Effects of orexins A and B on expression of orexin receptors and progesterone release in luteal and granulosa ovarian cells

Regulatory Peptides 178 (2012) 56–63

Contents lists available at SciVerse ScienceDirect

Regulatory Peptides journal homepage: www.elsevier.com/locate/regpep

Effects of orexins A and B on expression of orexin receptors and progesterone release in luteal and granulosa ovarian cells Natalia I. Cataldi a, Victoria A.R. Lux-Lantos a, Carlos Libertun a, b,⁎ a b

Instituto de Biología y Medicina Experimental-CONICET, Vuelta de Obligado 2490, C1428ADN, Argentina Departamento de Fisiología, Facultad de Medicina, Universidad de Buenos Aires, Argentina

a r t i c l e

i n f o

Article history: Received 5 December 2011 Received in revised form 29 March 2012 Accepted 22 June 2012 Available online 29 June 2012 Keywords: Orexins Hypocretins OX1 receptor OX2 receptor Progesterone Ovary

a b s t r a c t Orexin-A and orexin-B are neuropeptides controlling sleep-wakefulness, feeding and neuroendocrine functions via their G protein-coupled receptors, orexin-1R and orexin-2R. They are synthesized in the lateral hypothalamus and project throughout the brain. Orexins and orexin receptors have also been described outside the brain. Previously we demonstrated the presence of both receptors in the ovary, their increased expression during proestrous afternoon and the dependence on the gonadotropins. Here we studied the effects of orexins on the mRNA expression of both receptors, by quantitative real-time PCR, on luteal cells from superovulated rat ovaries and granulosa cells from diethylstilbestrol-treated rat ovaries. Effects on progesterone secretion were also measured. In luteal cells, 1 nM of either orexin-A or orexin-B decreased progesterone secretion. Orexin-A treatment increased expression of both orexin-1R and orexin-2R mRNA. The effect on orexin-1R mRNA expression was abolished by an orexin-1R selective receptor antagonist SB-334867 and the effect on orexin-2R mRNA expression was abolished by a selective orexin-2R antagonist JNJ-10397049. Orexin-B did not modify orexin-1R mRNA expression, but increased orexin-2R mRNA expression. The effect of orexin-B on orexin-2R was abolished by a selective orexin-2R antagonist. Neither the expression of orexin receptors nor progesterone secretions by granulosa cells were affected by orexins. FSH, as positive control, increased both steroid hormones secretion, but did not induce the expression of OX receptors in granulosa cells isolated from late preantral/early antral follicles. Finally in ovaries obtained immediately after sacrifice, the expression of orexin-1R and orexin-2R was higher in superovulated rat ovaries compared to control or diethylstilbestrol treated rat ovaries. A selective presence and function of both orexinergic receptors in luteal and granulosa cells is described, suggesting that the orexinergic system may have a functional role in the ovary. © 2012 Elsevier B.V. All rights reserved.

1. Introduction The regulatory peptides orexin-A (OXA, also known as hypocretin 1) and orexin-B (OXB, hypocretin 2), acting via G protein-coupled receptors orexin-1 receptor (OX1-R) and orexin-2 receptor (OX2-R), control sleep-wakefulness, feeding, and a variety of neuroendocrine functions. The orexins are derived from prepro-orexin (PPO), a 130 amino acid precursor which was isolated from rat hypothalamus, to mature OXA (33 residues) and OXB (28 residues). Both neuropeptides are synthesized by neurons in the lateral hypothalamus and project throughout the brain [1–5]. In addition, a peripheral source of the orexin peptides could be the gut, which expresses PPO [6]. Orexins and orexin receptors have been described outside the CNS. They are expressed in several glands including gonads and genital tract in both sexes [7–16]. In a previous work, we demonstrated the influence of the reproductive state, GnRH and gonadotropins, particularly the hormonal milieu ⁎ Corresponding author at: Vuelta de Obligado 2490, C1428ADN, Buenos Aires, Argentina. Tel.: +54 11 4783 2869; fax: +54 11 4786 2564. E-mail address: [email protected] (C. Libertun). 0167-0115/$ – see front matter © 2012 Elsevier B.V. All rights reserved. doi:10.1016/j.regpep.2012.06.008

of late proestrus, on the central orexinergic system [17]. We also showed the presence of both receptors, OX1-R and OX2-R in the ovary, their increased expression during the proestrous afternoon and the dependence of this expression on the gonadotropin peaks, but not on the dark–light cycle or food intake [18,19]. Here we studied the in vitro effects of both orexinergic neuropeptides, in the presence or absence of selective antagonists, on the expression of OX1-R and OX2-R receptors in luteal and granulosa cells of rats, as well as effect(s) on steroid hormone secretion. In addition, the expression of both receptors was determined in ovaries obtained immediately after sacrifice in controls, superovulated rats and diethylstilbestrol treated rats. 2. Material and methods 2.1. Animals Female virgin Sprague–Dawley rats from the Instituto de Biología y Medicina Experimental colony were housed in groups in an air-conditioned room (21 °C), with lights on from 07:00 h to 19:00 h. They were given free access to laboratory chow and tap water. At the

