- Email: [email protected]
Embelin ameliorates dextran sodium sulfate-induced colitis in mice
International Immunopharmacology 11 (2011) 724–731
Contents lists available at ScienceDirect
International Immunopharmacology j o u r n a l h o m e p a g e : w w w. e l s ev i e r. c o m / l o c a t e / i n t i m p
Embelin ameliorates dextran sodium sulfate-induced colitis in mice Kalyan Kumar G. a,⁎, Dhamotharan R. a, Nagaraj M. Kulkarni b, Srinivasa Honnegowda c, Murugesan S. d a
Post-Graduate Research Center, Department of Plant Biology and Biotechnology, Presidency College, Chennai-600005, India Department of Pharmacology and Toxicology, K.L.E.S's College of Pharmacy, J N Medical College Campus, Nehru Nagar, Belgaum-590010, Karnataka, India c Department of Pharmacology, Medical Education Building(MEB) School of Medicine, Louisiana State University, New Orleans, LA 70112, USA d Post Graduate and Research, Department of Botany, Pachaiyaappa's College, Chennai-600030, India b
a r t i c l e
i n f o
Article history: Received 25 November 2010 Received in revised form 4 January 2011 Accepted 17 January 2011 Available online 3 February 2011 Keywords: Embelin Ulcerative colitis DSS Cytokines
a b s t r a c t Embelin has been used to treat fever, inflammatory diseases, and a variety of gastrointestinal ailments for thousands of years. Although reports indicate that embelin has anti-inflammatory and anti-tumor effects, its effects on ulcerative colitis have not been previously explored. The purpose of the present work was to evaluate the anti-inflammatory effect of embelin on dextran sulfate sodium (DSS)-induced colitis. Experimental colitis was induced in BALB/c mice by dissolving 5% DSS in their drinking water for 7 days. Embelin (10, 30 or 50 mg/kg body weight) was administrated daily per oral route for 7 days. Embelin significantly attenuated DSS-induced DAI scores and tissue MPO accumulation, which implied that it suppressed weight loss, diarrhea, gross bleeding, and the infiltrations of immune cells. Embelin administration also effectively and dose-dependently prevented shortening of colon length and enlargement of spleen size. Histological examinations indicated that embelin suppressed edema, mucosal damage, and the loss of crypts induced by DSS. Furthermore, embelin inhibited the abnormal secretions and mRNA expressions of pro-inflammatory cytokines, such as, TNF-α, IL-1β, and IL-6. These results suggest that embelin has an antiinflammatory effect at colorectal sites that is due to the down-regulations of the productions and expressions of inflammatory mediators, and that it may have therapeutic value in the setting of inflammatory bowel disease (IBD). © 2011 Elsevier B.V. All rights reserved.
1. Introduction Inflammatory bowel diseases (IBD), Crohn's disease and ulcerative colitis (UC) are chronic, relapsing, remitting gastrointestinal (GI) diseases characterized by chronic inflammation of the intestine [4, 35, 38]. UC and Crohn's disease are associated with intestinal and extra intestinal clinical manifestations of disease, which include weight loss, diarrhea accompanied by blood and/or mucus, fever, gastric dysmotility, and shortening of the colon [14, 19]. The pathogenesis of IBD remains unclear, but imbalances between pro-inflammatory cytokines, such as, tumor necrosis factor (TNF-α), interferongamma (IFN-γ), interleukin-1 (IL-1), IL-6, and IL-12, and antiInflammatory cytokines, such as IL-4,IL-10,IL-11, are believed to play a central role in modulating inflammation [1]. Current treatment strategies for IBD, consisting predominantly of 5-aminosalicylic acid (5-ASA) is well tolerated but diarrhea, cramps, and abdominal pain are occasional side effects, and these may be accompanied by a fever, rash, or kidney problems. Corticosteroids have also been used for many years to treat patients with severe CD ⁎ Corresponding author at: Present address: Vanta Bioscience (Kemin Industries South Asia) K2, 11th Cross Street SIPCOT Industries Complex, Gummidipundi, Chennai, Tamilnadu-601201, India. Tel.: +91 9176401243. E-mail address: [email protected] (K. Kumar G.). 1567-5769/$ – see front matter © 2011 Elsevier B.V. All rights reserved. doi:10.1016/j.intimp.2011.01.022
