Effects of in utero exposure to nanoparticle-rich diesel exhaust on testicular function in immature male rats

Toxicology Letters 185 (2009) 1–8

Contents lists available at ScienceDirect

Toxicology Letters journal homepage: www.elsevier.com/locate/toxlet

Effects of in utero exposure to nanoparticle-rich diesel exhaust on testicular function in immature male rats ChunMei Li a,b,∗ , Shinji Taneda a , Kazuyoshi Taya c,d , Gen Watanabe c,d , Xuezheng Li c , Yuji Fujitani a , Tamie Nakajima e , Akira K. Suzuki a a Environmental Nanotoxicology Section, Research Center for Environmental Risk, National Institute for Environmental Studies, 16-2 Onogawa, Tsukuba, Ibaraki 305-8506, Japan b College of Animal Science and Technology, Nanjing Agricultural University, Nanjing, China c Laboratory of Veterinary Physiology, Department of Veterinary Medicine, Faculty of Agriculture, Tokyo University of Agriculture and Technology, Tokyo, Japan d Department of Basic Veterinary Science, The United Graduate School of Veterinary Sciences, Gifu University, Gifu, Japan e Department of Occupational and Environmental Health, Nagoya University Graduate School of Medicine, Nagoya, Japan

a r t i c l e

i n f o

Article history: Received 3 October 2008 Received in revised form 17 November 2008 Accepted 17 November 2008 Available online 28 November 2008 Keywords: In utero exposure Male offspring Nanoparticle-rich diesel exhaust Testosterone Testicular function StAR

a b s t r a c t We investigated the effects of in utero exposure to nanoparticle-rich diesel exhaust (NR-DE) on reproductive function in male rats. Pregnant F344 rats were exposed to NR-DE (148.86 ␮g/m3 , 1.83 × 106 particles/cm3 , 3.40 ppm CO, 1.46 ppm NOx), filtered diesel exhaust (F-DE; 3.10 ␮g/m3 , 2.66 particles/cm3 , 3.30 ppm CO, 1.41 ppm NOx), or clean air (as a control) from gestation days 1 to 19 (gestation day 0 = day of sperm-positivity). Male offspring were examined on postnatal day 28. The relative weights of the seminal vesicle and prostate to body weight were decreased after exposure to NR-DE or F-DE compared with controls. Serum concentrations of testosterone, progesterone, corticosterone, and follicle stimulating hormone and testicular concentrations of steroidogenic acute regulatory protein and 17␤-hydroxysteroid dehydrogenase mRNA were decreased after exposure to NR-DE or F-DE compared with control levels. In contrast, serum concentrations of immunoreative inhibin were increased after exposure to NR-DE or F-DE compared with control levels, whereas transcription of follicle stimulating hormone receptor mRNA was increased in the NR-DE exposure group only. These results suggest that prenatal exposure to NR-DE or F-DE leads to endocrine disruption after birth and suppresses testicular function in male rats. Because both the NR-DE and F-DE-exposed groups reacted to the same extent, the nanoparticles in DE did not contribute to the observed reproductive toxicity. © 2008 Elsevier Ireland Ltd. All rights reserved.

1. Introduction Air pollution is a serious environmental issue, and diesel exhaust particles (DEP) are a leading contributor to this problem. DEP contain many compounds that have hazardous effects on human health, such as lung cancer (Ichinose et al., 1997), allergic rhinitis (Takafuji et al., 1987), and bronchial asthma-like disease (Miyabara et al., 1998). Furthermore, DEP disrupt endocrine systems, with potentially adverse effects on male and female reproductive functions (Izawa et al., 2007a,b; Tsukue et al., 2002; Yoshida et al., 1999). Furthermore, our previous in vivo study showed that 3-methyl-4nitrophenol, a nitrophenol derivative isolated from DEP, produces

∗ Corresponding author at: Environmental Nanotoxicology Section, Research Center for Environmental Risk, National Institute for Environmental Studies, 16-2 Onogawa, Tsukuba, Ibaraki 305-8506, Japan. Tel.: +81 298 50 2461; fax: +81 298 50 2461. E-mail addresses: [email protected], [email protected] (C. Li). 0378-4274/$ – see front matter © 2008 Elsevier Ireland Ltd. All rights reserved. doi:10.1016/j.toxlet.2008.11.012

testicular toxicity in both adult Japanese quail (Li et al., 2006a) and immature rats (Li et al., 2006c). Many recent studies have focused on the toxic effects of environmental nanomaterials on living organisms (Peters et al., 1997; Utell and Frampton, 2000). Diesel-powered vehicles are among the major sources of nanoparticles (<0.1 ␮m) in the urban atmosphere, and several studies have measured the nanoparticles generated by diesel engines (Donaldson et al., 2005; Vaaraslahti et al., 2005). Nanoparticles typically are hydrocarbons or sulfates and are formed by nucleation during dilution and cooling of diesel exhaust, whereas accumulation-mode particles (50 nm < particle diameter < 1000 nm) mainly are carbonaceous soot agglomerates formed directly by combustion (Fujitani et al., 2008). In addition, nanoparticles have a larger surface area per unit mass than larger particles, which leads to a higher deposition rate in the peripheral lung (Oberdörster et al., 2002). They can cross the pulmonary epithelium and reach the interstitium, are implicated in cardiopulmonary system effects (Utell and Frampton, 2000). Furthermore, nanoparticles can enter the blood stream, and be

