Effects of the aryl hydrocarbon receptor agonist 3-methylcholanthrene on the 17β-estradiol regulated mRNA transcriptome of the rat uterus

G Model SBMB 4904 No. of Pages 11

Journal of Steroid Biochemistry & Molecular Biology xxx (2016) xxx–xxx

Contents lists available at ScienceDirect

Journal of Steroid Biochemistry & Molecular Biology journal homepage: www.elsevier.com/locate/jsbmb

Full length article

Effects of the aryl hydrocarbon receptor agonist 3-methylcholanthrene on the 17b-estradiol regulated mRNA transcriptome of the rat uterus Janina Hellea , Annekathrin M. Keilera , Oliver Zieraua , Peggy Dörfelta , Günter Vollmera , Leane Lehmannb , Sridar V. Chitturc, Martin Tenniswoodc , JoEllen Welshc, Georg Kretzschmara,* a

Institute of Zoology, Molecular Cell Physiology and Endocrinology, Technische Universität Dresden, 01062, Dresden, Germany Institute of Pharmacy and Food Chemistry, Universität Würzburg, 97070 Würzburg, Germany c Cancer Research Center and Department of Biomedical Sciences, University at Albany, NY 12144-2345, United States b

A R T I C L E I N F O

Article history: Received 18 November 2016 Received in revised form 1 March 2017 Accepted 6 March 2017 Available online xxx Keywords: Polycyclic aromatic hydrocarbons 17b-estradiol Uterus Aryl hydrocarbon receptor Uterotrophic assay

A B S T R A C T

Polycyclic aromatic hydrocarbons (PAHs) are products of incomplete combustion of organic compounds, abundant in exhaust fumes and cigarette smoke. They act by binding to the aryl hydrocarbon receptor (AHR) which induces expression of phase 1 and phase 2 enzymes in the liver. PAH induced AHR activation may also lead to adverse effects by modulating other pathways, for example estrogen receptor (ER) signaling in the female reproductive tract. We have investigated the effects of the PAH 3-methylcholanthrene (3-MC) on 17b-estradiol (E2) dependent signaling in the uterus of ovariectomized rats to characterize the cross talk between AHR and ER on an mRNA transcriptome wide scale. A standard three day uterotrophic assay was performed in young adult Lewis rats. Treatment induced effects were analyzed using histology, immunohistochemistry and gene expression analysis by microarray and qPCR. 3-MC shows broad E2 antagonistic effects on uterine mRNA transcription of the vast majority of E2 regulated genes, significantly altering prostaglandin biosynthesis, complement activation, coagulation pathways and other inflammatory response pathways. The regulation of ER expression in the uterus, but not the regulation of E2 metabolism in the liver, was identified as a potentially important factor in mediating this general antiestrogenic effect. The regulation of prostaglandin biosynthesis by E2 is important for inflammation-like events during pregnancy including the initiation of birth. Our results suggest that adverse effects of PAHs on prostaglandin related pathways are likely caused by the interference with E2 signaling, specifically by inhibiting the E2 mediated downregulation of PGF2a. Characterization of the generalized antagonistic effect of 3-MC on E2 dependent signaling in the rat uterus thus contributes to a better understanding of molecular mechanisms of the toxicity of PAHs in female reproductive organs. © 2017 Elsevier Ltd. All rights reserved.

1. Introduction Polycyclic aromatic hydrocarbons (PAHs) are an important group of toxic AHR ligands. They are mainly produced by incomplete combustion and are abundant in exhaust fumes and cigarette smoke. It has been shown that cigarette smoke leads to lower fecundity, adverse reproductive outcomes and reduced IVF success rates. Cigarette smoke targets all stages of reproductive function including folliculogenesis, steroidogenesis, embryo

* Corresponding author at: Institute of Zoology, Molecular Cell Physiology and Endocrinology, Technische Universität Dresden, 01062, Dresden, Germany. E-mail address: [email protected] (G. Kretzschmar).

transport, endometrial receptivity, endometrial angiogenesis, uterine blood flow and functioning of the uterine myometrium [1]. Furthermore smoke-free legislation leads to a reduction in preterm births, suggesting a role of PAHs in this condition [2,3], while traffic-related air toxins are positively correlated with preterm birth [4]. 17b-estradiol (E2) plays a crucial role in the regulation of these PAH targeted events. Many PAHs are ligands of the aryl hydrocarbon receptor (AHR). The AHR is a ubiquitously expressed transcription factor of the basic helix loop helix/PER ARNT SIM protein family [5]. While the most investigated aspect of AHR is the induction of a number of phase I and phase II enzymes of the xenobiotic metabolism, the receptor has a number of other functions that are far less understood. One of these is its interaction with estrogen receptor

http://dx.doi.org/10.1016/j.jsbmb.2017.03.004 0960-0760/© 2017 Elsevier Ltd. All rights reserved.

Please cite this article in press as: J. Helle, et al., Effects of the aryl hydrocarbon receptor agonist 3-methylcholanthrene on the 17b-estradiol regulated mRNA transcriptome of the rat uterus, J. Steroid Biochem. Mol. Biol. (2017), http://dx.doi.org/10.1016/j.jsbmb.2017.03.004

G Model SBMB 4904 No. of Pages 11

2

J. Helle et al. / Journal of Steroid Biochemistry & Molecular Biology xxx (2016) xxx–xxx

(ER) signaling. This interaction has been most extensively investigated in breast cancer cells, where ER agonistic and antagonistic effects of a number of AHR ligands have been demonstrated and several mechanisms have been proposed and investigated [6–8]. Among these mechanisms are the downregulation of transcription factors or coregulators necessary for ER signaling. The direct inhibition of the transcription of E2 induced genes by binding of the AHR to inhibitory xenobiotic response elements (XRE) has also been demonstrated as has competition for common coactivators of AHR and ER. In addition the increase of proteasomal degradation of ERa, and the decrease of circulatory E2 levels through the induction of E2 metabolizing enzymes in the liver by AHR activation may also attenuate E2 action [9,10]. Nevertheless, initial evidence for the antiestrogenic effect of the AHR ligand 2,3,7,8-tetrachlorodibenzo-p-dioxin (TCDD) stems from uterotrophic assays, [11–13] showing that treatment with TCDD and other AHR ligands caused a decreased responsiveness of uterine wet weight to E2 and decreased hepatic and uterine ER and PR levels, leading to a diminished activity of the associated pathways. Furthermore antiestrogenic effects of TCDD in the uterus have been shown on a number of additional endpoints like peroxidase activity and EGFR binding activity [14,15]. This suggests that antiestrogenic effects of AHR ligands are of a global nature rather than being limited to the regulation of the expression of a small number of specific genes, but this has not been confirmed to date. We therefore decided to more thoroughly investigate the antiestrogenic effects of AHR ligands in the uterus using the synthetic PAH 3-methylcholanthrene (3-MC) as a model compund. Although 3-MC has a higher carcinogenic potential than most other PAHs like benzo[a]pyrene, it is frequently used in studies investigating AHR signaling due to its well established AHR activating potential [16]. The affinity of 3-MC to the AHR is somewhat lower than that of the prototypical AHR ligand 2,3,7,8Tetrachlordibenzodioxin (TCDD). Its IC50 in a competitive ligand binding assay is about 4fold higher than that of TCDD while the concentration necessary to induce Cyp1a1 mRNA expression is between 10 and 100fold higher [16]. We therefore opted for a much higher treatment dose of 15 mg 3-MC per kg body weight per day than what is usually used for treatment with TCDD. This dose is similar to that used in many other studies of 3-MC as an AHR ligand [17–19]. To gain broader insight into the effects of 3-MC on estrogenic signaling we analyzed uterine mRNA from young adult rats that had been subjected to a standardized 3 day rat uterotrophic assay [20] using a transcriptome based approach. Additional physiological parameters have been measured to gain information on the mode of action of 3-MC.

