 2-ethylbutyric acid as internal standard. Ruminal ammonia nitrogen was evaluated by colorimetric spectrophotometer (UV2100, Shanghai Younike instrument Co., Ltd., Shanghai, China) according to AOAC (2000). Ruminal fluid was sonicated for 10 min with a 20 s pulse rate and at 4 °C, and then centrifuged to separate supernatant at 25 000 g and 4 °C for 15 min. The supernatant was used to determine microbial enzyme activity (carboxymethyl cellulase [CMC], cellobiase, xylanase, pectinase, α-amylase and protease) according to the method of Agarwal et al. (2002).

2.6. Statistical analyses Data were analyzed as a completely randomized design with a 2 (0 and 3 mg/kg of FA) × 2 (0 and 0.3 mg/kg of Se from SS) factorial arrangement of treatments by using the mixed procedure of SAS (Proc Mixed; SAS, 2000) according to the following model:

Yijklm = μ + Fi + Sj + (FS )ij + Tk + (TF )ik + (TS ) jk + (TFS )ijk + Rl : ijk + εijkll Where, Yijkl is the dependent variable; μ is the overall mean, Fi is the fixed effects of FA addition (i = with or without), Sj is the fixed effects of SS addition (j = with or without), (FS)ij is the FA × SS interaction; Tk is the fixed effect of time; (TF)ik is the Time × FA interaction; (TS)jk is the Time × SS interaction; (TFS)ijk is the Time × FA × SS interaction; Rl is the random effects of the mth calf; and εijkl is the residual error. Means were separated using the PDIFF option in the LSMEANS statement only for effects that were statistically significant (P < 0.050). Significance levels were declared at P < 0.050. Effects of time on all variable, the Time × FA interaction, the Time × SS interaction and the Time × FA × SS interaction for overall variable was not significant (P > 0.050), so these were not presented in the results.

2.5. Microbial DNA extraction and RT-PCR Total microbial DNA was isolated from 1.2 mL homogenized rumen fluid using the repeated bead-beating plus column method (Yu and Morrison, 2004). The quality and quantity of microbial DNA was evaluated via agarose gel electrophoresis and NanoDrop 2000 Spectrophotometer (Thermo Scientific, USA). The target populations were total bacteria, total anaerobic fungi, total protozoa, total methanogens, R. albus, R. flavefaciens, F. succinogenes, B. fibrisolvens, Prevotella (P.) ruminicola and Ruminobacter (Rb.) amylophilus. The sequences of all primer sets are listed in Table 2. The sample-derived standards of the determined microbes were set out from treatment pool set of microbial DNA. Sample-derived DNA standards for each real time PCR assay were generated by the regular PCR. The PCR product was purified using a QIA quick PCR purification kit (QIAGEN, Inc., Valencia, CA) and quantified using a spectrophotometer. Ten fold serial dilution was made in Tris-EDTA prior to real time PCR (Kongmun et al., 2010). The condition of the real-time PCR assay of target gene was 1 cycle of 50 °C for 2 min and 95 °C for 2 min for initial denaturation, and 45 cycles of 95 °C for 15 s and 60 °C for 1 min for primer annealing and product elongation. Amplicon specificity was performed via dissociation curve

3. Results 3.1. Feed intake, ADG and FCR The FA×SS interaction was not significant for nutrient intake, ADG and FCR (Table 3). Intake of DM, OM, CP, NDF and ADF were higher (P < 0.05) for FA addition, but were unchanged with SS addition. The higher (P = 0.012) ADG and lower (P = 0.002) FCR were observed for

Table 2 PCR primers for real-time PCR assay. Target species

Primer sequence (5′)

GeneBank accession no.