N.I. Cataldi et al. / Regulatory Peptides 178 (2012) 56–63

Each SPO ovary yielded approximately 1 × 106 viable cells/well. Briefly, cells were plated in plastic 24-well culture dishes, precoated with rat tail collagen (Sigma-Aldrich) and incubated in BIC: DMEM-F12 (Life Technologies, Carlsbad, CA) with 2.2 g/l sodium bicarbonate, 10% fetal bovine serum (Life Technologies), 0.01 mg/ml gentamicin (Life Technologies), and 0.01 mg/ml fungizone (Life Technologies). 24 h after plating the media were replaced. After 7 days in culture the cells were washed once with serum-free BIC-BSA: 0.1% BSA-supplemented (Sigma-Aldrich) medium (DMEM-F12 with 2.2 g/l sodium bicarbonate) and the stimuli were added. Stimuli were renewed 24 h later. Samples were collected 24 h thereafter (total incubation time: 48 h) for the corresponding determinations. Granulosa cell isolation and culture. Granulosa cells from DES-treated rats were isolated, as described previously [22]. Cells were seeded onto plastic 24-well plates (Nunc, Roskilde, Denmark) precoated with rat tail collagen. The initial plating density was 6 ×105 viable cells/well. Ovaries were incubated in Dulbecco Modified Eagle Medium (DMEM), EGTA (6.8 mM), and HEPES (10 mM; 15 min at 37 °C) and then washed twice and incubated in DMEM-FI2 (l: l), sucrose (0.5 M), and HEPES (10 mM; 5 min at 37 °C). Granulosa cells were obtained by pressing ovaries within two pieces of nylon mesh (Nytex 50, Geneva, Switzerland) and were purified by density gradient centrifugation, as described by Magoffin and Erickson [23]. Cells were maintained at 37 °C with 5% CO2. Androstenedione (Sigma‐Aldrich), 0.25 μM was added as an estradiol precursor. After 3 h, the medium was changed to remove

end of experimental procedures, animals were killed by decapitation at 09:00–10:00 h. Trunk blood was collected, ovaries were quickly removed and then tissues and sera were stored at −20 °C for hormone determinations. All procedures were performed according to protocols for animal use, approved by the institutional animal care and use committee (IBYME-CONICET) consistent with NIH guidelines. Luteal cells, superovulated rat ovaries (SPO): Prepuberal female rats, 23 days old, were injected s.c. with 25 IU of equine chorionic gonadotropin (eCG) (Novormon, Syntex, Buenos Aires, Argentina) and the 25 IU of human chorionic gonadotropin (hCG) (Endocorion, Elea, Buenos Aires, Argentina) 48 h later. These animals were used 5 days after hCG injection. They were quickly decapitated in the morning, between 900 and 1100 h, for sampling. Details of the model are described in references [20,21]. Granulosa cells, diethylstilbestrol treated rat ovaries (DES): Prepuberal female rats, 23 days old, were injected s.c. with 1 mg diethylstilbestrol (Sigma-Aldrich, St. Louis, MO), dissolved in castor oil, daily for 3 days to stimulate the development of early antral follicles. 24 h after the last injection blood and ovaries were collected as described above. Solvent injected animals were used as a control (C) group. 2.2. In vitro procedures Cells from SPO ovaries, were isolated with collagenase (Life Technologies, Inc., Grand Island, NY), as described previously [20,21].

400

57

SPO

OXA

350

P4 (pg / ml)

300

*

250

*

*

200 150 100 50 0 Control

400

OXA

OXA OX1R ant

OXA ----OX2R ant

OXA OX1R ant OX2R ant

OXB ----OX2R ant

OXB OX1R ant OX2R ant

OXB

350

P4 (pg / ml)

300

*

250

*

200 150 100 50 0 Control

OXB

OXB OX1R ant

Fig. 1. Progesterone (P4) secretion into culture media by luteal cells treated with 1 nM OXA (upper panel) or OXB (lower panel), in the presence or absence of 10 μM OX1R antagonist, OX2R antagonist or both orexin antagonists combined. After 7 days in culture media were changed and the stimuli added. Stimuli were renewed 24 h later. Samples were collected 24 h thereafter (total incubation time: 48 h). No effect of OX1R ant, OX2R ant or the OX1R/OX2R antagonist combination was seen in the absence of OXA or OXB stimulation (not shown). Mean ± SEM is shown with * significantly different from control (pb 0.05) (n = 4–6). Cultures were repeated 5–7 times; wells by duplicate or triplicate. OXA: orexin A. OXB: orexin B. OX1R ant: OX1R antagonist: OX2R ant: OX2R antagonist.