ovariectomy (OVX) to reduce the endogenous hormonal background. 14 days after surgery the OVX animals were randomized into five groups of six animals each. Two of these groups served as vehicle-treated controls. Animals were housed under defined lighting conditions (12 h light/12 h darkness), constant temperature (20  1  C) and a relative humidity of 50-80 %. The animals had ad libitum access to water and diet (2019 Harlan Teklad standard rodent diet; Harlan Laboratories GmbH, Venray, The Netherlands). 2.3. Uterotrophic assay Animals were subcutaneously treated with the carrier castor oil, 4 mg/kg E2, 15 mg/kg 3-MC or a combination of 4 mg/kg E2 and 15 mg/kg 3-MC daily for a period of three days. The animals were killed by CO2-inhalation after a light anaesthesia by inhaling an O2/CO2-mixture 24 h after the third administration. The uteri were excised and uterine wet weight (UWW) was determined. Uterine tissue was snap frozen in liquid nitrogen for ensuing RNA isolation, or fixed in a 4 % formaldehyde solution (Carl Roth, Karlsruhe/ Germany) for immunohistochemical analysis. 2.4. Histological analysis and immunohistochemistry For histological and immunohistochemical analysis the uterine tissue was cut into 5 mm tissue sections, deparaffinized and rehydrated in a descending xylol and alcohol series. Demasking of the protein epitope was achieved by incubating the tissue sections in Tris-EDTA buffer (pH 9.0) (VWR and AppliChem, Darmstadt/ Germany) at 60  C overnight. Endometrial epithelial height (EEH) was determined from at least three animals per treatment group using photos from DAB stained tissue sections. ImageJ analysis software was used to perform at least 30 measurements of the EEH of each animal. Immunohistochemical stainings were carried out using the IHC Select HRPO/DAB kit from Merck Millipore (Schwalbach, Germany) and specific primary antibodies PA5-27214 for PCNA (1:200), PA1-309 for ERa (1:200) and PA1-311 for ERb (1:1000) (Thermo Fisher Scientific, Braunschweig) were used. Specificity of the ERb antibodies was verified using rat ovary sections, where only granulosa cells were stained and rat liver sections, where no staining was detected. 0.1 M PBS was used for each washing step. The tissue specimens were dehydrated using an ascendant alcohol series and covered with Entellan (Merck, Darmstadt/Germany), photographed and documented (Keyence BZ-8100E, Keyence, Osaka, Japan). For the quantification of PCNA positive epithelial cells three uterine sections from each of the six animals per treatment group and all 12 animals of the vehicle control group were analyzed using ImageJ by determining the percentage of PCNA positive nuclei in each section.

2. Materials and methods 2.5. RNA extraction and mRNA microarrays 2.1. Substances The E2 and 3-MC used for this study were obtained from SigmaAldrich (Hamburg, Germany). 2.2. Animals and diet The experimental procedure and all animal handling followed the ethical standards compiled in the 1964 Declaration of Helsinki and the experimental protocols adhere to the 3R principles of animal welfare. All procedures were performed according to the Institutional Animal Care and Use Committee guidelines, regulated by the German federal law for animal welfare. 30 age-matched adult female Lewis rats obtained from Harlan Laboratories GmbH (Venray, The Netherlands), were subjected to

Total RNA was extracted and genomic DNA was removed using mRNeasy mini kit (Qiagen, Valencia, CA). The quality and the concentrations of total RNA was analyzed using the NanoDrop (Thermo Fisher Scientific, Waltham, MA) and Agilent Bioanalyzer (Agilent Technologies, Santa Clara, CA). Three independent replicates per treatment were concurrently interrogated for changes in mRNA. Total RNA (100 ng), deemed to be of good quality (RIN greater than 8), was processed according to the standard Affymetrix Whole Transcript Sense Target labeling protocol. The fragmented biotinlabeled cDNA was hybridized for 16 h to Affymetrix Gene 1.0 ST arrays and scanned on an Affymetrix Scanner 3000 7G using AGCC software. The resulting CEL files were analyzed for quality using Affymetrix Expression Console software, and imported into

Please cite this article in press as: J. Helle, et al., Effects of the aryl hydrocarbon receptor agonist 3-methylcholanthrene on the 17b-estradiol regulated mRNA transcriptome of the rat uterus, J. Steroid Biochem. Mol. Biol. (2017), http://dx.doi.org/10.1016/j.jsbmb.2017.03.004

G Model SBMB 4904 No. of Pages 11

J. Helle et al. / Journal of Steroid Biochemistry & Molecular Biology xxx (2016) xxx–xxx

GeneSpring GX11.5 (Agilent Technologies). The data was then quantile normalized using PLIER and baseline transformed to the median of the control samples. The probe sets were further filtered to exclude the bottom 20th percentile across all samples. The resulting entity list was subjected to a unpaired T-test with Benjamini-Hochberg False Discovery rate correction and a 1.5 fold filter to identify differentially expressed transcripts between the conditions at a p-value < 0.05. All data is MIAME compliant and the raw data is deposited in Gene Expression Omnibus (GEO, GSE28542) as detailed on the Microarray Gene Expression Data Society (MGED) society website (http://www.mged.org/Workgroups/MIAME/miame.html). 2.6. Quantitative real time PCR First-strand cDNA was synthesized from uterine total RNA from all six animals in each treatment group using M-MLV reverse transcriptase (Promega, Mannheim/Germany) and oligo-(dT)18 primer (Eurogentec, Cologne, Germany and Integrated DNA Technologies, Coralville, Iowa, USA). For the purpose of relative quantification cDNA from the uteri of six animals per treatment group was amplified in duplicate by qPCR in a Biorad CFX96 thermal cylcer (BIO-RAD, Munich/Germany) with SYBR-GreenTM as detection dye (Sigma-Aldrich, Hamburg, Germany). Ribosomal protein S18 (Rps18) was used as an endogenous reference gene. The primer sequences for each gene are listed in Table 1. Optimal combinations of magnesium chloride and primer concentrations were experimentally determined for each qPCR reaction. After an initial denaturation of the cDNA at 95  C, 45 amplification cycles followed with an annealing temperature of 60  C. To check for the correct amplicon the temperature was increased at a rate of 0.5  C/5 s to determine its specific melting point. Relative gene expression was calculated using the DDCt method described by Pfaffl [21]. 2.7. Analysis of E2 metabolism in liver microsomes Microsomes were obtained from liver samples (200 mg) of all 30 rats. Briefly, minced liver was homogenized in TRIS (50 mM)EDTA (1 mM) buffer (pH 7.4) and centrifuged at 9,000g (15 min,