Annealing temperature (°C)

Size (bp)

Total bacteria

F: CGGCAACGAGCGCAACCC R: CCATTGTAGCACGTGTGTAGCC F: GAGGAAGTAAAAGTCGTAACAAGGTTTC R: CAAATTCACAAAGGGTAGGATGATT F: GCTTTCGWTGGTAGTGTATT R: CTTGCCCTCYAATCGTWCT F: TTCGGTGGATCDCARAGRGC R: GBARGTCGWAWCCGTAGAATCC F: CCCTAAAAGCAGTCTTAGTTCG R: CCTCCTTGCGGTTAGAACA F: ATTGTCCCAGTTCAGATTGC R: GGCGTCCTCATTGCTGTTAG F: ACCGCATAAGCGCACGGA R: CGGGTCCATCTTGTACCGATAAAT F: GTTCGGAATTACTGGGCGTAAA R: CGCCTGCCCCTGAACTATC F: CTGGGGAGCTGCCTGAATG R: GCATCTGAATGCGACTGGTTG F: GAAAGTCGGATTAATGCTCTATGTTG R: CATCCTATAGCGGTAAACCTTTGG

AY548787.1

60

147

GQ355327.1

57.5

120

HM212038.1

59

234

GQ339873.1

60

160

CP002403.1

60

176

AB849343.1

60

173

HQ404372.1

61

65

AB275512.1

61

121

MH708240.1

60

102

LT975683.1

58.5

74

Total anaerobic fungi Total protozoa Total methanogens R. albus R. flavefaciens B. fibrisolvens F. succinogenes Rb. amylophilus P. ruminicola

3

Livestock Science 231 (2020) 103884

G.W. Zhang, et al.

Table 3 Effects of folic acid (FA) and sodium selenite (SS) addition on nutrient intake, average daily gain and feed conversion ratio in dairy calves. Item

Dry matter intake (kg/d) Organic matter intake (kg/d) Crude protein intake (kg/d) Neutral detergent fiber intake (kg/d) Acid detergent fiber intake (kg/d) Average daily gain (kg/d) Feed conversion ratio (kg/kg)3 1 2 3

FA-1 SS-

SS+

FA+ SS-

SS+

3.69 3.38 0.61 1.51 0.73 0.79 4.70

3.90 3.58 0.64 1.60 0.77 1.01 3.86

4.45 4.08 0.74 1.82 0.88 1.20 3.71

4.44 4.07 0.73 1.82 0.88 1.26 3.53

SEM

0.201 0.198 0.032 0.162 0.038 0.128 0.279

P-values2 FA

SS

FA×SS

0.003 0.012 0.025 0.007 0.018 0.012 0.002

0.478 0.364 0.105 0.135 0.276 0.103 0.041

0.416 0.501 0.438 0.534 0.604 0.077 0.226

FA- = no FA; FA+ = 3.0 mg/kg of FA; SS- = no SS; SS+ = 0.3 mg/kg of Se from SS. FA: FA effect; SS: SS effect; FA×SS: the interaction between FA and SS addition. Feed conversion ratio = dry matter intake (kg/d)/average daily gain (kg/d).

(Table 5). Activity of CMC was higher (P = 0.001) for FA addition, but was not affected by SS addition. Activity of cellobiase was unchanged, but xylanase, protease, α-amylase and pectinase were higher (P < 0.05) for both supplements. The FA×SS interaction was significant (P < 0.05) for populations of total anaerobic fungi, R. albus, R. flavefaciens, F. succinogenes and B. fibrisolvens, which increased more with SS addition in diet without FA than in diet with FA. Both supplements increased (P < 0.05) populations of total bacteria, protozoa and methanogens. Population of P. ruminicola was higher (P = 0.001) for FA addition, but was unchanged with SS addition. Population of Rb. amylophilus was unchanged with FA addition, but was lower (P = 0.005) for SS addition.