2

C. Li et al. / Toxicology Letters 185 (2009) 1–8

transported to other organs such as liver, kidney, spleen, brain, and heart (Oberdörster et al., 2002; Takenaka et al., 2001). Nanoparticles have an enhanced capacity to produce reactive oxygen species, and consequently have widespread toxicity (Li et al., 2003). Most current research is focused on the effects of exogenous endocrine disrupters on the development of offspring in utero or during the neonatal period (Sawaki et al., 2003). No previous study has addressed the effects of in utero exposure to nanoparticles on reproductive function in male offspring. Here, we examined the effects of in utero exposure to nanoparticle-rich diesel exhaust (NRDE) on serum hormone concentrations and on factors associated with testicular steroid hormone biosynthesis in male rats at 4 weeks after birth (postnatal day [PND] 28). 2. Materials and methods 2.1. Animals Fifteen pregnant female Fischer rats (F344/DuCrlCrli; gestation day [GD] 0 = day of sperm-positivity) were obtained from Charles River Japan (Tokyo, Japan) on the first day of pregnancy and housed in individual wire-mesh cages in whole-body exposure chambers (2.25 m3 ; Sibata Science Technology, Tokyo, Japan). The pregnant rats were maintained in a flow of 1 m3 /min, at 23 ◦ C with 50% humidity, and on a 12:12 h light:dark cycle. They were fed a commercial diet (CE-2, Japan Clea, Tokyo, Japan) and given water ad libitum. This study was conducted in accordance with the Guiding Principles in the Use of Animals in Toxicology and was approved by the Animal Care and Use Committee of the Japanese National Institute for Environmental Studies. 2.2. Generation of nanoparticle-rich diesel exhaust (NR-DE) The method for generation of NR-DE has been described by Li et al. (in press). Briefly, NR-DE was generated by an 8-L diesel engine (J08C, Hino Motors, Hino, Japan). The engine was operated under a steady-state condition for 5 h/d by using low-sulfur diesel fuel (JIS No. 2 light oil). The engine speed was 2000 rpm, and engine torque was 0 N m—conditions that readily generate high concentrations of nanoparticles (Fujitani et al., 2008). The exhaust was diluted immediately with a large amount of clean air to prevent changes in particle size due to coagulation during transport from the engine to the exposure chamber. The flow rate of the primary dilution air was set to 100 m3 /min, giving a primary dilution ratio of 17.7, and the temperature of the primary dilution air was set at 25 ◦ C. The exposure air was supplied after passing through the dilution system (Fujitani et al., 2008). The three chambers housing rats included a control chamber receiving air filtered through HEPA and charcoal filters (referred to as “clean air”), one that received NR-DE (168.84 ␮g/m3 , 1.36 × 106 particles/cm3 ), and filtered diesel exhaust (F-DE; 3.10 ␮g/m3 , 2.66 particles/cm3 ). Gaseous concentrations were monitored with a gas analyzer (Horiba, Kyoto, Japan). The particle number size distributions and concentrations were measured with a scanning mobility particle sizer (SMPS 3034, TSI, Shoreview, MN, USA) and a condensation particle counter (CPC 3025A, TSI), respectively. Fig. 1 shows the number size (A), surface area (B), and volume (C) distributions of particles. The peak number size concentration occurred at a particle size of 20–30 nm (Fig. 1(A)), the peak surface area occurred at a particle size of 20–80 nm (Fig. 1(B)), and the peak volume occurred at a particle size of 100–300 nm (Fig. 1(C)). Particles were collected by a Teflon filter (FP-500, Sumitomo Electric, Osaka, Japan) and quartz fiber filter (2500 QAT-UP, Pall, Pine Bush, NY, USA), and particle mass concentrations were measured by using a Teflon filter. Particle weights were measured with an electrical microbalance (M5P-F, Sartorius, Tokyo, Japan) in an air-conditioned chamber (CHAM-1000, Horiba, Kyoto, Japan) kept at a constant temperature and relative humidity (25 ◦ C, 50%). Analysis of the particle composition showed that the percentage of organic carbon was higher (79–63%) than that of elemental carbon (21–37%). Table 1 shows the average concentrations of nanoparticles (22–27 nm; nanoparticles of these diameters are often observed at traffic intersections in urban regions in Japan; Hasegawa et al., 2004) and gaseous components during the exposure experiments. 2.3. Experimental design Pregnant rats were allocated into three groups (n = 5 per group). Group 1 was exposed to clean air (control), and groups 2 and 3 were exposed to NR-DE and F-DE, respectively. Rats were exposed for 5 h daily during GD 1–19. After exposure, the animals were moved to a conventional animal-housing room. Newborns were weaned on PND 21, sorted into same-sex groups, and housed in a controlled environment with a 12:12-h light:dark cycle, temperature of 23 ± 2 ◦ C, humidity of 50 ± 10%, and ventilation with fresh-air changes hourly. On PND 28, male rats (5–7 rats per group) were weighed and decapitated. Blood samples were collected and were centrifuged at 1700 × g for 15 min at 4 ◦ C. Serum was separated and stored at −20 ◦ C until assayed for luteinizing hormone (LH), follicle stimulating hormone (FSH), testosterone, pro-

Fig. 1. Number size (A), surface area (B), and volume (C) distributions normalized to total particle concentrations.