3

4  C). The pellet obtained by ultracentrifugation (100,000g, 60 min, 4  C), was suspended in homogenization buffer and the microsomal fraction was isolated by ultracentrifugation (100,000 g, 60 min, 4  C) and stored at 80  C. Photometric quantification of microsomal protein using Bradford reagent (Bio-Rad, Munich, Germany) was carried out in a 96-well plate format using a filterbased microplate reader at 595 nm (Infinite F200, TECAN, Austria) and bovine serum albumin as calibration standard (20–110 mg/ml). To analyze the E2 metabolism in liver microsomes, 0.2 mM E2 in DMSO (final DMSO concentration 1% v/v) was incubated with NADPH (provided by a NADPH generating system with 1.2 mM NADP, 9.4 mM isocitrate, 4.2 mM MgCl, and 0.5 U isocitrate dehydrogenase) and 62.5 mg microsomal protein in buffer (pH 7.4) at 37  C for 10–60 min. After addition of the internal standard and extraction of the analytes with ethyl acetate, the evaporated organic phase was reconstituted in methanol and analyzed by HPLC-UV (280 nm, Agilent Technologies 1200 Series HPLC-System, Waldbronn, Germany). Further details on HPLC method can be found in Supplement Fig. 1. Since linear decrease of E2 peak area was observed after incubation for 30 min, this time point was chosen for monitoring the hydroxylation of E2 to the main metabolites 2- and 4-hydroxyestradiol (2/4-HO-E2) via liver cytochrome P450-dependent monooxygenase activity. 2.8. Statistics For gene expression analysis, UWW, EEH and PCNA staining data was first tested for normal distribution using the ShapiroWilk test. If normality was not rejected, Tukey’s Test was applied to calculate p values. In case normality was rejected, the KruskalWallis Test was used. Significance was assumed at p < 0.05. 3. Results To examine the effects of E2 as well as those of 3-MC on E2 signaling in the rat uterus we performed a standard 3d uterotrophic assay, in which ovariectomized young adult Lewis rats were treated with either castor oil, 4 mg/kg E2, 15 mg/kg 3-MC or a combination of E2 and 3-MC. 3.1. Effects of E2 and 3-MC on uterine proliferation

Table 1 Primer sequences for gene expression analysis using qPCR. Transcript

Primers

Amplicon size

Esr1

fwd TGA AGC ACA AGC GTC AGA GAG AT Rev AGA CCA GAC CAA TCA TCA GGA T fwd CTA CAG AGA GAT GGT CAA AAG TGG A rev GGG CAA GGA GAC AGA AAG TAA GT fwd TAT GCT GTG TGC TGG TTT CG rev GTA GAC GCT GAC ATT GGT GTA AA fwd CAC GGA GAC AAC TTC CCA TT rev GAG TGA CCC AGA CCC AGA GA fwd TGA AGA GGC TGG TGG ATA CC rev TTG GTG TAG GGA GGT CAA GG fwd AAT CAA GGC TGC GTC TCA AG rev TGA CCA CAA TCA CCA CAT TCA fwd GCG TTC CCA AAC CTG AAG rev TCT CCT AAA GCC ACC CTG TC fwd GAG CCC CTG CTT CCA GA rev GGT CTT CCT CCA AAC TTC TTC A fwd GGCTGGAGAAGGACTGTTCA rev GTCATCAAGGTCAAGGCAGAG fwd ACA GCC TTC CCG GGA GCA TCA ACA rev AGC GCA CCA CAG GAG GCA CAG AGT C fwd CCC TCC AGT CCA AGA TGC TCA ACA C rev CCA TGC GGC TTT TCC TGC GGT ATT C fwd CGT GAA GGA TGG GAA GTA TAG C rev TAT TAA CAG CAA AGG CCC AAA G

382

Esr2 Prss32 Mmp7 Scgb1a1 Cuzd1 Gstm7 Gulo Them5 C3 Clu Rps18

215 172 188 185 169 155 129 128 275 302 218

UWW of OVEX animals is increased approximately 5 fold in response to E2 treatment but remains unchanged in the 3-MC treated animals compared to the vehicle treated control animals. Coadministration of 3-MC does not significantly inhibit the E2 induced UWW increase. (Fig. 1A) EEH is often used as a more sensitive parameter for estrogen induced uterotrophic effects than UWW [22]. E2 treatment leads to an approximately 3.5-fold increase of EEH compared to the EHH of control animals (Fig. 1B). 3-MC alone also has no significant effect on EEH, but partially inhibits the E2 induced increase of EEH when coadministered. PCNA is a proliferation marker that indicates mitotically active cells. In the luminal epithelium E2 treatment leads to a strong increase in the number of PCNA positive nuclei from approximately 5% to 60% (Fig. 1C). 3-MC does not stimulate PCNA expression if applied alonem, and does not inhibit the E2-induced response in the combinatorial setting. 3.2. Regulation of uterine gene expression Based on Affymetrix Gene 1.0 ST arrays we demonstrate that 1356 entities are more than 1.5 fold upregulated following 3 days of E2 treatment. Additional treatment with 3-MC partially or completely inhibits this effect in 1238 of these entities (91,3%).

Please cite this article in press as: J. Helle, et al., Effects of the aryl hydrocarbon receptor agonist 3-methylcholanthrene on the 17b-estradiol regulated mRNA transcriptome of the rat uterus, J. Steroid Biochem. Mol. Biol. (2017), http://dx.doi.org/10.1016/j.jsbmb.2017.03.004

G Model SBMB 4904 No. of Pages 11

4

J. Helle et al. / Journal of Steroid Biochemistry & Molecular Biology xxx (2016) xxx–xxx

Fig. 1. 3-MC slightly inhibits the E2 induced increase of the endometrial epithelial height but not the overall uterotrophic effect of E2. Uterus wet weight (A), endometrial epithelial height (B) and PCNA positive nuclei of the endometrial epithelium (C) following a standard 3 day young adult rat uterotrophic assay. Treatment doses were 4 mg/kg/ d E2 and 15 mg/kg/d 3-MC. Different letters indicate statistically significant differences between treatment groups. (p < 0.05).

Fig. 2. 3-MC partially inhibits the transcriptional regulation of most of the E2 regulated genes in the rat uterus. A) Expression fold changes of all entities significantly and at least 1.5-fold regulated following treatment with E2 as determined by microarray (n = 3). B) Inhibitory effect of 3-MC on E2 regulated gene expression.

E2 treatment leads to a downregulation of the expression of 1134 entities. In 1033 entities (91.1%) 3-MC attenuates this effect (Fig. 2, GEO data series GSE95783). 3-MC treatment alone has minimal effect on uterine gene expression. Only 19 entities are upregulated in the uterus following 3-MC treatment. Of these only C3 is upregulated more than 2fold and this upregulation is probably due to the slight affinity of 3-MC to ERa since C3 is very strongly estrogen responsive [23].

Downregulation by 1.5 fold or more following 3-MC treatment was observed in 6 entities including the adiponectin gene Adipoq, the gene for the adult chain 1 of alpha hemoglobin Hba-a1, and the thyroid hormone-inducible hepatic protein gene Thrsp. The expression pattern of a number of very strongly E2 regulated genes was verified using qPCR (Fig. 3). According to these results Prss32 expression is approximately 4000-fold upregulated in the rat uterus following E2 treatment. Uterine Mmp7 and Cuzd1

Please cite this article in press as: J. Helle, et al., Effects of the aryl hydrocarbon receptor agonist 3-methylcholanthrene on the 17b-estradiol regulated mRNA transcriptome of the rat uterus, J. Steroid Biochem. Mol. Biol. (2017), http://dx.doi.org/10.1016/j.jsbmb.2017.03.004

G Model SBMB 4904 No. of Pages 11

J. Helle et al. / Journal of Steroid Biochemistry & Molecular Biology xxx (2016) xxx–xxx

5

Fig. 3. qPCR based verification of the microarray results confirms the inhibitory effect of 3-MC on the transcriptional regulation by E2. Diagrams show average relative expression levels of each treatment group (n = 6). Error bars indicate the standard deviation. Different letters indicate significantly different expression between these treatment groups (p < 0.05). A) Genes most strongly upregulated by E2 in the rat uterus according to microarray. B) Genes most strongly downregulated by E2 in the rat uterus.

expression is more than 2000-fold upregulated following three days of E2 treatment and Scgb1a1 expression is more than 1000fold upregulated under the same conditions. While expression of Gulo is downregulated below the detection limit following E2

treatment, Gstm7 expression is approximately 90-fold downregulated. Furthermore our results show that all these E2 dependent changes in expression are partially inhibited by additional 3-MC treatment.