FA addition. Dietary SS addition did not affect ADG, but decreased (P = 0.041) FCR. 3.2. Total tract nutrient digestibility and rumen fermentation The FA×SS interaction was significant (P < 0.05) for CP and ADF digestibility (Table 4); SS addition increased digestibility of CP and ADF and the increase was greater when the diet was not supplemented with FA than with the FA+ diet. The higher (P < 0.05) digestibility of DM, OM, and NDF were observed for both supplements. The FA×SS interaction was not significant for ruminal fermentation parameters. The lower (P < 0.05) ruminal pH and higher (P < 0.05) total VFA concentration were observed for both supplements. The higher (P = 0.016) acetate to propionate ratio was observed due to the increased (P = 0.028) acetate proportion and decreased (P = 0.033) propionate proportion with FA addition. Acetate proportion unchanged and propionate proportion increased (P = 0.020), hence the lower (P = 0.012) acetate to propionate ratio was observed with SS addition. Proportion of butyrate was similar among treatments. Proportions of valerate, isobutyrate and isovalerate were greater (P < 0.05) for FA addition, but were unchanged with SS addition. Ammonia N content was lower (P = 0.008) for FA addition, but was unchanged with SS addition.

3.4. Excretion of urinary PD The FA×SS interaction was significant (P < 0.05) for urinary allantoin and PD excretion; SS addition increased excretion of allantoin and total PD and the increase was greater when the diet was not supplemented with FA than with the FA+ diet (Table 6). The excretion of uric acid was unchanged for both supplements. 4. Discussion

3.3. Ruminal enzyme activity and microflora

The higher nutrient intake was associated with the positive impact of FA addition on NDF and ADF digestibility, which would cause a decrease in the distension of the rumen in calves. It had been

The FA×SS interaction was not significant for enzyme activity

Table 4 Effects of folic acid (FA) and sodium selenite (SS) addition on nutrient digestibility and ruminal fermentation in dairy calves. Item

Nutrient digestibility Dry matter Organic matter Crude protein Neutral detergent fiber Acid detergent fiber Ruminal fermentation pH Total VFA (mM) Mol/100 mol Acetate (A) Propionate (P) Butyrate Valerate Isobutyrate Isovalerate A:P3 Ammonia N (mg/100 ml) 1 2 3

FA-1 SS-

SS+

FA+ SS-

SS+

SEM

P-values2 FA

SS

FA×SS

0.723 0.737 0.729 0.576 0.413

0.750 0.767 0.763 0.600 0.436

0.763 0.776 0.778 0.618 0.446

0.778 0.789 0.786 0.633 0.459

0.005 0.004 0.006 0.003 0.003

0.012 0.034 0.001 0.001 0.001

0.041 0.039 0.001 0.041 0.044

0.250 0.211 0.012 0.066 0.032

6.66 83.29

6.44 95.02

6.40 94.32

6.35 106.6

0.082 1.654

0.037 0.009

0.043 0.007

0.071 0.958

64.13 20.24 11.13 1.78 1.69 1.04 3.18 12.69

62.89 22.84 10.01 1.61 1.60 1.05 2.75 11.71

65.56 18.91 9.99 2.01 2.28 1.26 3.46 10.03

64.79 20.46 9.62 1.92 2.08 1.13 3.16 11.53

0.308 0.238 0.125 0.141 0.022 0.038 0.047 0.286

0.028 0.033 0.060 0.003 0.016 0.005 0.016 0.008

0.152 0.020 0.069 0.071 0.159 0.153 0.012 0.526

0.707 0.487 0.316 0.527 0.423 0.114 0.548 0.051

FA- = no FA; FA+ = 3.0 mg/kg of FA; SS- = no SS; SS+ = 0.3 mg/kg of Se from SS. FA: FA effect; SS: SS effect; FA×SS: the interaction between FA and SS addition. A:P was the ratio of acetate to propionate. 4

Livestock Science 231 (2020) 103884

G.W. Zhang, et al.

Table 5 Effects of folic acid (FA) and sodium selenite (SS) addition on microbial enzyme activity and microflora in dairy calves. Item