58

N.I. Cataldi et al. / Regulatory Peptides 178 (2012) 56–63

evaluated by the ratio of absorbance at 260 nm/280 nm (>1.8). RNAs were kept frozen at −70 °C until analyzed. After digestion of genomic DNA by treatment with deoxyribonuclease I (Ambion, Austin, TX), first-strand cDNA was synthesized from 2 μg of total RNA for SPO cells, and 1 μg for DES cells, in the presence of 10 mM MgCl2, 50 mM Tris–HCl (pH 8.6), 75 mM KCl, 0.5 mM deoxy-NTPs, 1 mM DTT, 1 U/μl RnaseOUT (Invitrogen, Buenos Aires, Argentina), 0.5 μg oligo-(deoxythymidine) 15 primer (Biodynamics, Buenos Aires, Argentina), and 20 U MMLV Reverse Transcriptase (Epicentre, Madison, WI). To validate successful deoxyribonuclease I treatment, the reverse transcriptase was omitted in control reactions. The absence of PCR-amplified DNA fragments in these samples indicated the isolation of RNA free of genomic DNA.

non-attached cells and replaced with fresh medium and stimuli were added. First group of samples was collected 6 h later. For the two other groups (24 h and 32 h) stimuli were renewed 12 h after the incubation initial. Media were kept at − 20 °C for RIA determination of steroid hormones. Plates were washed with PBS, and 300 μl of TriZol was added for RNA extraction. 2.3. Drugs OXA, (Sigma‐Aldrich), 10−9 M; OXB (Sigma-Aldrich), 10−9 M or FSH (NIH, Bethesda, MD) (200 ng/ml), as positive control only in relation to DES cells. PBS was used as negative control. SB-334867-A (OX1R ant; N-(2-methyl-6-benzoxazolyl)-N′-1,5-naphthyridin-4-yl urea hydrochloride) is a non-peptide OX1-R selective receptor antagonist, (Smart 2001) (Tocris Bioscience, MO, USA). Selective OX2-R antagonist JNJ-10397049 [24] (OX2R ant; 9,1-(2,4-dibromo-phenyl)-3((4S,5S)-2,2-dimethyl-4-phenyl-[1,3]dioxan-5-yl)-urea) was provided by Johnson & Johnson Pharmaceutical Research & Development, LLC, S. Diego, USA. Drug concentrations used were determined by preliminary studies using progesterone secretion as an end point (data not shown) and the literature [25–29].

2.5. Quantitative real-time PCR Sense and antisense oligonucleotide primers were designed based on the published cDNA OX1-R and OX2-R receptor, and cyclophilin sequences using the PrimerExpress software (Applied Biosystems, Foster City, CA). Oligonucleotides were obtained from Invitrogen. The sequences of the primers were as follows: OX1-R sense GCCTGCCAGCCTGTTAGTG, OX1-R antisense AAGGCATGGCCGAAGAG, OX2-R sense GAAAGAATAT GAGTGGGTCCTGATC, OX2-R antisense CAGGACGTTCCCGATGAGA, cyclophilin sense GTGGCAAGATCGAAGTGGAGA AAC, cyclophilin antisense TAAAAATCAGGCCTGTGGAAT GTG. Quantitative measurements of OX1-R and OX2-R receptor, and cyclophilin cDNA were performed by kinetic PCR using SYBR green I

2.4. Total RNA preparation and cDNA synthesis Total RNA was isolated using the TRIzol reagent method from tissue homogenates as previously described [18]. The RNA concentration was determined based on absorbance at 260 nm and its purity was

SPO OX1 mRNA expression (AU)

8

OXA

*

*

7 6 5 4 3 2 1 0 Control

OXA

OXA OX1R ant

OXA ----OX2R ant

OXA OX1R ant OX2R ant

OX2 mRNA expression (AU)

5

* 4

* 3

2

1

0 Control

OXA

OXA OX1R ant

OXA ----OX2R ant

OXA OX1R ant OX2R ant

Fig. 2. Luteal cells (SPO). Effect of 1 nM OXA on OX1-R (upper) and OX2-R (lower) mRNA expression examined with or without 10 μM of OX1R ant, OX2R ant. Mean ± SEM is shown with * significantly different from control (p b 0.05) (n = 5–8). OXA: orexin A. OXB: orexin B. OX1R ant: OX1R antagonist: OX2R ant: OX2R antagonist.

N.I. Cataldi et al. / Regulatory Peptides 178 (2012) 56–63

as fluorescent dye (Invitrogen). PCR reactions consisted of 100 ng cDNA, 0.4 μM primers, 10 mM Tris–HCl, 50 mM KCl, 3 mM MgCl2, 0.2 mM deoxy-NTPs, and 1.25 U Taq Polymerase (Invitrogen) in a final volume of 25 μl. After denaturizing at 95 °C for 5 min, the cDNA products were amplified with 40 cycles, each cycle consisting of denaturizing at 95 °C for 15 s, annealing at 58 °C for 40 s and extension at 72 °C for 40 s. The accumulating DNA products were monitored by the ABI7500 sequence detection system (Applied Biosystems), and data were stored continuously during the reaction. The results were validated based on the quality of dissociation curves, generated at the end of the PCR runs by ramping the temperature of the samples from 60 °C to 95 °C, meanwhile continuously collecting fluorescence data. Product purity was confirmed by polyacrylamide gel electrophoresis. Each sample was analyzed in duplicate along with specific standards and no template controls to monitor contaminating DNA. The calculations of the initial mRNA copy numbers in each sample were made according to the cycle threshold (Ct) method. The CT for each sample was calculated at a fluorescence threshold (Rn) using the ABI7500 sequence detection system software with an automatic baseline setting. For all designed primer sets, linearity of Real-time RT-PCR signaling was determined with wide-range serial dilutions of reference cDNA that covered the amount of target mRNA expected in the experimental samples, and clear linear correlations were found between the amount of cDNA and the Ct for the duration of at least 40 real-time RT-PCR rounds. For each target gene, the relative gene expression was normalized to that of the cyclophilin housekeeping gene by the use of the standard curve method, as described by the manufacturer (User bulletin # 2). Results are expressed as arbitrary units (AU) for comparison