Please cite this article in press as: J. Helle, et al., Effects of the aryl hydrocarbon receptor agonist 3-methylcholanthrene on the 17b-estradiol regulated mRNA transcriptome of the rat uterus, J. Steroid Biochem. Mol. Biol. (2017), http://dx.doi.org/10.1016/j.jsbmb.2017.03.004

G Model SBMB 4904 No. of Pages 11

6

J. Helle et al. / Journal of Steroid Biochemistry & Molecular Biology xxx (2016) xxx–xxx

3.3. 3-MC mediated inhibiton of E2 dependent regulation of molecular pathways Pathway analysis using GeneSpring Pathway Architect revealed that prostaglandin biosynthesis and its regulation represents the pathway most strongly affected by 3 days of E2 treatment with 7 out of 31 considered entities regulated and a p value of 4.82E-6 (Fig. 4). Additional treatment with 3-MC leads to a less pronounced regulation of expression of members of this pathway at a much reduced level of significance with only 3 of 31 genes being regulated (p = 0.003). Other strongly E2 regulated pathways are complement and coagulation cascades (8 out of 62 at p = 2.38E-05, 6 of 62 at p = 1.32E-05 following additional 3-MC treatment), retinol metabolism (6 of 38, p = 1.68E-04, 3 of 38 with p = 0.005 following additional 3-MC treatment), glutathione metabolism (3 of 21, 8.78E-04, this regulation was completely blocked following additional 3-MC treatment) and biotransformation with a slightly lower percentage of E2 regulated genes but a very low p-value due to the high number of genes included in this metapathway (10 of 143, p = 9.72E-04 and 6 of 104 at p = 0.002 following additional 3-MC treatment). The complete list (p < 0.05) is shown in Table 2. 3.4. Mechanisms of AHR mediated antiestrogenicity As outlined in the introduction there are a number of mechanisms by which the antiestrogenic effects of AHR ligands may be mediated. One possibility is the potential downregulation of ERa or ERb by AHR ligands in the uterus. No significant changes in Esr1 mRNA expression following treatment with 3-MC were detected either in the absence or presence of E2 (Fig. 5A). The

apparent increase in uterine Esr1 expression following E2 treatment is not statistically significant. The mRNA expression of Esr2 has not significantly changed in any of the treatment groups either, but in tendency it is increased by 3-MC alone and in combination with E2 when compared to the vehicle control or the E2 treated animals respectively (Fig. 5C). Both receptors ERa and ERb are predominantly expressed in the endometrial epithelium (EE), but ERb appears to be more abundant in the glandular than in the luminal epithelium. Both receptors can also be observed in all other tissue compartments of the uterus. (Fig. 5B and D) E2 treatment leads to a reduction of ERa protein, especially in the EE (Fig. 5B, top vs. bottom), while the effect of 3-MC on ERa is low, possibly slightly increasing ERa levels in the EE. Unlike with ERa, 3-MC treatment leads to an increase in ERb in all uterine tissue compartments, most notably in the EE, while E2 treatment has a negligible effect on uterine protein levels of ERb. (Fig. 5D, left vs. right). In addition we investigated the 3-MC dependent regulation of E2 metabolism in the liver. Because endogenous E2 production was curtailed by ovariectomy and the last E2 injection was performed 24 h before the animals were killed no E2 was detectable in the plasma. Therefore this hypothesis could not be tested by direct means. Instead microsomes from cryopreserved liver samples were incubated with E2. For this a time course of E2 metabolism was determined that shows a nearly linear decrease in the measured E2 levels up to 30 min after the addition of E2 to the microsomes (data not shown). Hence the 30 min time point was chosen for further experiments. Treatment of the animals with E2 and/or 3-MC has no significant effect on the E2 concentration at the end of the 30 min incubation period. E2 and 3-MC treatment

Fig. 4. E2 regulated members of the prostaglandin synthesis and regulation pathway. (Adapted from wikipathways.org).

Please cite this article in press as: J. Helle, et al., Effects of the aryl hydrocarbon receptor agonist 3-methylcholanthrene on the 17b-estradiol regulated mRNA transcriptome of the rat uterus, J. Steroid Biochem. Mol. Biol. (2017), http://dx.doi.org/10.1016/j.jsbmb.2017.03.004

G Model SBMB 4904 No. of Pages 11

J. Helle et al. / Journal of Steroid Biochemistry & Molecular Biology xxx (2016) xxx–xxx

7

Table 2 Pathways most strongly regulated by E2 in the rat uterus sorted by the percentage of E2-regulated members. E2 regulated pathways in the rat uterus

number of entities number (percentage) of entities in in pathway pathway regulated by E2

P value

number (percentage) of entities in pathway for which the effect of E2 is repressed by coadministration of 3-MC

Prostaglandin Synthesis and Regulation Estrogen metabolism Complement Activation Retinol metabolism

31

7 (23)

4 (57)

14 16 38

3 (21) 3 (19) 6 (16)

Oxidative Stress Glutathione metabolism

27 21

4 (15) 3 (14)

Cholesterol Biosynthesis Complement and Coagulation Cascades Interactions between CFTR and other ion channels p53 pathway Folic Acid Network Inflammatory Response Pathway Selenium metabolism Selenoproteins Cardiovascular Signaling TGF Beta Signaling Pathway metapathway biotransformation

15 62

2 (13) 8 (13)

8

1 (13)

4,82E06 0,003 0,004 1,68E04 0,003 8,78E04 0,039 2,38E05 0,045

46 29 30

5 (11) 3 (10) 3 (10)

0,004 0,016 0,023

2 (40) 1 (33) 1 (33)

42

4 (10)

0,011

4 (100)

38 51 143

3 (8) 4 (8) 10 (7)

0,048 3 (100) 0,023 4 (100) 9,72E- 4 (40) 04

also doesn’t significantly change the amounts of 2-OH-E2 and 4OH-E2 produced by the liver microsomes (supplemental Fig. 1). 4. Discussion PAHs are widespread persistent toxins that have profound effects on uterine physiology. Here we investigated the impact of 3MC as a model compound for PAHs on estrogen induced transcriptional changes in the uterus in a rat 3-day uterotrophic assay. There are two major questions that have been addressed in this study. First, we have investigated the effects of estradiol on uterine gene expression on a transcriptome wide level in a standard rat three day uterotrophic assay and identified a large number of estradiol regulated genes and pathways. Second we investigated the impact of a co-treatment with the PAH 3-MC in the uterus on E2 induced changes in gene expression and physiological parameters. 4.1. Effects of E2 on uterine gene expression Several efforts to identify the estrogen regulated mRNA transcriptome in the rodent uterus under varying conditions and in comparison to numerous substances have already been undertaken [24–31]. However this is the first study to look at E2 induced changes in the mRNA transcriptome in the uterus of rats treated in a standard 3 day uterotrophic assay. Since this assay is widely used, data on potentially regulated genes and pathways are of great value and relevance for future experiments to enable the selection of targets relevant for the respective study. In this context, data from additional organs would also be of interest and we have in fact also recently published microarray data from mammary glands of the same animals [32]. In line with the fundamental role of E2 in the uterus, the number of E2 regulated genes identified in the uterus is much higher than in the mammary glands. Verification using qPCR in this study as well as in another one from our lab [33] showed that using microarray technology, changes in gene expression are usually