FA-1 SS-

SS+

FA+ SS-

SS+

SEM

P-values2 FA

SS

FA×SS

0.30 0.20 0.93 0.51 1.70 0.57

0.34 0.19 1.23 0.55 2.83 0.77

0.38 0.24 1.26 0.61 2.32 1.05

0.37 0.22 1.41 0.67 3.23 1.12

0.006 0.003 0.021 0.010 0.046 0.019

0.001 0.059 0.008 0.005 0.007 0.006

0.230 0.179 0.027 0.042 0.003 0.013

0.062 0.211 0.116 0.637 0.263 0.062

2.84 2.49 3.20 10.14 1.42 0.19 2.75 1.97 44.84 8.56

3.27 3.06 4.44 11.41 2.03 0.30 3.26 2.92 46.86 7.71

4.46 3.28 4.32 12.06 2.52 0.35 3.67 3.08 48.73 8.42

4.69 3.12 4.85 12.91 2.82 0.31 3.69 3.19 49.19 7.16

0.065 0.085 0.110 0.449 0.048 0.009 0.062 0.056 1.119 0.136

0.004 0.003 0.001 0.011 0.001 0.030 0.001 0.001 0.001 0.237

0.033 0.001 0.001 0.006 0.048 0.038 0.045 0.002 0.173 0.005

0.161 0.008 0.524 0.083 0.001 0.026 0.012 0.010 0.594 0.473

3

Microbial enzyme activity Carboxymethyl-cellulase Cellobiase Xylanase Pectinase α-amylase Protease Ruminal microflora (copies/mL) Total bacteria, ×1011 Total anaerobic fungi, ×107 Total protozoa, ×105 Total methanogens, ×109 R. albus, ×108 R. flavefaciens, ×109 F. succinogenes, ×109 B. fibrisolvens, ×109 P. ruminicola, ×109 Rb. amylophilus, ×108 1

FA- = no FA; FA+ = 3.0 mg/kg of FA; SS- = no SS; SS+ = 0.3 mg/kg of Se from SS. FA: FA effect; SS: SS effect; FA×SS: the interaction between FA and SS addition. Units of enzyme activity are: carboxymethyl-cellulase (μmol glucose/min/mL), cellobiase (μmol glucose/min/mL), xylanase (μmol xylose/min/mL), pectinase (μmol D-galactouronic acid /min/mL), α-amylase (μmol glucose/min/mL) and protease (μg hydrolysed protein/min/mL). 2 3

evidenced by the observed increase in activities of CMC, xylanase and pectinase as well as populations of total fungi, protozoa and the primary cellulolytic bacteria (R. albus, R. flavefaciens, F. succinogenes and B. fibrisolvens). Ruminal cellulolytic bacteria, fungi and protozoa produce cellulolytic enzyme, and then degrade structural carbohydrate to acetate (Dijkstra and Tamminga, 1995). Dietary supplemented FA might promote DNA, RNA and protein synthesis of microbes by participating in one carbon unit metabolism (Bailey and Gregory, 1999), and resulting in the observed increase in microbial population and enzyme activity. Additionally, the higher molar proportions of valerate, isobutyrate and isovalerate, which resulted from the increased protease activity and protozoa, B. fibrisolvens and P. ruminicola population, also contributed to an increase in cellulolytic bacteria population and enzyme activity. Ruminal valerate, isobutyrate and isovalerate are the degradation products of feed protein, and can be used by microbes to synthesize their cell components, such as branched chain amino acids, branched chain fatty acids or aldehyde (Andries et al., 1987). Dietary isobutyrate and isovalerate addition stimulated ruminal cellulolytic bacteria growth and enzyme activity in dairy cows (Wang et al., 2019a). Similarly, other studies found that tetrahydrofolate, the active form of FA, was essential for R. flavefaciens growth in vitro (Slyter and Weaver, 1977), and ruminal cellulolytic bacteria abundance and enzyme activity increased due to FA addition in calves (Wang et al., 2019b). Feed protein degradation and the predation of protozoa to bacteria contribute to an accumulation of ruminal ammonia-N (Williams, 1986; Reynolds and Kristensen, 2008). Ruminal microbes utilize ammonia-N, carbon-skeleton and energy to synthesize protein (Reynolds and Kristensen, 2008). The amount of microbial protein synthesis is usually reflected via urinary total PD excretion (Verbic et al., 1990). Therefore, the lower ammonia N concentration