gesterone, corticosterone, and immunoreactive (ir)-inhibin. Testes were removed and weighed, and the left testis was fixed in 10% neutral phosphate-buffered formalin (Wako Pure Chemical Industries, Osaka, Japan), pH 7.4, for histologic examination. The right testis was kept in RNAlaterTM (Qiagen, Tokyo, Japan) for isolation of total RNA. Accessory reproductive glands (epididymis, ventral prostate, seminal vesicles plus coagulating glands, levator ani plus bulbocavernosus muscles, and glans penis) were excised, carefully trimmed of excess adhering tissue and fat, and immediately weighed. The liver, spleen, adrenal glands, kidneys, and thymus glands also were weighed. 2.4. Radioimmunoassay Serum concentrations of LH and FSH were measured by using NIDDK rat radioimmunoassay (RIA) kits (Torrance, CA, USA); the antisera used were anti-rat LH-S-11 and anti-rat FSH-S-11. The intra- and interassay coefficients of variation were 5.4% and 6.9% for LH and 4.3% and 10.3% for FSH, respectively. Serum concentrations of ir-inhibin were measured as described previously (Hamada et al., 1989). The iodinated preparation was 32-kDa bovine inhibin, and the antiserum used was rabbit antiserum against bovine inhibin (TNDH-1). Results are expressed in terms of 32-kDa bovine inhibin. The intra- and interassay coefficients of variation were 8.8% and 14.4%, respectively. Serum concentrations of progesterone, testosterone, and corticosterone were determined with a double-antibody RIA system with 125 I-labeled radioligands, as described previously (Kanesaka et al., 1992; Taya et al., 1985). The antiserum against progesterone (GDN 337; Gibori et al., 1977) and testosterone (GDN 250; Gay and Kerlan, 1978) were provided by Dr G. D. Niswender (Colorado State University, Fort Collins, CO, USA). The intra- and interassay coefficients of variation were 6.9% and 11.2% for progesterone, 6.3% and 7.2% for testosterone, and 9.5% and 16.4% for corticosterone, respectively.

C. Li et al. / Toxicology Letters 185 (2009) 1–8

3

Table 1 Exposure components. Exposure groups Clean air (control)

Particulate matter

Average of mode diameter (nm) Mass concentration (␮g/m3 ) Number concentration (cm−3 ) EC/TC (ratio) TC/PM (ratio)

Gaseous matter

CO (ppm) SO2 (ppm) NOx (ppm) NO2 (ppm) NO (ppm) CO2 (%)

Nanoparticle-rich diesel exhaust (NR-DE)

Filtered diesel exhaust (F-DE)

101.57 4.58 3.28 0.30 0.38

± ± ± ± ±

20.12 1.31 0.34 0.01 0.03

26.81 ± 0.46 148.86 ± 3.45 1.83 ×106 ± 2.05 × 104 0.37 ± 0.01 0.85 ± 0.01

92.62 3.10 2.66 0.21 0.47

± ± ± ± ±

19.32 0.77 0.36 0.02 0.02

0.27 0.000 0.01 0.00 0.00 0.06

± ± ± ± ± ±

0.01 0.000 0.00 0.00 0.00 0.00

3.40 ± 0.01 0.009 ± 0.000 1.46 ± 0.00 0.53 ± 0.00 0.93 ± 0.00 0.08 ± 0.00

3.30 0.008 1.41 0.51 0.91 0.08

± ± ± ± ± ±

0.01 0.000 0.00 0.00 0.00 0.00

EC, elemental carbon; TC, total carbon; PM, particle mass. Data are expressed as means ± S.E.M. Table 2 Primers used in real-time PCR. Gene

Forward primer (5 to 3 )

Reverse primer (5 to 3 )

GAPDH StAR P450scc 3␤-HSD P450c17 17␤-HSD AR LHR FSHR

GGCACAGTCAAGGCTGAGAATG CTGCAGCAAGCACTGTGTGG GGAGGAGATCGTGGACCCTGA AGCAAAAAGATGGCCGAGAA TGGCTTTCCTGGTGCACAATC AATGTGCTTTCCATTTGCAAGGT CTAGCGCGTGCCTTCCTTTACA CTGCGCTGTCCTGGCC TTTACTTGCCTGGAAGCGACTAA

ATGGTGGTGAAGACGCCAGTA GGGATAACAGCTCAGACGGTAGAGA TGGAGGCATGTTGAGCATGG GGCACAAGTATGCAATGTGCC TGAAAGTTGGTGTTCGGCTGAAG ATGCCACTGGCAGAGGAGATG CCCACCTGCGGGAAGCT CGACCTCATTAAGTCCCCTGAA CCCAGGCTCCTCCACACA

5 s and 60 ◦ C for 30 s. Melting curve determination was performed between 60 and 95 ◦ C to differentiate between the desired amplicons and any primer dimers or DNA contaminants. Glyceraldehyde-3-phosphate dehydrogenase (GAPDH) was used as a housekeeping gene for data analysis. The levels of mRNA transcribed from all genes of interest were normalized to that of GAPDH. 2.6. Histology Testes samples were dehydrated in an ethanol series and embedded in paraffin wax. Sections (5 ␮m) of testes were stained routinely with hematoxylin and eosin for histological examination. 2.7. Statistical analysis

GAPDH, glyceraldehyde-3-phosphate dehydrogenase; StAR, steroidogenic acute regulatory protein; P450scc, cytochrome P450 side-chain cleavage enzyme; 3␤-HSD, 3␤-hydroxysteroid dehydrogenase; P450c17, cytochrome P450 17␣hydroxylase/C17-20-lyase; 17␤-HSD, 17␤-hydroxysteroid dehydrogenase; AR, androgen receptor; LHR, luteinizing hormone receptor; FSHR, follicle-stimulating hormone receptor.

All data are presented as mean ± standard error of the mean (S.E.M.) and were analyzed by one-way analysis of variance (ANOVA) followed by Tukey’s multiple comparison test. Statistical analysis was performed by using the GraphPad Prism software (GraphPad Software, San Diego, CA, USA). Differences were considered statistically significant when the P level was less than 0.05.