59

among samples. AU is defined as the expression level relative to a sample of solvent injected controls (calibrator sample). 2.6. Hormonal determinations Medium progesterone (P4) and estradiol (E2) were determined by RIA using specific antisera kindly provided by Dr. G.D. Niswender (Colorado State University, Fort Collins, CO) after ethyl ether extraction for serum samples. Labeled hormones were purchased from PerkinElmer (Wellesley, MA). Assay sensitivities were 1.8 pg for estradiol and 25 pg for progesterone. Intra- and inter-assay coefficients of variation were 6.8 and 11.7% for estradiol, respectively; 7.1 and 12.15% for progesterone, respectively. 2.7. Statistics Data are presented as mean ± SEM. Cultures were repeated 6 times; wells by duplicate or triplicate. Differences between treatment groups were estimated by one-way variance analysis for repeated measures (ANOVA) followed by Tukey's post-test using the Statistica Software. P b 0.05 indicated statistically significant differences. 3. Results 3.1. Progesterone secretion into culture media by superovulated rat ovary cells incubated with OXA and OXB Both OXA and OXB (1 nM) decreased progesterone secretion (Fig. 1). The OXA effect on progesterone was not changed by any

OX1-R mRNA expression (AU)

SPO 5

OXB

4 3 2 1 0 Control

OX2-R mRNA expression (AU)

4

OXB

OXB OX1R ant

OXB ----OX2R ant

OXB OX1R ant OX2R ant

* *

3

2

1

0 Control

OXB

OXB OX1R ant

OXB ----OX2R ant

OXB OX1R ant OX2R ant

Fig. 3. Luteal cells (SPO). Effect of 1 nM OXB on OX1-R (upper) and OX2-R (lower) mRNA expression examined with or without 10 μM OX1R ant, OX2R ant. Mean ± SEM is shown with * significantly different from control (p b 0.05) (n = 5–7). OXA: orexin A. OXB: orexin B. OX1R ant: OX1R antagonist: OX2R ant: OX2R antagonist.

60

N.I. Cataldi et al. / Regulatory Peptides 178 (2012) 56–63

blocking agent (OX1R antagonist SB-334867 or OX2R antagonist JNJ-10397049) when used alone, but the effect was suppressed when both agents were present in medium at 10 μM. SB-334867 functionally antagonizes the OX1-R with a pKb of 8.1 [30] and JNJ-10397049 antagonizes the OX2-R with a pKb of 7.9 [24], therefore full blockade was achieved with each antagonist. The OXB decreasing effect was abolished by OX2R ant alone or combined with OX1R ant.

positive control, increased both steroid hormones at all studied times (Fig. 4).

3.2. OX1-R and OX2-R mRNA expression in superovulated rat ovary cells treated with OXA and OXB

3.5. OX1-R and OX2-R mRNA expression in freshly obtained ovaries

3.4. OX1-R and OX2-R mRNA expression in diethylstilbestrol treated rat ovary cells incubated with OXA and OXB In contrast with SPO rats, neither orexin peptide modified expression of OX1-R or OX2-R mRNA at any time in DES animals (Fig. 5).

Finally, the expression of both receptors was determined in whole ovaries dissected immediately after sacrifice from control, SPO and DES treated rats (Fig. 6). Orexin-1 receptor and orexin-2 receptor expression was higher in SPO in comparison to control or DES treated animals. In trunk blood collected after decapitation, serum progesterone but not estradiol was increased in SPO rats (P4, ng/ml, C: 0.043 ±0.001, SPO: 0.1667±0.012 (pb 0.05), DES: 0.0361 ± 0.003 NS. E2, ng/ml, C: 0.221 ±0.015, SPO: 0.192± 0.004, DES: 0.266 ±0.011, NS. n: 7–8 per group).

OXA treatment (1 nM) increased the expression of both OX1-R and OX2-R mRNA (Fig. 2). The OXA effect on OX1-R mRNA expression was abolished when 10 μM of OX1R antagonist was present, either alone or combined with 10 μM OX2R antagonist. OX2R antagonist alone was ineffective. The OXA effect on OX-2 mRNA expression was abolished when OX2-R antagonist was present, either alone or combined with OX1-R antagonist. OX1-R antagonist alone was ineffective. OXB treatment (1 nM) did not modify OX1-R mRNA expression, but increased OX2-R mRNA expression (Fig. 3). The effect of OXB on OX2-R was abolished when OX2R antagonist was present, either alone or combined with OX1R antagonist. The OX1R antagonist alone was ineffective.