demonstrated that DMI was positively related to NDF digestibility in dairy cows (Allen, 2000). Moreover, digestibility of feeds is critical for calves because their rumen is just developing and they are not able to use fibers as effectively as older animals. In the present study, the positive response of ADG to FA addition resulted from the increased DMI, nutrient digestion and ruminal total VFA concentration. Considering the crucial role of FA in protein synthesis metabolism (Bailey and Gregory, 1999), the observed higher ADG was also associated with a positive impact of FA addition on protein synthesis metabolism in calves. La et al. (2019) observed that hepatic expression of genes related to protein synthesis were up-regulated with rumen-protected FA (RPFA; a partly rumen by pass product) addition in calves. Other studies found an increased ADG with parenteral FA addition or dietary FA addition in calves (Dumoulin et al., 1991; Wang et al., 2019b). The greater total tract digestibility of DM and OM were in agreement with the higher ruminal total VFA concentration, and were attributed to the increase in microbial population and enzyme activity with FA addition. The results indicated that nutrient degradation in the rumen was prompted by FA addition. Additionally, some studies indicated that FA is essential for the exocrine function and growth of pancreatic cell (Longnecker, 2002), and the secretion of pancreatic amylase reduced when dietary FA was deficient in rat (Balaghi and Wagner, 1995). Therefore, the positive response of total tract nutrient digestibility was also possibly associated with an improved feed digestion in the small intestine with FA addition. Similarly, other studies observed an increased nutrient digestibility with FA or RPFA addition in dairy calves (Wang et al., 2019a; La et al., 2019). The higher NDF and ADF digestibility were in accordance with the increase in acetate molar proportion, and indicated that the supplemented FA was required by ruminal microbes responsible for feed fiber degradation, as

Table 6 Effects of folic acid (FA) and sodium selenite (SS) addition on urinary excretion of purine derivatives (PD) in dairy calves. Item

Allantoin (mmol/day) Uric acid (mmol/day) Total PD (mmol/day) 1 2

FA-1 SS-

SS+

FA+ SS-

SS+

SEM

P-values2 FA

SS

FA×SS

145.7 5.55 151.3

162.1 5.46 167.6

186.1 5.47 191.6

188.5 5.57 194.1

2.14 0.041 2.16

0.001 0.289 0.002

0.030 0.264 0.035

0.039 0.924 0.045

FA- = no FA; FA+ = 3.0 mg/kg of FA; SS- = no SS; SS+ = 0.3 mg/kg of Se from SS. FA: FA effect; SS: SS effect; FA×SS: the interaction between FA and SS supplementation. 5

Livestock Science 231 (2020) 103884

G.W. Zhang, et al.

reductase (MTHFR) reduces 5,10-methylenetetrahydrofolate to 5-methyltetrahydrofolate, and then provides methyl group for homocysteine to generate methionine, but MTHFR can be inhibited by the increased ratio of SAM to SAH (Bailey and Gregory, 1999). Therefore, the hypothesized higher efficiency in stimulating ruminal microbial growth was not observed for the combined addition of FA and SS compared with FA or SS supplement alone in calves.