2.5. RNA isolation and quantitative real-time PCR

3. Results

Total RNA was isolated from the testis of PND 28 male rats exposed in utero to NR-DE or F-DE during GD 1–19 by using an RNeasy Mini kit (Qiagen, Tokyo, Japan). The isolated RNA was reverse-transcribed into cDNA by using a PrimeScript firststrand cDNA Synthesis Kit (Takara Bio, Shiga, Japan) according to the manufacturer’s instructions. Briefly, 1 ␮g total RNA was combined with 50 ␮M oligo-dT primer and 10 ␮M dNTPs in DNase- and RNase-free water to a final volume of 10 ␮l. RNA and primer were denatured at 65 ◦ C and then cooled immediately on ice. Reverse transcription was performed by using 10 ␮l of a master mix containing the following: 5× PrimeScript buffer (Takara Bio), RNase inhibitor (40 U/␮l), PrimeScript reverse transcriptase (200 U/␮l; Takara Bio), and DNase and RNase-free water. Reactions were incubated at 42 ◦ C for 60 min and were terminated by incubation at 75 ◦ C for 15 min. The primers (Table 2) were designed by using Primer Express 1.0 software (Applied Biosystems, Singapore). Quantitative real-time PCR was performed by using a Thermal Cycler Dice Real-Time System TP800 (Takara Bio) according to the manufacturer’s instructions. The reaction mixture contained cDNA, 10 ␮M of each forward and reverse primer, and 2× SYBR Premix Ex Taq (Takara Bio) in a final volume of 25 ␮l. The thermal cycling program was 95 ◦ C for 10 s, followed by 40 cycles at 95 ◦ C for

3.1. Body and organ weights No deaths or macroscopical changes related to the NR-DE or F-DE inhalation occurred, and the sex ratio of live newborns at birth did not differ between the exposed and control groups (data not shown). To determine the overall toxicity of NR-DE and FDE, we measured body and organ weights of PND 28 male rats (Tables 3 and 4). Neither body weight nor relative weights of livers, adrenals, or thymus glands differed among the groups (Table 3). However, relative spleen weight increased significantly (P < 0.05) in the F-DE exposure group compared with the control group (Table 3), and relative kidney weight was decreased in rats exposed to NR-DE compared with the control group (P < 0.01) and F-DE-exposed group (P < 0.05; Table 3). Relative

Table 3 Body weights and relative organ weights of PND 28 male rats exposed in utero to clean air, NR-DE, or F-DE during GD 1–19. Exposure groups

Number of animals Body weight (g) Liver/body weight (mg/g) Spleen/body weight (mg/g) Kidneys/body weight (mg/g) Adrenals/body weight (mg/g) Thymus glands/body weight (mg/g)

Clean air

NR-DE

F-DE

5 67.2 ± 0.7 46.18 ± 0.64 3.18 ± 0.07 11.37 ± 0.13 0.38 ± 0.01 3.00 ± 0.37

7 66.7 ± 1.6 45.82 ± 0.47 4.02 ± 0.08 10.78 ± 0.11** , # 0.37 ± 0.01 3.07 ± 0.06

6 64.8 ± 2.5 44.95 ± 0.60 4.05 ± 0.05* 11.21 ± 0.12 0.39 ± 0.03 3.08 ± 0.14

Values are expressed as mean ± S.E.M. (n = 5–7 per group). * P < 0.05 compared with the value for the control group (ANOVA and Tukey’s multiple comparison test). ** P < 0.01 compared with the value for the control group (ANOVA and Tukey’s multiple comparison test). # P < 0.05 compared with the value for the F-DE group (ANOVA and Tukey’s multiple comparison test).

4

C. Li et al. / Toxicology Letters 185 (2009) 1–8

Table 4 Relative weights of testes and accessory sex organs of PND 28 male rats exposed in utero to clean air, NR-DE, or F-DE during GD 1–19. Exposure groups Clean air Testes/body weight (mg/g) Epididymis/body weight (mg/g) Ventral prostate/body weight (mg/g) Seminal vesicles plus coagulating glands/body weight (mg/g) Levator ani plus bulbocavernosus muscles/body weight (mg/g) Glans penis/body weight (mg/g)

6.34 0.72 0.37 0.26 0.76 0.33

± ± ± ± ± ±

0.47 0.04 0.01 0.01 0.02 0.03

NR-DE

F-DE

6.65 ± 0.08 0.73 ± 0.02 0.32 ± 0.02* 0.22 ± 0.01* 0.70 ± 0.03 0.22 ± 0.03

6.49 0.72 0.29 0.21 0.67 0.26

± ± ± ± ± ±

0.12 0.02 0.02* 0.03* 0.02 0.01

Values are expressed as mean ± S.E.M. (n = 5–7 per group). * P < 0.05 compared with the value for the control group (ANOVA and Tukey’s multiple comparison test).

weights of the testes, epididymis, levator ani plus bulbocavernosus muscles, and glans penis (Table 4) were unaffected by exposure to NR-DE or F-DE. However, the relative weights of the ventral prostate and seminal vesicles plus coagulating glands were significantly reduced (P < 0.05) in the NR-DE and F-DE exposure groups compared with the control group (Table 4). 3.2. Serum hormone concentrations We investigated the serum concentrations of LH, FSH, testosterone, ir-inhibin, progesterone, and corticosterone in PND 28 male

rats exposed in utero to NR-DE, F-DE, or clean air (control) during GD 1–19 (Fig. 2). Serum concentrations of LH in the NR-DE and F-DE exposure groups did not differ from those in the controls (Fig. 2(A)). In contrast, serum concentrations of FSH (Fig. 2(B)), testosterone (Fig. 2(D)), and progesterone (Fig. 2(E)) were decreased significantly (P < 0.05) in the groups exposed to NR-DE or F-DE compared with the control group. Serum concentrations of ir-inhibin were significantly increased (P < 0.05) in groups exposed to NR-DE or F-DE compared with the control group (Fig. 2(C)). Serum concentrations of corticosterone were significantly decreased (P < 0.05) in the NRDE exposure group compared with the control group (Fig. 2(F)) and

Fig. 2. Serum concentrations of LH (A), FSH (B), ir-inhibin (C), testosterone (D), progesterone (E), and corticosterone (F) of PND 28 male rats exposed in utero to clean air (control), NR-DE, or F-DE during GD 1–19. Each bar represents the mean ± S.E.M. of 5–7 rats per group. * P < 0.05, ** P < 0.01, and *** P < 0.001 compared with the value for the control group (ANOVA and Tukey’s multiple comparison test).