1 (33) 1 (33) 3 (50) 4 (100) 3 (100) 2 (100) 2 (25) 1 (100)

compressed and therefore underestimated. This has also been confirmed by other studies [34,35]. We can therefore assume, that the number of false positives is low and most of the identified genes are truly E2 regulated and the number of E2 regulated genes may actually be even higher than the microarray results suggest. This is underscored by the qPCR data confirming E2 dependent expression of a number of AHR battery genes (data not shown) that were previously shown to be E2 regulated in the rat uterus [36–38], even though they were not identified as E2 regulated in the microarray experiment of this particular study. While most of the E2 regulated genes in the mammary gland are associated with proliferation and cell cycle control, the E2 regulated pathways in the uterus cover a much wider range. We identified prostaglandin synthesis and regulation as the most strongly regulated pathway (Table 2, Fig. 4). Prostaglandins are essential in mediating inflammatory processes among others. Immunity and particularly inflammation as part of the innate immune response play important roles in normal ovarian and uterine function like estrous and menstrual cycles, implantation, placentation and fetal development, as well as in the response to infection by microbes. On the other hand the uterine immune system needs to tolerate allogeneic spermatozoa and the immunologically distinct fetus. It is therefore not surprising that we found prostaglandin biosynthesis to be tightly regulated by E2. When looking at the particular genes of this pathway that are affected by E2 treatment, it becomes apparent that in general inhibiting factors are upregulated. The most striking example is the highly E2 dependently expressed Scgb1a1, which encodes for uteroglobin, also known as Clara cell 10 kDa protein (CC10). Uteroglobin is known to be strongly anti-inflammatory and probably a key factor in suppressing rejection of mammalian fetuses by the maternal immune system [39,40]. It acts by repressing arachidonic acid release through the inhibition of phospholipase A2 activity [41]. Furthermore, Ptgs1 and Ptgs2, which encode for cyclooxygenase 1 and cyclooxygenase 2 respectively and which catalyze the formation of PGH2 from arachidonic acid are downregulated by E2. Upregulation of thromboxane synthase mRNA expression may help to maintain

Please cite this article in press as: J. Helle, et al., Effects of the aryl hydrocarbon receptor agonist 3-methylcholanthrene on the 17b-estradiol regulated mRNA transcriptome of the rat uterus, J. Steroid Biochem. Mol. Biol. (2017), http://dx.doi.org/10.1016/j.jsbmb.2017.03.004

G Model SBMB 4904 No. of Pages 11

8

J. Helle et al. / Journal of Steroid Biochemistry & Molecular Biology xxx (2016) xxx–xxx

Fig. 5. While E2 downregulates ERa protein levels in the rat uterus, 3-MC upregulates ERb mRNA expression as well as protein levels. Data show qPCR based gene expression analysis of the Esr1 (A) and Esr2 (C) genes and the corresponding immunohistochemical stainings of ERa (B) and ERb (D) in uterine cross sections.

stable thromboxane levels despite the downregulation of Ptgs1/2. Prostaglandin signaling is also reduced by E2 through downregulation of the prostaglandin receptor mRNAs Ptger3 and Ptgfr. E2 treatment also downregulates the mRNA that encodes for CBP1 which catalyzes the conversion from PGE2 to PGF2a. PGF2a therefore appears to be the prostaglandin most affected in its production by E2. However, the impact of E2 on uterine PGF2a has so far only been measured in ruminants, where either no effect or an increase of PGF2a in response to E2 could be measured depending on the highly variable experimental settings [42]. PGF2a is involved in several reproductive functions including stimulation of luteolysis which leads to a decrease in progesterone production [43]. Importantly PGF2a is also a key factor in the

initiation of labor because it leads to the induction of oxytocin (OT) receptor expression at term. This increase in OT receptor expression causes a marked increase in uterine sensitivity to OT. Through this OT initiates uterine contractions even though OT concentration remains constant [44]. Therefore downregulation of PGF2a production by E2 may be important for maintaining pregnancy by preventing preterm labor. 4.2. Effects of 3-MC on uterine E2 signaling The antiestrogenic potential of AHR ligands has been known for a long time and numerous studies have shown that antiestrogenicity appears to be a common feature of most, if not all AHR

Please cite this article in press as: J. Helle, et al., Effects of the aryl hydrocarbon receptor agonist 3-methylcholanthrene on the 17b-estradiol regulated mRNA transcriptome of the rat uterus, J. Steroid Biochem. Mol. Biol. (2017), http://dx.doi.org/10.1016/j.jsbmb.2017.03.004

G Model SBMB 4904 No. of Pages 11

J. Helle et al. / Journal of Steroid Biochemistry & Molecular Biology xxx (2016) xxx–xxx

ligands [45,46]. Nevertheless, the extent of the effects of PAHs on uterine gene expression as a whole has not been demonstrated so far. Here we show for the first time that this antiestrogenicity is nearly universal regarding uterine gene expression with more than 90% of all E2 regulated mRNAs in the rat uterus being inhibited by additional 3-MC treatment. In a previous study we have also demonstrated that 3-MC inhibits E2 dependent regulation of gene expression in more than 40% of all E2 target genes in the mammary gland of the same animals as well [32]. Surprisingly this does not translate into equally large effects regarding the overall uterotrophic response. Only the E2 induced increase in EEH is partially inhibited by 3-MC while UWW and the fraction of PCNA positive, mitotic nuclei in the EE are not affected. PAHs from cigarette smoke [2,3] as well as from car exhausts [4] have been associated with preterm birth. The gene expression data presented here show that prostaglandin biosynthesis and regulation and especially the biosynthesis of labor inducing PGF2a is tightly controlled by E2 with estrogen dependent expression of Scgb1a1 being a key factor for this control. This study clearly shows that 3-MC inhibits the suppression of this pathway, suggesting that PAH induced preterm birth may be due to an increase in uterine PGF2a as a consequence of PAH antiestrogenicity which then leads to an increase in OT receptor expression and consequently a higher sensitivity to OT [44]. However this will have to be investigated in detail in a suitable model for pregnancy which also factors in the effects of progesterone. The broad antiestrogenic effect of 3-MC cannot be explained by gene specific mechanisms like inhibitory XREs [47], but there are a number of more general mechanisms that may be acting in concert resulting in the observed, mostly target independent antiestrogenicity. Many AHR ligands, among them 3-MC, have been shown to directly interact with ERs [48,49]. In the case of 3-MC this interaction is very weak but measurable. This affinity to both ERs may lead to an activation of ERs in some tissues but antagonistic effects in others. Notably in mammary gland derived HC11 cells, 3-MC acts as an AHR independent ERa antagonist [23]. On the other hand TCDD displays similar antiestrogenic properties even though its affinity to ERa and ERb is even lower and it is usually tested at much lower concentrations due to its persistency. It is therefore likely that additional mechanisms are involved in mediating the antiestrogenic response of AHR ligands in general and PAHs like 3-MC specifically. In this study several of these putative mechanisms that may be responsible for this inhibition of E2 dependent regulation of gene expression were explored. One of them is the induction of E2 metabolism by AHR ligands by increasing the amount of CYP1A1 and CYP1B1 in the liver via an XRE dependent upregulation of mRNA expression [50,51]. Because the last treatment was 24 h before dissecting the animals, plasma levels of E2 were too low to be measured and compared. We therefore opted to prepare microsomes from the livers of all test animals and assessed their potential to metabolize E2 in vitro. Since the treatment of the animals affected neither the residual E2 concentration nor the formation of the two major metabolites 2-OH-E2 and 4-OH-E2, we conclude that the antiestrogenic effect of 3-MC is not due to induction of E2 metabolism in the liver. Secondly, it is possible that 3-MC affects the levels of ERa and ERb in the uterus and in the EE in particular which may alter the uterine response to E2. However our microarray and qPCR data show that Esr1 expression is not significantly regulated on the level of mRNA transcription. However, AHR has been identified as a component of a cullin 4B ubiquitin ligase complex [52], and in breast cancer cell lines activation of the AHR by 3-MC and other ligands of the receptor results in ubiquitinylation and proteasomal degradation of the ER and other steroid receptors [53]. This decrease of ERa has also been observed in the mammary glands of