was not consistent with the higher protease activity as well as populations of protozoa, B. fibrisolvens and P. ruminicola with FA addition. Considering the increased ruminal total VFA concentration and total bacteria population, the decreased ammonia-N was due to an increase in microbial protein synthesis, as showed by the higher total PD excretion with FA addition. Nutrient intake and ADG were unchanged, but the lower FCR was observed due to the increase in nutrient digestibility and ruminal total VFA concentration with SS addition. Similarly, Salles et al. (2014) observed that DMI and weight gain were unchanged, but FCR tended to be more efficient in a 75 days feeding trial of calves with 0.8 mg of Se from Se yeast addition per day. In the current study, the greater total tract digestibility of DM, OM, CP, NDF and ADF were consistent with the higher ruminal total VFA concentration, and indicated that nutrient digestion in the rumen was promoted with SS addition. Additionally, Se addition improved the antioxidant status of intestine and pancreas, and thereby increased the activity of digestive enzyme in the small intestine (McDonald et al., 2011; Cobanova et al., 2017). Some studies indicated that ruminal degradability of DM, CP and NDF increased with dietary addition of 0.3 mg Se/kg DM from nano-Se in sheep (Shi et al., 2011), and postruminal digestion of OM, CP and NDF increased with 0.9 mg/ kg of Se as SS addition in diet containing 50% grain in lambs (RazoRodriguez et al., 2013). The lower ruminal pH with SS addition was observed due to the higher total VFA concentration (Dijkstra et al., 2012), but it was optimum for the growth of fibrolytic bacteria and the degradation of dietary fiber (Russell and Wilson, 1996). The higher propionate molar proportion and lower acetate to propionate ratio were associated with the increase in α-amylase activity and total protozoa and B. fibrisolvens population, indicating that the ruminal fermentation pattern was changed to more propionate production with SS addition. The higher xylanase and pectinase activity were consistent with the increase in populations of total bacteria, fungi, protozoa and R. albus. The observed positive impact of dietary supplemented SS on ruminal microbial growth and enzyme activity were associated with the antioxidant function of Se. Ruminal microorganisms incorporate dietary Se to form their protein or cell wall components (Hidiroglou et al., 1968), and Se content and glutathione peroxidase activity of bacteria and protozoa increased with 0.4 mg Se/kg DM as SS addition in sheep (Cobanova et al., 2017). Glutathione peroxidase converts hydrogen peroxide into water (NRC, 2001), hence the ability of microorganisms against oxidative damage was enhanced due to Se addition. Similarly, other studies found that dietary Se addition increased ruminal total microbial count (Hidiroglou et al., 1968) and promoted protozoa growth (Mihalikova et al., 2005). The higher protease activity was associated with the increase in populations of total protozoa and B. fibrisolvens. The increase in urinary total PD excretion indicated that more ammonia N was used to synthesize microbial protein, and explained the contradiction between the higher protease activity and unchanged ammonia N with SS addition. Similarly, Shi et al. (2011) observed an increased urinary total PD excretion with Se addition in sheep. Although SS addition improved nutrient digestibility and increased total VFA concentration, DMI and ADG did not improve unlike in FA in the current study. This might be due to the lower increased range of nutrient digestibility and total VFA concentration with SS addition compared to FA addition which was not enough to cause significant changes in DMI and ADG, and this remains to be verified. The higher increased magnitude for total tract digestibility of CP and ADF, populations of total fungi and primary cellulolytic bacteria (R. albus, R. flavefaciens, F. succinogenes and B. fibrisolvens) as well as total urinary PD excretion with SS addition in diet without FA than with FA supplemented diet might be associated with the similar way of FA and SS participating in one carbon unit metabolism. Folic acid is essential for the formation of methylating agent, SAM (Bailey and Gregory, 1999). Speckmann et al. (2017) indicated that dietary Se addition increased the ratio of SAM to S-adenosylhomocysteine (SAH) in mice. In the one carbon unit cycle, methylene tetrahydrofolate