C. Li et al. / Toxicology Letters 185 (2009) 1–8

tended to decrease in F-DE-exposed group, but the difference was not statistically significant. 3.3. Real-time quantitative PCR analysis of factors related to the biosynthesis of steroid sex hormones Using real-time quantitative PCR, we investigated the levels of mRNA transcribed from several genes associated with the biosynthesis of steroid sex hormone (specifically androgen receptor [AR], luteinizing-hormone receptor [LHR], follicle-stimulating

5

hormone receptor [FSHR], steroidogenic acute regulatory [StAR] protein, cytochrome P450 side-chain cleavage enzyme [P450scc], 3␤-hydroxysteroid dehydrogenase [3␤-HSD], cytochrome P450 17␣-hydroxylase/C17-20-lyase [P450c17], and 17␤-hydroxysteroid dehydrogenase [17␤-HSD]) in the testis of PND 28 male rats exposed in utero to NR-DE, F-DE, or clean air (control) during GD 1–19 (Fig. 3). Compared with those of controls, the levels of StAR and 17␤HSD mRNA was decreased significantly by exposure to NR-DE or F-DE (Fig. 3(D) and (H); P < 0.01). FSHR mRNA was increased signif-

Fig. 3. mRNA levels of AR (A), LHR (B), FSHR (C), StAR (D), P450scc (E), 3␤-HSD (F), P450c17 (G), and 17␤-HSD (H) in the testes of PND 28 male rats exposed in utero to clean air (control), NR-DE, or F-DE during GD 1–19. Each bar represents the mean ± S.E.M. of 5–7 rats per group. ** P < 0.01 and *** P < 0.001 compared with the value for the control group; # P < 0.01 compared with the value for the F-DE group (ANOVA and Tukey’s multiple comparison test).

6

C. Li et al. / Toxicology Letters 185 (2009) 1–8

Fig. 4. Testicular histology of PND 28 male rats exposed in utero to clean air (A), NR-DE (B), or F-DE (C) during GD 1–19. Testes were sectioned at 5 ␮m and stained with hematoxylin and eosin. ST, seminiferous tubules; bar, 50 ␮m.

icantly in the NR-DE exposure group compared with that of the control and F-DE groups (Fig. 3(C); P < 0.01 and P < 0.05, respectively). However, mRNA levels of AR, LHR, P45scc, 3␤-HSD, and P450c17 were not altered by NR-DE or F-DE exposure (Fig. 3(A), (B), (E)–(G)). 3.4. Testicular histology We examined the testicular histology of PND 28 male rats exposed in utero to NR-DE, F-DE, or clean air (control) during GD 1–19 (Fig. 4). Control sections showed compartmentalization of germ cells in the seminiferous tubule (Fig. 4(A)). In contrast, the seminiferous tubules of the NR-DE- and F-DE-exposed groups showed loss of germ cells (Fig. 4(B) and (C)). 4. Discussion In the present study, immature male rats (PND 28) exposed in utero to NR-DE or F-DE during the fetal period (GD 1–19) had adverse changes in their reproductive system. Exposure to either NR-DE or F-DE reduced serum concentrations of LH, FSH, testosterone, progesterone, and corticosterone and increased serum concentrations of ir-inhibin in PND 28 male rats. Testosterone and inhibin are synthesized in the Leydig and Sertoli cells in male rats

(Bardin et al., 1988). LH and FSH are the primary stimulants of testosterone and inhibin production from Leydig and Sertoli cells, respectively (Ewing et al., 1983). Our current findings suggest that inhalation of NR-DE or F-DE affects testicular function by affecting the functions of Leydig and Sertoli cells and that secretion of FSH from the pituitary decreased in response to increased ir-inhibin by the normal negative feedback of the hypothalamus–pituitary axis. In addition, our histologic findings support dysfunction of Leydig and Sertoli cells. Exposure of adult mice to DE (5.6 mg/m3 ) induces Leydig cell degeneration (Yoshida et al., 1999). In rats, corticosterone and progesterone are the predominant adrenal steroid hormones, and their production is directly stimulated by adrenocorticotropic hormones secreted from corticotrophs in the anterior pituitary gland. Our results showed that exposure to NR-DE or FDE significantly decreases plasma concentrations of corticosterone and progesterone in immature male rats. Due to the functional relationship between the gonads and adrenals (Rivier et al., 1986), our findings suggest that NR-DE or F-DE affects the pituitary–adrenal axis. No deaths or macroscopical changes related to NR-DE or FDE inhalation occurred, and the sex ratios of live newborns at birth did not differ between the exposed and control groups (data not shown). Therefore DE exposure did not affect normal growth in male offspring. However, it reduced the weight of the accessory reproductive organs. These results suggest that the resultant decrease in testosterone adversely affects the development of reproductive organs in male offspring, causing morphological abnormalities of the testes. Furthermore, the increased spleen weights were noted in F-DE-exposure rats likely may lead to dysfunction of immune systems. We noted a marked decrease in testicular mRNA transcription of StAR after in utero exposure to NR-DE or F-DE. StAR is expressed in steroidogenic tissues (Stocco and Clark, 1996) and it is necessary for delivery of cholesterol to the inner mitochondrial membrane (West et al., 2001). Histologically, the testes of StAR knockout embryos contain lipid deposits, denoting impaired cholesterol delivery into the mitochondria and suggesting this protein has an essential role in regulating steroid biosynthesis (Caron et al., 1997). However, neither NR-DE nor F-DE altered testicular levels of P450scc mRNA; P450scc-induced conversion of cholesterol to pregnenolone is the limiting enzymatic step in steroidogenesis and occurs in testicular Leydig cells (Payne, 1990). Pregnenolone leaves the mitochondrion for the smooth endoplasmic reticulum, where it is converted to progesterone by 3␤-HSD; P450c17 then catalyzes pregnenolone to produce 17-hydroxyprogesterone and androstenedione, which 17␤-HSD converts to testosterone (Payne and Youngblood, 1995). Our results show that the testicular 17␤-HSD mRNA was significantly decreased in both NR-DEand F-DE-exposed groups. Taken together, these results clearly indicate that in utero exposure to NR-DE or F-DE inhibits StAR and 17␤-HSD to suppress the production of testosterone and progesterone in the testes of immature male rats. The herbicide Roundup significantly reduces steroidogenesis by disrupting StAR protein production (Walsh et al., 2000), indicating that StAR may be another important target for environmental pollutants that disrupt steroidogenesis and impair reproductive function. Moreover, in utero exposure to di (n-butyl) phthalate reduces the transcription of various genes, including StAR, leading to altered steroidogenesis and thus decreased production of testosterone in fetal rat testes (Lehmann et al., 2004). Whereas testicular mRNA levels of LHR and AR, which contribute to androgen signaling and male reproductive development and function, did not differ among the three exposure groups, testicular transcription of FSHR mRNA was increased and serum FSH concentrations were decreased in the NR-DE group compared with the control group. Our results are supported by a previous study in which FSH downregulated the transcription