4. Discussion The purpose of the present work was to further investigate the orexinergic system in the ovary. In previous studies we described OX1-R and OX2-R mRNA expression in the gonads of adult rats at different stages of the estrous cycle and correlated mRNA expression to the endocrine status, the sleep–wake cycle and food intake. Both orexinergic receptors vary along the estrous cycle, with a marked

3.3. Progesterone and estradiol secretion into culture media by ovary cells from diethylstilbestrol treated rats, incubated with OXA and OXB OXA and OXB were unable to modify progesterone or estradiol in medium, after 6, 24 or 32 h of incubation. FSH, 200 ng/ml, used as

control OXA OXB FSH

DES *

E2 (pg / ml)

4000

3000

* 2000

*

1000

0 6 hs

24hs

32hs

0,8

*

0,7

P4 (pg / ml)

0,6 0,5

* *

0,4 0,3 0,2 0,1 0,0 6 hs

24hs

32hs

Fig. 4. Progesterone (P4, lower) and estradiol (E2, upper) secretion into culture media by granulosa cells treated with 1 nM OXA or OXB, at 0 h. FSH: positive control. Samples were collected after 6 h, 24 h and 32 h. of initial stimulation. Mean ± SEM is shown with * significantly different from control (p b 0.05) (n = 6). OXA: orexin A. OXB: orexin B. FSH: follicule stimulating hormone.

N.I. Cataldi et al. / Regulatory Peptides 178 (2012) 56–63

OX1-R mRNA expression (AU)

DES

61

control

2.5

OXA OXB

2.0

FSH

1.5

1.0

0.5

0.0 6 hs

24hs

32hs

OX2-R mRNA expression (AU)

2.5

2.0

1.5

1.0

0.5

0.0 6 hs

24hs

32hs

Fig. 5. Granulosa cells (DES). Lack of effect of 1 nM OXA and OXB on OX1-R (upper) and OX2-R (lower) mRNA expression. FSH: positive control. (n = 6). OXA: orexin A. OXB: orexin B. FSH: follicule stimulating hormone.

increase in the evening of proestrus. The fact that the increase in mRNA expression of both orexin receptors occurred only during the late afternoon and night of proestrus strongly suggests that the proestrus hormonal state leads to ovulation and bares no relationship to the sleep–wake cycle or food intake [16–19]. Here, we used an in vitro system to investigate whether orexin neuropeptides, acting directly on luteal or granulosa cells, have effects on the mRNA expression of OX1-R and OX2-R as well as on steroid secretions. In luteal cells, OXA treatment at 1 nM increased the mRNA expression of both receptors. The effect on OX1-R was abolished by 10 μM SB-334867, an OX1R selective receptor antagonist, and the effect on OX2-R was abolished by 10 μM JNJ-10397049, a selective OX2R antagonist, indicating that the neuropeptide is acting on those receptors. OXB did not modify OX1-R mRNA expression, but increased OX2-R mRNA expression and this effect was suppressed by OX2R antagonist, indicating a potentially more limited action of OXB. This is consistent with published pharmacology, as the OXB pKi was 5.8 and the pEC50 was 6.7 in a COS OX2-R expression system [31]. OXA (1 nM) decreased P4 release into the medium and this endocrine effect was abolished when 10 μM of both OX1R and OX2R antagonists was present, indicating some complementary action between OX1-R and OX2-R. OXB also decreased P4 and this action was blocked by OX2R antagonist in our in vitro system. Thus, both neuropeptides are active on the mRNA expression of OX1-R and OX2-R and on P4 output, suggesting that the orexinergic system may have some functional role in the ovary. On the other hand, some differences in actions of both ligands on their receptors in the gonad are present, as has been shown in other

tissues. Variation of the distribution of OXA and OXB immunoreactivity has been described in the rat brain. OX1-R and OX2-R genes are also widely expressed in the rodent brain, with differences in distribution and mechanisms of action. Differential roles for OX1 and OX2 receptors have been suggested [32–40]. The intracellular signaling pathways mediating the effects of orexins have been investigated and differences may help to explain the diverse biological actions of orexins. Briefly, OX1-R is coupled to Gq/11 protein and the activation of phospholipase C and the phosphatidylinositol cascade. OX2-R is coupled to both Gq/11 and inhibitory Gi proteins in cell lines [41–44]. Orexin A is a more selective ligand for OX1-R while OX2-R binds both orexins A and B. Another consideration regarding the differential effects of both orexin receptor antagonists would be their specificity. OX2R antagonist JNJ-10397049 has in vitro selectivity of about 600-fold for OX2-R over OX1-R [24]. Although our data suggest that the effect of orexins and their receptors in the gonad may be involved in different functions, additional studies are needed to determine whether the differences observed between these new compounds depend on the pharmacology of them or to a differential function for each orexin and for each receptor in the ovary. A sharp contrast with luteal cells was found in granulosa cells, since neither 1 nM OXA nor OXB modified OX1-R and OX2-R mRNA expression, or P4 or E2 release, at any time studied. A different cellular localization of OX1-R and OX2-R and different endocrine functions between luteal and granulosa cells are suggested by the present results. Furthermore, the mRNA expression of both receptors was higher in SPO ovaries than in controls or DES ovaries.