9

those animals used in this study [32]. Nevertheless, this does not seem to be the case in the uterus where 3-MC leads to a slight increase in ERa levels (Fig. 5B). Since E2 treatment reduced uterine ERa levels this resembles the general E2 antagonistic effect of 3-MC, but it is obviously not its cause. Both, qPCR and IHC results, demonstrate that, unlike in breast cancer cell lines, 3-MC treatment also leads to an increase in uterine ERb especially in the EE. ERb is known to attenuate ERa induced gene expression, an effect known as the Yin Yang principle [54]. It is therefore possible that the observed increase of ERb in the EE, even though relatively small, contributes to the antiestrogenic effect of 3-MC in the uterus, adding one more putative mechanism for the antiestrogenic properties of AHR ligands. 4.3. Conclusions Our data give a detailed account of the in vivo effects of E2 and 3-MC on gene expression and physiological parameters of the rat uterus. They demonstrate that AHR ligands like 3-MC are antiestrogenic with regard to most E2 regulated genes in the uterus including those belonging to the tightly controlled prostaglandin biosynthesis pathway which is important for maintaining pregnancies. This could help to explain why PAH containing cigarette smoke and exhaust fumes lead to an increase in the incidence of preterm birth. Almost no E2 independent effects of 3-MC on gene expression could be observed. This indicates that interaction with ERs is the predominant mode of action of AHR in the uterus. We could identify an increase in ERb in all uterine tissue compartments, but especially in the EE as another putative mechanism by which 3-MC and possibly other PAHs inhibit estrogen induced effects in vivo.

Ethical standards and conflicts of interest This manuscript does not contain clinical studies or patient data. The authors declare that they have no conflict of interest. Acknowledgements This work was supported by the German Research Foundation (Deutsche Forschungsgemeinschaft, DFG) grant number KR3768/ 2-1. Appendix A. Supplementary data Supplementary data associated with this article can be found, in the online version, at http://dx.doi.org/10.1016/j. jsbmb.2017.03.004. References [1] C. Dechanet, T. Anahory, J.C.M. Daude, X. Quantin, L. Reyftmann, S. Hamamah, B. Hedon, H. Dechaud, Effects of cigarette smoking on reproduction, Hum. Reprod. Update 17 (2011) 76–95, doi:http://dx.doi.org/10.1093/humupd/ dmq033. [2] Y. Miyake, K. Tanaka, M. Arakawa, Active and passive maternal smoking during pregnancy and birth outcomes: the Kyushu Okinawa Maternal and Child Health Study, BMC Pregnancy Childbirth 13 (157) (2013), doi:http://dx.doi.org/ 10.1186/1471-2393-13-157. [3] J. Qiu, X. He, H. Cui, C. Zhang, H. Zhang, Y. Dang, X. Han, Y. Chen, Z. Tang, H. Zhang, H. Bai, R. Xu, D. Zhu, X. Lin, L. Lv, X. Xu, R. Lin, T. Yao, J. Su, X. Liu, W. Wang, Y. Wang, B. Ma, S. Liu, H. Huang, C. Lerro, N. Zhao, J. Liang, S. Ma, R.A. Ehrenkranz, Q. Liu, Y. Zhang, Passive smoking and preterm birth in urban China, Am. J. Epidemiol. 180 (2014) 94–102, doi:http://dx.doi.org/10.1093/aje/ kwu092. [4] M. Wilhelm, J.K. Ghosh, J. Su, M. Cockburn, M. Jerrett, B. Ritz, Traffic-related air toxics and preterm birth: a population-based case-control study in Los Angeles county, California, Environ. Health 10 (89) (2011), doi:http://dx.doi. org/10.1186/1476-069x-10-89.

Please cite this article in press as: J. Helle, et al., Effects of the aryl hydrocarbon receptor agonist 3-methylcholanthrene on the 17b-estradiol regulated mRNA transcriptome of the rat uterus, J. Steroid Biochem. Mol. Biol. (2017), http://dx.doi.org/10.1016/j.jsbmb.2017.03.004