C. Li et al. / Toxicology Letters 185 (2009) 1–8

of FSHR mRNA in immature rat testes in vivo (Maguire et al., 1997). The disrupted testicular function of rats exposed in utero may have been due to filtered exhaust itself, because NR-DE and F-DE had almost the same effect. The gaseous phase of the exhaust apparently contains agents that disrupt reproductive endocrine function. DE is known to contain thousands of chemical components, including nitrophenols, nitrogen oxide, dioxin-like compounds, and polycyclic aromatic hydrocarbons (Clunies-Ross et al., 1996). We previously showed that nitrophenol chemical components derived from DE have estrogenic and anti-androgenic activities (Furuta et al., 2004, 2005; Taneda et al., 2004; Li et al., 2006b,d) and that they can disrupt reproductive (Li et al., 2006a,c, 2007a) and adrenal (Li et al., 2007b; Furuta et al., 2008) functions. In addition, nitrogen oxide not only is inhaled but also is synthesized endogenously through a biochemical reaction-dependent process, especially in sites of inflammation caused by nitrogen dioxide (Postlethwait et al., 1990). Nitrogen oxide is involved in the regulation of endocrine processes including hypothalamic–pituitary–gonadal axis functions (Ceccatelli et al., 1993; Gaytan et al., 1997). Further, fetuses exposed to DE (1.71 mg/m3 ) and filtered diesel exhaust have increased quantities of polycyclic aromatic hydrocarbons adsorbed on DE particles (Tozuka et al., 2004). These findings indicate that chemical substances transferred from mother to fetus can act as toxicants in later life, even if DE is inhaled only during the fetal period. Therefore the disrupting effects of NR-DE on testicular function may be due to chemical components such as nitrophenols in DE. Further studies are necessary to address the factors responsible for NR-DEassociated toxicity. In conclusion, our findings provide evidence that in utero exposure to NR-DE or F-DE impairs testicular functions of immature male rats. Specifically, in utero exposure to NR-DE or F-DE suppresses testicular production of testosterone by inhibiting StAR and 17␤-HSD. Conflict of interest statement None. Acknowledgments We are grateful to the National Hormone and Pituitary Program (National Institute of Diabetes and Digestive and Kidney Diseases, National Institutes of Health, Torrance, CA) and Dr. A.F. Parlow for the rat LH and FSH RIA kits and to Dr. G.D. Niswender (Animal Reproduction and Biotechnology Laboratory, Colorado State University, Fort Collins, CO, USA) for providing antiserum to testosterone (GDN250) and progesterone (GDN337). This study was supported in part by Grants-in-Aid for Scientific Research (P07582 and B18310044) from the Japan Society for the Promotion of Science (JSPS). References Bardin, C.W., C.C., Mustow, N.A., Gunsalus, G.L., 1988. The Sertoli cell. In: Knobil, E., Neill, J.D. (Eds.), The Physiology of Reproduction. Raven Press, New York, pp. 933–974. Caron, K.M., Soo, S.C., Wetsel, W.C., Stocco, D.M., Clark, B.J., Parker, K.L., 1997. Targeted disruption of the mouse gene encoding steroidogenic acute regulatory protein provides insights into congenital lipoid adrenal hyperplasia. Proc. Natl. Acad. Sci. U.S.A. 94, 11540–11545. Ceccatelli, S., Hulting, A.L., Zhang, X., Gustafsson, L., Villar, M., Hokfelt, T., 1993. Nitric oxide synthase in the rat anterior pituitary gland and the role of nitric oxide in regulation of luteinizing hormone secretion. Proc. Natl. Acad. Sci. U.S.A. 90, 11292–11296. Clunies-Ross, C., Stanmore, B.R., Millar, G.J., 1996. Dioxins in diesel exhaust. Nature 381, 379. Donaldson, K., Tran, L., Jimenez, L.A., Duffin, R., Newby, D.E., Mills, N., MacNee, W., Stone, V., 2005. Combustion-derived nanoparticles: a review of