N.I. Cataldi et al. / Regulatory Peptides 178 (2012) 56–63

OX1-R mRNA expression (AU)

62

*

10 8

6

4

2

0

Control

OX2-R mRNA expression (AU)

5

SPO

DES

*

4

3

2

1

0

Control

SPO

DES

Fig. 6. OX1-R (upper) and OX2-R (lower) mRNA expression examined from control, SPO and DES ovaries. Mean ± SEM is shown with * significantly different from control (p b 0.05) (n = 5–6).

The presence of mRNAs demonstrates that the corresponding genes are expressed in these cells; and changes in mRNA expression are possibly related to alterations in receptor transcription. On the other hand, since no prepro-orexin mRNA expression was observed in the ovary, throughout the estrous cycle [18,45] or in pooled ovaries [10], different hypotheses can be suggested to explain the finding of both receptors in the gonad in the absence of the precursor. OXA and OXB may originate elsewhere, as e.g. the hypothalamus or some peripheral source as the gut, which expresses prepro-orexin [6,46], or the receptors may be activated by other molecules present in the gonad. The first possibility, orexins may originate from outside the gonad, suggested that they arrive by the general circulation. Immunoreactive OXA has been described in blood [47–49]. The possibility that orexins reach the ovary via the general circulation and, alone or in combination with gonadotropins or other factors, may regulate OX1-R and OX2-R mRNA expression in a hypothesis that should be a matter of further research. Also, the contribution of nerves ending in the gonads should be matter of further studies. A selective presence and function of both orexinergic receptors in luteal and granulosa cells is described, suggesting that the orexinergic system may have a regulatory role in the ovary.

Acknowledgments This work was supported by grants from Consejo Nacional de Investigaciones Científicas y Técnicas (CONICET; PIP 00363), Agencia Nacional de Promoción Científica y Tecnológica (ANPCyT; PICT 2007‐01050) and Universidad de Buenos Aires (M 043). We thank Dr. Steven Sutton for his valuable comments on this manuscript.

References [1] de Lecea L, Kilduff TS, Peyron C, Gao X, Foye PE, Danielson PE, Fukuhara C, Battenberg EL, Gautvik VT, Bartlett FS, Frankel WN, van den Pol AN, Bloom FE, Gautvik KM, Sutcliffe JG. The hypocretins: hypothalamus-specific peptides with neuroexcitatory activity. Proc Natl Acad Sci U S A 1998;95:322–7. [2] Ferguson AV, Samson WK. The orexin/hypocretin system: a critical regulator of neuroendocrine and autonomic function. Front Neuroendocrinol 2003;24:141–50. [3] Peyron C, Tighe DK, van den Pol AN, de Lecea L, Heller HC, Sutcliffe JG, Kilduff TS. Neurons containing hypocretin (orexin) project to multiple neuronal systems. J Neurosci 1998;18:9996–10015. [4] Sakurai T, Amemiya A, Ishii M, Matsuzaki I, Chemelli RM, Tanaka H, Williams SC, Richardson JA, Kozlowski GP, Wilson S, Arch JR, Buckingham RE, Haynes AC, Carr SA, Annan RS, McNulty DE, Liu WS, Terrett JA, Elshourbagy NA, Bergsma DJ, et al. Orexins and orexin receptors: a family of hypothalamic neuropeptides and G protein-coupled receptors that regulate feeding behavior. Cell 1998;92:573–85. [5] Sakurai T. The neural circuit of orexin (hypocretin): maintaining sleep and wakefulness. Nat Rev Neurosci 2007;8:171–81. [6] Kirchgessner AL. Orexins in the brain–gut axis. Endocr Rev 2002;23:1–15. [7] Barreiro ML, Pineda R, Gaytan F, Archanco M, Burrell MA, Castellano JM, Hakovirta H, Nurmio M, Pinilla L, Aguilar E, Toppari J, Dieguez C, Tena-Sempere M. Pattern of orexin expression and direct biological actions of orexin-a in rat testis. Endocrinology 2005;146:5164–75. [8] Blanco M, Gallego R, Garcia-Caballero T, Dieguez C, Beiras A. Cellular localization of orexins in human anterior pituitary. Histochem Cell Biol 2003;120:259–64. [9] Heinonem MV, Purhonen AK, Makela KA, Herzig KH. Functions of orexins in peripheral tissues. Acta Physiol (Oxf) 2008;192:471–85. [10] Johren O, Neidert SJ, Kummer M, Dendorfer A, Dominiak P. Prepro-orexin and orexin receptor mRNAs are differentially expressed in peripheral tissues of male and female rats. Endocrinology 2001;142:3324–31. [11] Johren O, Bruggemann N, Dendorfer A, Dominiak P. Gonadal steroids differentially regulate the messenger ribonucleic acid expression of pituitary orexin type 1 receptors and adrenal orexin type 2 receptors. Endocrinology 2003;144:1219–25. [12] Karteris E, Chen J, Randeva HS. Expression of human prepro-orexin and signaling characteristics of orexin receptors in the male reproductive system. J Clin Endocrinol Metab 2004;89:1957–62. [13] Nowak KW, Strowski MZ, Switonska MM, Kaczmarek P, Singh V, Fabis M, Mackowiak P, Nowak M, Malendowicz LK. Evidence that orexins A and B stimulate insulin secretion from rat pancreatic islets via both receptor subtypes. Int J Mol Med 2005;15:969–72.