G Model SBMB 4904 No. of Pages 11

10

J. Helle et al. / Journal of Steroid Biochemistry & Molecular Biology xxx (2016) xxx–xxx

[5] K.M. Dolwick, J.V. Schmidt, L.A. Carver, H.I. Swanson, C.A. Bradfield, Cloning and expression of a human Ah receptor cDNA, Mol. Pharmacol. 44 (1993) 911– 917. [6] S. Safe, M. Wormke, I. Samudio, Mechanisms of inhibitory aryl hydrocarbon receptor-estrogen receptor crosstalk in human breast cancer cells, J. Mammary Gland Biol. Neoplasia 5 (2000) 295–306. [7] F. Ohtake, K. Takeyama, T. Matsumoto, H. Kitagawa, Y. Yamamoto, K. Nohara, C. Tohyama, A. Krust, J. Mimura, P. Chambon, J. Yanagisawa, Y. Fujii-Kuriyama, S. Kato, Modulation of oestrogen receptor signalling by association with the activated dioxin receptor, Nature 423 (2003) 545–550, doi:http://dx.doi.org/ 10.1038/nature01606. [8] J.M. Shipley, D.J. Waxman, Aryl hydrocarbon receptor-independent activation of estrogen receptor-dependent transcription by 3-methylcholanthrene, Toxicol. Appl. Pharmacol. 213 (2006) 87–97, doi:http://dx.doi.org/10.1016/j. taap.2005.09.011. [9] S. Safe, M. Wormke, Inhibitory aryl hydrocarbon receptor-estrogen receptor a cross-talk and mechanisms of action, Chem. Res. Toxicol. 16 (2003) 807–816, doi:http://dx.doi.org/10.1021/tx034036r. [10] E. Swedenborg, I. Pongratz, AhR and ARNT modulate ER signaling, Toxicology 268 (2010) 132–138, doi:http://dx.doi.org/10.1016/j.tox.2009.09.007. [11] M. Romkes, J. Piskorska-Pliszczynska, S. Safe, Effects of 2,3,7,8tetrachlorodibenzo-p-dioxin on hepatic and uterine estrogen receptor levels in rats, Toxicol. Appl. Pharmacol. 87 (1987) 306–314. [12] M. Romkes, S. Safe, Comparative activities of 2,3,7,8-tetrachlorodibenzo-pdioxin and progesterone as antiestrogens in the female rat uterus, Toxicol. Appl. Pharmacol. 92 (1988) 368–380. [13] B. Astroff, S. Safe, Comparative antiestrogenic activities of 2,3,7,8tetrachlorodibenzo-p-dioxin and 6-methyl-1,3,8-trichlorodibenzofuran in the female rat, Toxicol. Appl. Pharmacol. 95 (1988) 435–443. [14] B. Astroff, S. Safe, 2,3,7,8-Tetrachlorodibenzo-p-dioxin as an antiestrogen: effect on rat uterine peroxidase activity, Biochem. Pharmacol. 39 (1990) 485–488. [15] B. Astroff, S. Safe, 6-Alkyl-1,3,8-trichlorodibenzofurans as antiestrogens in female Sprague-Dawley rats, Toxicology 69 (1991) 187–197. [16] D.S. Riddick, Y. Huang, P.A. Harper, A.B. Okey, 2,3,7,8-Tetrachlorodibenzo-pdioxin versus 3-methylcholanthrene: comparative studies of Ah receptor binding, transformation, and induction of CYP1A1, J. Biol. Chem. 269 (1994) 12118–12128. [17] M. Göttlicher, P. Cikryt, Induction of the aromatic hydrocarbon receptor by trans-4-acetylaminostilbene in rat liver. Comparison with other aromatic amines, Carcinogenesis 8 (1987) 1021–1023. [18] S.R. Kondraganti, K. Muthiah, W. Jiang, R. Barrios, B. Moorthy, Effects of 3methylcholanthrene on gene expression profiling in the rat using cDNA microarray analyses, Chem. Res. Toxicol. 18 (2005) 1634–1641, doi:http://dx. doi.org/10.1021/tx050085n. [19] S. Deb, S.M. Bandiera, Characterization of a new cytochrome P450 enzyme, CYP2S1, in rats: its regulation by aryl hydrocarbon receptor agonists, Toxicology 267 (2010) 91–98, doi:http://dx.doi.org/10.1016/j.tox.2009.10.025. [20] J. Kanno, L. Onyon, J. Haseman, P. Fenner-Crisp, J. Ashby, W. Owens, The OECD program to validate the rat uterotrophic bioassay to screen compounds for in vivo estrogenic responses: phase 1, Environ. Health Perspect. 109 (2001) 785– 794. [21] M.W. Pfaffl, A new mathematical model for relative quantification in real-time RT-PCR, Nucleic Acids Res. 29 (2001) (e45). [22] P. Diel, S. Schmidt, G. Vollmer, In vivo test systems for the quantitative and qualitative analysis of the biological activity of phytoestrogens, J. Chromatogr. B Analyt. Technol. Biomed. Life Sci. 777 (2002) 191–202. [23] E. Swedenborg, J. Rüegg, A. Hillenweck, S. Rehnmark, M.H. Faulds, D. Zalko, I. Pongratz, K. Pettersson, 3-Methylcholanthrene displays dual effects on estrogen receptor (ER) alpha and ER beta signaling in a cell-type specific fashion, Mol. Pharmacol. 73 (2008) 575–586, doi:http://dx.doi.org/10.1124/ mol.107.036384. [24] S.C. Hewitt, B.J. Deroo, K. Hansen, J. Collins, S. Grissom, C.A. Afshari, K.S. Korach, Estrogen receptor-dependent genomic responses in the uterus mirror the biphasic physiological response to estrogen, Mol. Endocrinol. 17 (2003) 2070– 2083, doi:http://dx.doi.org/10.1210/me.2003-0146. [25] K.C. Fertuck, J.E. Eckel, C. Gennings, T.R. Zacharewski, Identification of temporal patterns of gene expression in the uteri of immature, ovariectomized mice following exposure to ethynylestradiol, Physiol. Genomics 15 (2003) 127–141, doi:http://dx.doi.org/10.1152/ physiolgenomics.00058.2003. [26] J.G. Moggs, J. Ashby, H. Tinwell, F.L. Lim, D.J. Moore, I. Kimber, G. Orphanides, The need to decide if all estrogens are intrinsically similar, Environ. Health Perspect. 112 (2004) 1137–1142, doi:http://dx.doi.org/10.1289/ehp.7028. [27] J.G. Moggs, H. Tinwell, T. Spurway, H.-S. Chang, I. Pate, F.L. Lim, D.J. Moore, A. Soames, R. Stuckey, R. Currie, T. Zhu, I. Kimber, J. Ashby, G. Orphanides, Phenotypic anchoring of gene expression changes during estrogen-Induced uterine growth, Environ. Health Perspect. 112 (2004) 1589–1606 (10.1289/ txg.7345). [28] S.C. Hewitt, J. Collins, S. Grissom, K. Hamilton, K.S. Korach, Estren behaves as a weak estrogen rather than a nongenomic selective activator in the mouse uterus, Endocrinology 147 (2006) 2203–2214, doi:http://dx.doi.org/10.1210/ en.2005-1292. [29] M. Ivanga, Y. Labrie, E. Calvo, P. Belleau, C. Martel, V. Luu-The, J. Morissette, F. Labrie, F. Durocher, Temporal analysis of E2 transcriptional induction of PTP and MKP and downregulation of IGF-I pathway key components in the mouse

[30]

[31]

[32]

[33]

[34]

[35]

[36]

[37]

[38]

[39]

[40]

[41] [42]

[43]

[44]

[45]

[46]

[47]

[48]

[49]

[50]

[51]