7

their toxicology following inhalation exposure. Part. Fibre. Toxicology 2, 10. Ewing, L.L., Wing, T.Y., Cochran, R.C., Kromann, N., Zirkin, B.R., 1983. Effect of luteinizing hormone on Leydig cell structure and testosterone secretion. Endocrinology 112, 1763–1769. Fujitani, Y., Hirano, S., Kobayashi, S., Tanabe, K., Suzuki, A.K., Furuyama, A., Kobayashi, T., 2008. Characterization of dilution conditions for diesel nanoparticle inhalation studies. Inhal. Toxicol., 7. Furuta, C., Li, C., Taneda, S., Suzuki, A.K., Kamata, K., Watanabe, G., Taya, K., 2005. Immunohistological study for estrogenic activities of nitrophenols in diesel exhaust particles. Endocrine 27, 33–36. Furuta, C., Noda, S., Li, C., Suzuki, A.K., Taneda, S., Watanabe, G., Taya, K., 2008. Nitrophenols isolated from diesel exhaust particles regulate steroidogenic gene expression and steroid synthesis in the human H295R adrenocortical cell line. Toxicol. Appl. Pharmacol. 229, 109–120. Furuta, C., Suzuki, A.K., Taneda, S., Kamata, K., Hayashi, H., Mori, Y., Li, C., Watanabe, G., Taya, K., 2004. Estrogenic activities of nitrophenols in diesel exhaust particles. Biol. Reprod. 70, 1527–1533. Gay, V.L., Kerlan, J.T., 1978. Serum LH and FSH following passive immunization against circulating testosterone in the intact male rat and in orchidectomized rats bearing subcutaneous silastic implants of testosterone. Arch. Androl. 1, 257–266. Gaytan, F., Bellido, C., Aguilar, R., Morales, C., van Rooijen, N., Aguilar, E., 1997. Role of the testis in the response of the pituitary-testicular axis to nitric oxide-related agents. Eur. J. Endocrinol. 137, 301–308. Gibori, G., Antczak, E., Rothchild, I., 1977. The role of estrogen in the regulation of luteal progesterone secretion in the rat after day 12 of pregnancy. Endocrinology 100, 1483–1495. Hamada, T., Watanabe, G., Kokuho, T., Taya, K., Sasamoto, S., Hasegawa, Y., Miyamoto, K., Igarashi, M., 1989. Radioimmunoassay of inhibin in various mammals. J. Endocrinol. 122, 697–704. Hasegawa, S., Hirabayashi, M., Kobayashi, S., Moriguchi, Y., Kondo, Y., Tanabe, K., Wakamatsu, S., 2004. Size distribution and characterization of ultrafine particles in roadside atmosphere. J. Environ. Sci. Health A: Tox. Hazard. Subst. Environ. Eng. 39, 2671–2690. Ichinose, T., Yajima, Y., Nagashima, M., Takenoshita, S., Nagamachi, Y., Sagai, M., 1997. Lung carcinogenesis and formation of 8-hydroxy-deoxyguanosine in mice by diesel exhaust particles. Carcinogenesis 18, 185–192. Izawa, H., Kohara, M., Watanabe, G., Taya, K., Sagai, M., 2007a. Diesel exhaust particle toxicity on spermatogenesis in the mouse is aryl hydrocarbon receptor dependent. J. Reprod. Dev. 53, 1069–1078. Izawa, H., Kohara, M., Watanabe, G., Taya, K., Sagai, M., 2007b. Effects of diesel exhaust particles on the male reproductive system in strains of mice with different aryl hydrocarbon receptor responsiveness. J. Reprod. Dev. 53, 1191–1197. Kanesaka, T., Taya, K., Sasamoto, S., 1992. Radioimmunoassay of corticosterone using 125 I-labeled radioligand. J. Reprod. Dev. 38, 85–89. Lehmann, K.P., Phillips, S., Sar, M., Foster, P.M., Gaido, K.W., 2004. Dose-dependent alterations in gene expression and testosterone synthesis in the fetal testes of male rats exposed to di (n-butyl) phthalate. Toxicol. Sci. 81, 60–68. Li, C., Takahashi, S., Taneda, S., Furuta, C., Watanabe, G., Suzuki, A.K., Taya, K., 2006a. Impairment of testicular function in adult male Japanese quail (Coturnix japonica) after a single administration of 3-methyl-4-nitrophenol in diesel exhaust particles. J. Endocrinol. 189, 555–564. Li, C., Taneda, S., Suzuki, A.K., Furuta, C., Watanabe, G., Taya, K., 2006b. Antiandrogenic activity of 3-methyl-4-nitrophenol in diesel exhaust particles. Eur. J. Pharmacol. 543, 194–199. Li, C., Taneda, S., Suzuki, A.K., Furuta, C., Watanabe, G., Taya, K., 2006c. Effects of 3methyl-4-nitrophenol in diesel exhaust particles on the regulation of testicular function in immature male rats. J. Androl. 28, 252–258. Li, C., Taneda, S., Suzuki, A.K., Furuta, C., Watanabe, G., Taya, K., 2006d. Estrogenic and anti-androgenic activities of 4-nitrophenol in diesel exhaust particles. Toxicol. Appl. Pharmacol. 217, 1–6. Li, C., Takahashi, S., Taneda, S., Furuta, C., Watanabe, G., Suzuki, A.K., Taya, K., 2007a. Effects of 3-methyl-4-nitrophenol in diesel exhaust particles on the regulation of reproductive function in immature female Japanese quail (Coturnix japonica). J. Reprod. Dev. 53, 673–678. Li, C., Taneda, S., Suzuki, A.K., Furuta, C., Watanabe, G., Taya, K., 2007b. Effects of 3-methyl-4-nitrophenol on the suppression of adrenocortical function in immature male rats. Biol. Pharm. Bull. 30, 2376–2380. Li, C., Taneda, S., Taya, K., Watanabe, G., Fujitani, Y., Ito, Y., Nakajima, T., Suzuki, A.K., in press. Effects of inhaled nanoparticle-rich diesel exhaust on regulation of testicular function in adult male rats. Inhal. Toxicol. Li, N., Sioutas, C., Cho, A., Schmitz, D., Misra, C., Sempf, J., Wang, M., Oberley, T., Froines, J., Nel, A., 2003. Ultrafine particulate pollutants induce oxidative stress and mitochondrial damage. Environ. Health Perspect. 111, 455–460. Maguire, S.M., Tribley, W.A., Griswold, M.D., 1997. Follicle-stimulating hormone (FSH) regulates the expression of FSH receptor messenger ribonucleic acid in cultured Sertoli cells and in hypophysectomized rat testis. Biol. Reprod. 56, 1106–1111. Miyabara, Y., Ichinose, T., Takano, H., Sagai, M., 1998. Diesel exhaust inhalation enhances airway hyperresponsiveness in mice. Int. Arch. Allergy Immunol. 116, 124–131. Oberdörster, G., Sharp, Z., Atudorei, V., Elder, A., Gelein, R., Lunts, A., Kreyling, W., Cox, C., 2002. Extrapulmonary translocation of ultrafine carbon particles following whole-body inhalation exposure of rats. J. Toxicol. Environ. Health A 65, 1531–1543.