5. Conclusion Dietary FA addition improved nutrient intake, growth performance and feed efficiency in calves. Dietary SS addition did not promote the growth but did improve feed utilization of calves. Folic acid or SS supplements had a stimulating impact on nutrient digestion, ruminal total VFA production, microbial growth, enzyme activity and microbial protein synthesis. The numerically highest values of ADG, nutrient digestibility, ruminal pH, total VFA, activity of ruminal xylanase, pectinase, α-amylase and protease, population of total bacteria, total protozoa, total methanogens, R. albus, B. fibrisolvens and P. ruminicola, as well as urinary excretion of allantoin and total PD are observed for calves receiving both supplements. Declaration of Competing Interest None. Acknowledgements This work was supported by a grant from Key Research and Development project of Shanxi Province (201803D221025-2) and Animal Husbandry “1331 project” Key Discipline Construction program of Shanxi Province. The authors thank the staff of Shanxi Agriculture University dairy cow unit for care of the animals. References Agarwal, N., Kamra, D.N., Chaudhary, L.C., Agarwal, I., Sahoo, A., Pathak, N.N., 2002. Microbial status and rumen enzyme profile of crossbred calves fed on different microbial feed additives. Lett. Appl. Microbiol. 34, 329–336. Allen, M.S., 2000. Effects of diet on short-term regulation of feed intake by lactating dairy cattle. J. Dairy Sci. 83, 1598–1624. Alaburda, J., De Almeida, A.P., Shundo, L., Ruvieri, V., Sabino, M., 2008. Determination of folic acid in fortified wheat flours. J. Food Compos. Anal. 21, 336–342. Andries, J.I., Buysse, F.X., Debrabander, D.L., Cottyn, B.G., 1987. Isoacids in ruminant nutrition: their role in ruminal and intermediary metabolism and possible influences on performances: a review. Anim. Feed Sci. Technol. 18, 169–180. AOAC, 2000. Official Methods of Analysis, 17th ed. Association of Official Analytical Chemists, Int., Arlington, VA, USA. Bailey, L.B., Gregory, J.F., 1999. Folate metabolism and requirements. J. Nutr. 129, 779–782. Balaghi, M., Wagner, C., 1995. Folate deficiency inhibits pancreatic amylase secretion in rats. Am. J. Clin. Nutr. 61, 90–96. Cobanova, K., Faix, S., Placha, I., Mihalikova, K., Varadyova, Z., Kisidayova, S., Gresakova, L., 2017. Effects of different dietary selenium sources on antioxidant status and blood phagocytic activity in sheep. Biol. Trace Elem. Res. 175, 339–346. Davis, C.D., Uthus, E.O., 2003. Dietary folate and selenium affect dimethylhydrazineinduced aberrant crypt formation, global DNA methylation and one-carbon metabolism in rats. J . Nutr. 133, 2907–2914. Dumoulin, P.G., Girard, C.L., Matte, J.J., StLaurent, G.J., 1991. Effects of a parenteral supplement of folic acid and its interaction with level of feed intake on hepatic tissues and growth performance of young dairy heifers. J. Anim. Sci. 69, 1657–1666. Dijkstra, J., Tamminga, S., 1995. Simulation of the effects of diet on the contribution of rumen protozoa to degradation of fibre in the rumen. Brit. J. Nutr. 74, 617–634. Dijkstra, J., Ellis, J.L., Kebreab, E., Strathe, A.B., Lopez, S., Bannink, A., 2012. Ruminal pH regulation and nutritional consequences of low pH. Anim. Feed Sci. Technol. 172, 22–33. Hidiroglou, M., Heaney, D.P., Jenkins, K.J., 1968. Metabolism of inorganic selenium in rumen bacteria. Can. J. Physiol. Pharm. 46, 229–232. Kongmun, P., Wanapat, M., Pakdee, P., Navanukraw, C., 2010. Effect of coconut oil and garlic powder on in vitro fermentation using gas production technique. Livest. Sci. 127, 38–44. La, S., Li, H., Wang, C., Liu, Q., Guo, G., Huo, W.J., Zhang, Y.L., Pei, C.X., Zhang, S.L., 2019. Effects of rumen-protected folic acid and dietary protein level on growth performance, ruminal fermentation, nutrient digestibility and hepatic gene expression of dairy calves. J. Anim. Physiol. Anim. Nutr. 103, 1006–1014.

6

Livestock Science 231 (2020) 103884

G.W. Zhang, et al.