uterus, Physiol. Genomics 29 (2007) 13–23, doi:http://dx.doi.org/10.1152/ physiolgenomics.00291.2005. R.R. Newbold, W.N. Jefferson, S.F. Grissom, E. Padilla-Banks, R.J. Snyder, E.K. Lobenhofer, Developmental exposure to diethylstilbestrol alters uterine gene expression that may Be associated with uterine neoplasia later in life, Mol. Carcinog. 46 (2007) 783–796, doi:http://dx.doi.org/10.1002/mc.20308. W. Winuthayanon, S.C. Hewitt, K.S. Korach, Uterine epithelial cell estrogen receptor alpha-dependent and –independent genomic profiles that underlie estrogen responses in mice, Biol. Reprod. 91 (110) (2014), doi:http://dx.doi. org/10.1095/biolreprod.114.120170. J. Helle, M.I. Bader, A.M. Keiler, O. Zierau, G. Vollmer, S.V. Chittur, M. Tenniswood, G. Kretzschmar, Cross-talk in the female rat mammary gland: influence of aryl hydrocarbon receptor on estrogen receptor signaling, Environ. Health Perspect. (2015), doi:http://dx.doi.org/10.1289/ehp.1509680. D.A.M. Amer, G. Kretzschmar, N. Müller, N. Stanke, D. Lindemann, G. Vollmer, Activation of transgenic estrogen receptor-beta by selected phytoestrogens in a stably transduced rat serotonergic cell line, J. Steroid Biochem. Mol. Biol. 120 (2010) 208–217, doi:http://dx.doi.org/10.1016/j.jsbmb.2010.04.018. T. Yuen, E. Wurmbach, R.L. Pfeffer, B.J. Ebersole, S.C. Sealfon, Accuracy and calibration of commercial oligonucleotide and custom cDNA microarrays, Nucleic Acids Res. 30 (2002) e48, doi:http://dx.doi.org/10.1093/nar/30.10.e48. S. Draghici, P. Khatri, A.C. Eklund, Z. Szallasi, Reliability and reproducibility issues in DNA microarray measurements, Trends Genet. 22 (2006) 101–109, doi:http://dx.doi.org/10.1016/j.tig.2005.12.005. G. Kretzschmar, A. Papke, O. Zierau, F.J. Möller, S. Medjakovic, A. Jungbauer, G. Vollmer, Estradiol regulates aryl hydrocarbon receptor expression in the rat uterus, Mol. Cell. Endocrinol. 321 (2010) 253–257, doi:http://dx.doi.org/ 10.1016/j.mce.2010.02.018. F. Rataj, F.J. Möller, M. Jähne, O. Zierau, P. Diel, G. Vollmer, G. Kretzschmar, Regulation of uterine AHR battery gene expression by 17b-estradiol is predominantly mediated by estrogen receptor, Arch. Toxicol. 86 (2012) 1603– 1612, doi:http://dx.doi.org/10.1007/s00204-012-0870-y. F. Rataj, F.J. Möller, M. Jähne, P. Hönscheid, O. Zierau, G. Vollmer, G. Kretzschmar, Progesterone, as well as 17b-estradiol, is important for regulating AHR battery homoeostasis in the rat uterus, Arch Toxicol1 -12 (2014) 2, doi:http://dx.doi.org/10.1007/s00204-014-1261-3. A.B. Mukherjee, K. Laki, A.K. Agrawal, Possible mechanism of success of an allotransplantation in nature: mammalian pregnancy, Med. Hypotheses 6 (1980) 1043–1055, doi:http://dx.doi.org/10.1016/0306-9877(80)90017-1. A.B. Mukherjee, G.C. Kundu, G. Mantile-Selvaggi, C.-J. Yuan, A.K. Mandal, S. Chattopadhyay, F. Zheng, N. Pattabiraman, Z. Zhang, Uteroglobin: a novel cytokine? Cell Mol Life Sci CMLS 55 (2014) 771–787, doi:http://dx.doi.org/ 10.1007/s000180050331. S.W. Levin, J.D. Butler, U.K. Schumacher, P.D. Wightman, A.B. Mukherjee, Uteroglobin inhibits phospholipase A2 activity, Life Sci. 38 (1986) 1813–1819. W.J. Silvia, G.S. Lewis, J.A. McCracken, W.W. Thatcher, L. Wilson, Hormonal regulation of uterine secretion of prostaglandin F2 alpha during luteolysis in ruminants, Biol. Reprod. 45 (1991) 655–663, doi:http://dx.doi.org/10.1095/ biolreprod45.5.655. J. McCracken, Prostaglandin f2a and corpus luteum regression, Ann. N. Y. Acad. Sci. 180 (1971) 456–469, doi:http://dx.doi.org/10.1111/j.1749-6632.1971. tb53213.x. Y. Sugimoto, A. Yamasaki, E. Segi, K. Tsuboi, Y. Aze, T. Nishimura, H. Oida, N. Yoshida, T. Tanaka, M. Katsuyama, K. Hasumoto, T. Murata, M. Hirata, F. Ushikubi, M. Negishi, A. Ichikawa, S. Narumiya, Failure of parturition in mice lacking the prostaglandin F receptor, Science 277 (1997) 681–683, doi:http:// dx.doi.org/10.1126/science.277.5326.681. E.K. Shanle, W. Xu, Endocrine disrupting chemicals targeting estrogen receptor signaling: identification and mechanisms of action, Chem. Res. Toxicol. 24 (2011) 6–19, doi:http://dx.doi.org/10.1021/tx100231n. R.A. Lubet, B.M. Heckman, S.L. De Flora, V.E. Steele, J.A. Crowell, M.M. Juliana, C. J. Grubbs, Effects of 5,6-benzoflavone, indole-3-carbinol (I3C) and diindolylmethane (DIM) on chemically-induced mammary carcinogenesis: is DIM a substitute for I3C? Oncol Rep-736 26 (731) (2011), doi:http://dx.doi.org/ 10.3892/or.2011.1316. V. Krishnan, W. Porter, M. Santostefano, X. Wang, S. Safe, Molecular mechanism of inhibition of estrogen-induced cathepsin D gene expression by 2,3,7,8-tetrachlorodibenzo-p-dioxin (TCDD) in MCF-7 cells, Mol. Cell. Biol. 15 (1995) 6710–6719. M. Abdelrahim, E. Ariazi, K. Kim, S. Khan, R. Barhoumi, R. Burghardt, S. Liu, D. Hill, R. Finnell, B. Wlodarczyk, V.C. Jordan, S. Safe, 3-Methylcholanthrene and other aryl hydrocarbon receptor agonists directly activate estrogen receptor alpha, Cancer Res. 66 (2006) 2459–2467, doi:http://dx.doi.org/10.1158/00085472 (CAN-05-3132). S. Liu, M. Abdelrahim, S. Khan, E. Ariazi, V.C. Jordan, S. Safe, Aryl hydrocarbon receptor agonists directly activate estrogen receptor alpha in MCF-7 breast cancer cells, Biol. Chem. 387 (2006) 1209–1213, doi:http://dx.doi.org/10.1515/ BC.2006.149. D.C. Spink, D.W. Lincoln 2nd, H.W. Dickerman, J.F. Gierthy, 2,3,7,8Tetrachlorodibenzo-p-dioxin causes an extensive alteration of 17 betaestradiol metabolism in MCF-7 breast tumor cells, Proc. Natl. Acad. Sci. U. S. A. 87 (1990) 6917–6921. L.A. Suchar, R.L. Chang, P.E. Thomas, R.T. Rosen, J. Lech, A.H. Conney, Effects of phenobarbital, dexamethasone, and 3-methylcholanthrene administration on the metabolism of 17 beta-estradiol by liver microsomes from female rats,

Please cite this article in press as: J. Helle, et al., Effects of the aryl hydrocarbon receptor agonist 3-methylcholanthrene on the 17b-estradiol regulated mRNA transcriptome of the rat uterus, J. Steroid Biochem. Mol. Biol. (2017), http://dx.doi.org/10.1016/j.jsbmb.2017.03.004

G Model SBMB 4904 No. of Pages 11

J. Helle et al. / Journal of Steroid Biochemistry & Molecular Biology xxx (2016) xxx–xxx Endocrinology 137 (1996) 663–676, doi:http://dx.doi.org/10.1210/ endo.137.2.8593816. [52] F. Ohtake, A. Baba, I. Takada, M. Okada, K. Iwasaki, H. Miki, S. Takahashi, A. Kouzmenko, K. Nohara, T. Chiba, Y. Fujii-Kuriyama, S. Kato, Dioxin receptor is a ligand-dependent E3 ubiquitin ligase, Nature 446 (2007) 562–566, doi:http:// dx.doi.org/10.1038/nature05683.

11

[53] M. Wormke, M. Stoner, B. Saville, K. Walker, M. Abdelrahim, R. Burghardt, S. Safe, The aryl hydrocarbon receptor mediates degradation of estrogen receptor alpha through activation of proteasomes, Mol. Cell. Biol. 23 (2003) 1843–1855. [54] S. Nilsson, S. Mäkelä, E. Treuter, M. Tujague, J. Thomsen, G. Andersson, E. Enmark, K. Pettersson, M. Warner, J,-Å. Gustafsson, Mechanisms of estrogen action, Physiol. Rev. 81 (2001) 1535–1565.

Please cite this article in press as: J. Helle, et al., Effects of the aryl hydrocarbon receptor agonist 3-methylcholanthrene on the 17b-estradiol regulated mRNA transcriptome of the rat uterus, J. Steroid Biochem. Mol. Biol. (2017), http://dx.doi.org/10.1016/j.jsbmb.2017.03.004