8

C. Li et al. / Toxicology Letters 185 (2009) 1–8

Payne, A.H., 1990. Hormonal regulation of cytochrome P450 enzymes, cholesterol side-chain cleavage and 17 alpha-hydroxylase/C17-20 lyase in Leydig cells. Biol. Reprod. 42, 399–404. Payne, A.H., Youngblood, G.L., 1995. Regulation of expression of steroidogenic enzymes in Leydig cells. Biol. Reprod. 52, 217–225. Peters, A., Wichmann, H.E., Tuch, T., Heinrich, J., Heyder, J., 1997. Respiratory effects are associated with the number of ultrafine particles. Am. J. Respir. Crit. Care Med. 155, 1376–1383. Postlethwait, E.M., Bidani, A., Evans, M.J., 1990. The effect of NO2 exposure on perfusate distribution in isolated rat lungs: pulmonary versus bronchial circulation. Toxicol. Appl. Pharmacol. 106, 456–461. Rivier, C., Rivier, J., Vale, W., 1986. Stress-induced inhibition of reproductive functions: role of endogenous corticotropin-releasing factor. Science 231, 607–609. Sawaki, M., Noda, S., Muroi, T., Mitoma, H., Takakura, S., Sakamoto, S., Yamasaki, K., 2003. In utero through lactational exposure to ethinyl estradiol induces cleft phallus and delayed ovarian dysfunction in the offspring. Toxicol. Sci. 75, 402–411. Stocco, D.M., Clark, B.J., 1996. Regulation of the acute production of steroids in steroidogenic cells. Endocr. Rev. 17, 221–244. Takafuji, S., Suzuki, S., Koizumi, K., Tadokoro, K., Miyamoto, T., Ikemori, R., Muranaka, M., 1987. Diesel-exhaust particulates inoculated by the intranasal route have an adjuvant activity for IgE production in mice. J. Allergy Clin. Immunol. 79, 639–645. Takenaka, S., Karg, E., Roth, C., Schulz, H., Ziesenis, A., Heinzmann, U., Schramel, P., Heyder, J., 2001. Pulmonary and systemic distribution of inhaled ultrafine silver particles in rats. Environ. Health Perspect. 109 (Suppl. 4), 547–551.

Taneda, S., Mori, Y., Kamata, K., Hayashi, H., Furuta, C., Li, C., Seki, K., Sakushima, A., Yoshino, S., Yamaki, K., Watanabe, G., Taya, K., Suzuki, A.K., 2004. Estrogenic and anti-androgenic activity of nitrophenols in diesel exhaust particles (DEP). Biol. Pharm. Bull. 27, 835–837. Taya, K., Watanabe, G., Sasamoto, S., 1985. Radioimmunoassay for progesterone, testosterone, and estradiol-17b using 125 I-iodohistamine radioligands. Jpn. J. Anim. Reprod. 31, 186–197. Tozuka, Y., Watanabe, N., Ohsawa, M., Toriba, A., Kizu, R., Hayakawa, K., 2004. Transfer of polycyclic aromatic hydrocarbons to fetuses and breast milk of rats exposed to diesel exhaust. J. Health Sci. 250, 497–502. Tsukue, N., Tsubone, H., Suzuki, A.K., 2002. Diesel exhaust affects the abnormal delivery in pregnant mice and the growth of their young. Inhal. Toxicol. 14, 635–651. Utell, M.J., Frampton, M.W., 2000. Acute health effects of ambient air pollution: the ultrafine particle hypothesis. J. Aerosol. Med. 13, 355–359. Vaaraslahti, K., Keskinen, J., Giechaskiel, B., Solla, A., Murtonen, T., Vesala, H., 2005. Effect of lubricant on the formation of heavy-duty diesel exhaust nanoparticles. Environ. Sci. Technol. 39, 8497–8504. Walsh, L.P., McCormick, C., Martin, C., Stocco, D.M., 2000. Roundup inhibits steroidogenesis by disrupting steroidogenic acute regulatory (StAR) protein expression. Environ. Health Perspect. 108, 769–776. West, L.A., Horvat, R.D., Roess, D.A., Barisas, B.G., Juengel, J.L., Niswender, G.D., 2001. Steroidogenic acute regulatory protein and peripheral-type benzodiazepine receptor associate at the mitochondrial membrane. Endocrinology 142, 502–505. Yoshida, S., Sagai, M., Oshio, S., Umeda, T., Ihara, T., Sugamata, M., Sugawara, I., Takeda, K., 1999. Exposure to diesel exhaust affects the male reproductive system of mice. Int. J. Androl. 22, 307–315.