certain strains of ruminococcus flavefaciens. Appl. Environ. Microb. 33, 363–369. Speckmann, B., Schulz, S., Hiller, F., Hesse, D., Schumacher, F., Kleuser, B., Geiselg, J., Obeidg, R., Grune, T., Kipp, A.P., 2017. Selenium increases hepatic dna methylation and modulates one-carbon metabolism in the liver of mice. J. Nutr. Biochem. 48, 112–119. Van Soest, P.J., Robertson, J.B., Lewis, B.A., 1991. Methods for dietary fiber, neutral detergent fiber and non-starch polysaccharides in relation to animal nutrition. J. Dairy Sci. 74, 3583–3597. Verbic, J., Chen, X.B., MacLeod, N.A., Ørkov, E.R., 1990. Excretion of purine derivatives by ruminants. Effect of microbial nucleic acid infusion on purine derivative excretion by steers. J. Agr. Sci. 114, 243–248. Wang, C., Liu, Q., Yang, W.Z., Dong, Q., Yang, X.M., He, D.C., Zhang, P., Dong, K.H., Huang, Y.X., 2009. Effects of selenium yeast on rumen fermentation, lactation performance and feed digestibilities in lactating dairy cows. Livest. Sci. 126, 239–244. Wang, C., Liu, Q., Guo, G., Huo, W.J., Zhang, Y.L., Pei, C.X., Zhang, S.L., 2019a. Effects of rumen-protected folic acid and branched-chain volatile fatty acids supplementation on lactation performance, ruminal fermentation, nutrient digestion and blood metabolites in dairy cows. Anim. Feed Sci. Technol. 247, 157–165. Wang, C., Wu, X.X., Liu, Q., Guo, G., Huo, W.J., Zhang, Y.L., Pei, C.X., Zhang, S.L., Wang, H., 2019b. Effects of folic acid on growth performance, ruminal fermentation, nutrient digestibility and urinary excretion of purine derivatives in post-weaned dairy calves. Arch. Anim. Nutr. 73, 18–29. Williams, A.G., 1986. Rumen holotrich ciliate protozoa. Microbiol. Res. 50, 25–49. Yu, Z.T., Morrison, M., 2004. Improved extraction of PCR-quality community DNA from digesta and fecal sample. Bio. Tech. 36, 808–812.

Longnecker, D.S., 2002. Abnormal methyl metabolism in pancreatic toxicity and diabetes. J. Nutr. 132, 2373S–2376S. McDonald, P., Edwards, R.A., Greenhalgh, J.F.D., Morgan, C.A., Sinclair, L.A., Wilkinson, R.G., 2011. Animal Nutrition, 7th ed. Pearson Education, London, UK. Mihalikova, K., Gresakova, L., Boldižarova, K., Faix, S., Leng, L., Kisidayova, S., 2005. The effects of organic selenium supplementation on the rumen ciliate population in sheep. Folia Microbiol. 50, 353–356. NRC, 2001. Nutrient requirements of dairy cattle. 7th rev. ed.National Academy of Science, Washington, DC. Reynolds, C.K., Kristensen, N.B., 2008. Nitrogen recycling through the gut and the nitrogen economy of ruminants: an asynchronous symbiosis. J. Anim. Sci. 86, E293–E305. Razo-Rodriguez, O.E.D., Ramirez-Bribiesca, J.E., Lopez-Arellano, R., Revilla-Vazquez, A.L., Gonzalez-Munoz, S.S., Cobos-Peralta, M.A., Hernandez-Calva, L.M., Mcdowell, L.R., 2013. Effects of dietary level of selenium and grain on digestive metabolism in lambs. Czech J. Anim. Sci. 58, 253–261. Russell, J.B., Wilson, D.B., 1996. Why are ruminal cellulolytic bacteria unable to digest cellulose at low pH? J. Dairy Sci. 79, 1503–1509. Salles, M.S.V., Zanetti, M.A., Junior, L.C.R., Salles, F.A., Azzolini, A.E.C.S., Soares, E.M., Faccioli, L.H., Valim, Y.M.L., 2014. Performance and immune response of suckling calves fed organic selenium. Anim. Feed Sci. Technol. 188, 28–35. SAS, 2000. User's Guide: Statistics, Version 8.1 Edition. SAS Inst., Inc., Cary, NC. Shi, L., Xun, W.J., Yue, W.B., Zhang, C.X., Ren, Y.S., Liu, Q., Wang, Q., Shi, L., 2011. Effect of elemental nano-selenium on feed digestibility, rumen fermentation, and purine derivatives in sheep. Anim. Feed Sci. Technol. 163, 136–142. Slyter, L.L., Weaver, J.M.., 1977. Tetrahydrofolate and other growth requirements of

7