N.I. Cataldi et al. / Regulatory Peptides 178 (2012) 56–63 [14] Nurmio M, Tena-Sempere M, Toppari J. Orexins and the regulation of the hypothalamic–pituitary–testicular axis. Acta Physiol (Oxf) 2010;198:349–54. [15] Russell SH, Small CJ, Kennedy AR, Stanley SA, Seth A, Murphy KG, Taheri S, Ghatei MA, Bloom SR. Orexin A interactions in the hypothalamo-pituitary gonadal axis. Endocrinology 2001;142:5294–302. [16] Silveyra P, Cataldi NI, Lux-Lantos VA, Libertun C. Role of orexins in the hypothalamic– pituitary–ovarian relationships. Acta Physiol (Oxf) 2010;198:355–60. [17] Silveyra P, Catalano PN, Lux-Lantos V, Libertun C. Impact of proestrous milieu on expression of orexin receptors and prepro-orexin in rat hypothalamus and hypophysis: actions of Cetrorelix and Nembutal. Am J Physiol Endocrinol Metab 2007;292: E820–8. [18] Silveyra P, Lux-Lantos V, Libertun C. Both orexin receptors are expressed in rat ovaries and fluctuate with the estrous cycle: effects of orexin receptor antagonists on gonadotropins and ovulation. Am J Physiol Endocrinol Metab 2007;293: E977–85. [19] Silveyra P, Cataldi N, Lux-Lantos V, Libertun C. Gonadal steroids modulated hypocretin/orexin type-1 receptor expresión in brain regions, sex and daytime specific manner. Regul Pept 2010;158:121–6. [20] Chamson-Reig A, Sorianello E, Catalano PN, Fernández MO, Pignataro OP, Libertun C, Lux-Lantos VAR. Gonadotropin-releasing hormone signaling pathways in an experimental ovarian tumor. Endocrinology 2003;144:2957–66. [21] Saragüeta P, Krimer ARD, Charreau EH, Tesone M. Insulin regulation of steroidogenic activity in rat culture luteal cells. J Steroid Biochem 1989;32:393–7. [22] Bley MA, Simon JC, Estevez AG, de Asua LJ, Baranao JL. Effect of follicle-stimulating hormone on insulin-like growth factor-I-stimulated rat granulosa cell deoxyribonucleic acid synthesis. Endocrinology 1992;131:1223–9. [23] Magoffin DA, Erickson GF. Purification of ovarian theca-interstitial cells by density gradient centrifugation. Endocrinology 1988;122:2345–7. [24] McAtee LC, Sutton SW, Rudolph DA, Li X, Aluisio LE, Phuong VK, Dvorak CA, Lovenberg TW, Carruthers NI, Jones TK. Novel substituted 4-phenyl-[1,3]dioxanes: potent and selective orexin receptor 2 (OX(2)R) antagonists. Bioorg Med Chem Lett 2004;14:4225–9. [25] Dugovic C, Shelton JE, Aluisio LE, Fraser IC, Jiang X, Sutton SW, Bonaventure P, Yun S, Li X, Lord B, Dvorak CA, Carruthers NI, Lovenberg TW. Blockade of orexin-1 receptors attenuates orexin-2 receptor antagonism-induced sleep promotion in the rat. J Pharmacol Exp Ther 2009;330:142–51. [26] Hardy AB, Aioun J, Baly C, Julliard KA, Caillol M, Salesse R, Duchamp-Viret P. Orexin A modulates mitral cell activity in the rat olfactory bulb: patch-clamp study on slices and immunocytochemical localization of orexin receptors. Endocrinology 2005;146:4042–53. [27] Karteris E, Machado RJ, Chen J, Zervou S, Hillhouse EW, Randeva HS. Food deprivation differentially modulates orexin receptor expression and signaling in rat hypothalamus and adrenal cortex. Am J Physiol Endocrinol Metab 2005;288: E1089–100. [28] Mazzocchi G, Malendowicz LK, Gottardo L, Aragona F, Nussdorfer GG. Orexin A stimulates cortisol secretion from human adrenocortical cells through activation of the adenylate cyclase-dependent signaling cascade. J Clin Endocrinol Metab 2001;86:778–82. [29] Sasson R, Dearth RK, White RS, Chappell PE, Mellon PL. Orexin A induces GnRH gene expression and secretion from GT1-7 hypothalamic GnRH neurons. Neuroendocrinology 2006;84:353–63. [30] Malherbe P, Borroni E, Pinard E, Wettstein JG, Knoflach F. Biochemical and electrophysiological characterization of almorexant, a dual orexin 1 receptor (OX1)/orexin 2 receptor (OX2) antagonist: comparison with selective OX1 and OX2 antagonists. Mol Pharmacol 2009;76:618–31.

63

[31] Tran DT, Bonaventure P, Hack M, Mirzadegan T, Dvorak CA, Letavic M, Carruthers NI, Lovenberg TW, Sutton SW. Chimeric, mutant orexin receptors show key interactions between orexin receptors, peptides and antagonists. Eur J Pharmacol 2011;667:120–8. [32] Ammoun S, Holmqvist T, Shariatmadari R, Oonk HB, Detheux M, Parmentier M, Akerman KE, Kukkonen JP. Distinct recognition of OX1 and OX2 receptors by orexin peptides. J Pharmacol Exp Ther 2003;305:507–14. [33] Cai XJ, Denis R, Vernon RG, Clapham JC, Wilson S, Arch JR, Williams G. Food restriction selectively increases hypothalamic orexin-B levels in lactating rats. Regul Pept 2001;97:163–8. [34] Cluderay JE, Harrison DC, Hervieu GJ. Protein distribution of the orexin-2 receptor in the rat central nervous system. Regul Pept 2002;104:131–44. [35] Cutler DJ, Morris R, Sheridhar V, Wattam TA, Holmes S, Patel S, Arch JR, Wilson S, Buckingham RE, Evans ML, Leslie RA, Williams G. Differential distribution of orexin-A and orexin-B immunoreactivity in the rat brain and spinal cord. Peptides 1999;20:1455–70. [36] Kastin AJ, Akerstrom V. Orexin A but not orexin B rapidly enters brain from blood by simple diffusion. J Pharmacol Exp Ther 1999;289:219–23. [37] Lu XY, Bagnol D, Burke S, Akil H, Watson SJ. Differential distribution and regulation of OX1 and OX2 orexin/hypocretin receptor messenger RNA in the brain upon fasting. Horm Behav 2000;37:335–44. [38] Porkka-Heiskanen T, Kalinchuk A, Alanko L, Huhtaniemi I, Stenberg D. Orexin A and B levels in the hypothalamus of female rats: the effects of the estrous cycle and age. Eur J Endocrinol 2004;150:737–42. [39] Porkka-Heiskanen T, Alanko L, Kalinchuk A, Heiskanen S, Stenberg D. The effect of age on prepro-orexin gene expression and contents of orexin A and B in the rat brain. Neurobiol Aging 2004;25:231–8. [40] Trivedi P, Yu H, MacNeil DJ, Van der Ploeg LH, Guan XM. Distribution of orexin receptor mRNA in the rat brain. FEBS Lett 1998;438:71–5. [41] Nunez AA, Kannan K, Giesy JP, Fang J, Clemens LG. Effects of bisphenol A on energy balance and accumulation in brown adipose tissue in rats. Chemosphere 2001;42:917–22. [42] Ramanjaneya M, Conner AC, Chen J, Kumar P, Brown JE, Johren O, Lehnert H, Stanfield PR, Randeva HS. Orexin-stimulated MAP kinase cascades are activated through multiple G-protein signalling pathways in human H295R adrenocortical cells: diverse roles for orexins A and B. J Endocrinol 2009;202:249–61. [43] Tsujino N, Sakurai T. Orexin/hypocretin: a neuropeptide at the interface of sleep, energy homeostasis, and reward system. Pharmacol Rev 2009;61:162–76. [44] Zhu Y, Miwa Y, Yamanaka A, Yada T, Shibahara M, Abe Y, Sakurai T, Goto K. Orexin receptor type-1 couples exclusively to pertussis toxin-insensitive G-proteins, while orexin receptor type-2 couples to both pertussis toxin-sensitive and -insensitive G-proteins. J Pharmacol Sci 2003;92:259–66. [45] Nitkiewicz A, Smolinska N, Przala J, Kaminski T. Expression of orexin receptors 1 (OX1) and 2 (OX2) in the porcine ovary during the oestrous cycle. Regul Pept 2010;165:168–90. [46] Kirchgessner AL, Liu M. Orexin synthesis and response in the gut. Neuron 1999;24:941–51. [47] Arihara Z, Takahashi K, Murakami O, Totsune K, Sone M, Satoh F, Ito S, Mouri T. Immunoreactive orexin-A in human plasma. Peptides 2001;22:139–42. [48] Bronsky J, Nedvidkova J, Zamrazilova H, Pechova M, Chada M, Kotaska K, Nevoral J, Prusa R. Dynamic changes of orexin A and leptin in obese children during body weight reduction. Physiol Res 2007;56:89–96. [49] Heinonen MV, Purhonen AK, Miettinen P, Paakkonen M, Pirinen E, Alhava E, Akerman K, Herzig KH. Apelin, orexin-A and leptin plasma levels in morbid obesity and effect of gastric banding. Regul Pept 2005;130:7–13.