and UC which produce systemic immunosuppression, are fraught with significant clinical sequelae which limit their long-term usage of 5-ASA, and have well-known side effects, which include rounding of the face, acne, increased body hair, diabetes, weight gain, and high blood pressure [43]. In addition, some immunomodulators, such as, azathioprine and 6-mercaptopurine, and antibiotics are becoming important in the setting of steroid resistant and steroid-dependent patients [18]. However, all of these drugs have short comings. Treatment strategies which effectively attenuate the mucosal inflammation associated with fewer side effects are needed. Naturally occurring compounds have given rise to the development of approximately half of all pharmaceuticals introduced to the market over the past 20 years [41]. The fruit of the Embelia ribes Burm. plant (Myrsinaceae) (called false black pepper in English, Vidanda in Sanskrit, and Babrang in Hindi languages) has been used to treat fever, inflammatory diseases, and a variety of gastrointestinal ailments for thousands of years [15]. More than 4 decades ago, the active component from this plant was isolated and named embelin [13]; see structure in Fig. 1) and later chemically synthesized [10]. Previous studies have reported that embelin has been shown to have antitumor, anti-inflammatory, and analgesic properties [6]. Embelin regulation over cell proliferation, apoptosis, invasion, and tumor cell migration is poorly established. Embelin has been shown to suppress carcinogenesis [6, 37]. Earlier results demonstrate that
K. Kumar G. et al. / International Immunopharmacology 11 (2011) 724–731
725
2.4. Experimental animals
Fig. 1. Structure of Embelin.
embelin inhibits the expression of COX-2, MMP-9, cyclin D1, VEGF, and ICAM-1, all regulated by NF-κB. More recently, embelin was also identified as a cell-permeable, small molecular weight inhibitor of the X chromosome linked inhibitor of apoptosis protein (XIAP), an antiapoptotic protein that binds the BIR3 domain and abolishes its activity to inhibit caspase-9. Previous phytochemical investigations of embelin beyond its use in parasitic infections however, used has an important remedy in both Vattic and Kaphaja conditions, used in dryness of the bowels, constipation, colic and flatulence. No reports have been issued on its anti-inflammatory effects on intestinal epithelial cells or the mechanism involved. In the present study, we investigated whether the embelin from E. ribes extract of the fruits suppresses gut inflammation in an in vivo inflammatory model of bowel disease (IBD)-induced by DSS. 2. Materials and methods
Male Swiss albino mice weighing 28–30 g were purchased from C.L. Baid Mehta College, India. All mice were housed 2/cage and fed standard laboratory chow in the animal room with 12-h dark/light cycles and constant temperature of 20 ± 5 °C. All animal experiments were conducted under university guideline and approved by ethical committee for Animal Care and Use of the Madras University according to an animal protocol. 2.5. Induction of colitis Experimental colitis was induced by giving mice drinking water ad libitum containing 5% (w/v) DSS for 7 days. Mice of each of the groups were monitored carefully every day to confirm that they consumed an approximately equal volume of DSS-containing water. For each experiment, mice were divided into six experimental groups. The first group was kept as vehicle-treated control and treated with saline as the same routes embelin, and the second group was given drinking water with DSS only throughout the experimental period. Other 4 groups consisted of mice receiving 5% DSS were administrated embelin (10, 30, 50 mg/kg/day p.o.) or 5-ASA (75 mg/kg/day p.o.) daily for 7 days according to experimental design. All materials were dissolved in vehicle (0.5% sodium carboxymethyl cellulose). Control groups were given vehicle daily for 7 days as appropriate. Administration of each drug was started with the DSS treatment at the same time. The experiments were conducted two times with six mice in each group.
2.1. Plant materials 2.6. Evaluation of disease activity index (DAI) Dry fruits of E. ribes (Myrsinaceae) were collected from PERD Centre, Ahmedabad, and Gujarat, India. The plant was authenticated by comparing with the herbarium voucher specimen deposited at Presidency College Madras University Herbarium (Specimen No. PBPB-26). The material was air dried in shade, powdered mechanically and stored in airtight containers. One kilogram of the powdered material was refluxed with ethanol in a soxhlet apparatus for 48 h in batches of 250 g each. The extract was filtered, pooled and the solvent was removed under reduced pressure at 40 ± 50 C using rotary flash evaporator and the yield was 5.27 g.
Body weight, stool consistency and gross bleeding were recorded daily. Disease activity index (DAI) was determined by combining scores of (i) body weight loss, (ii) stool consistency and (iii) gross bleeding, divided by 3. Each score was determined as follows: change in body weight loss (0: none, 1: 1–5%, 2: 5–10%, 3: 10–20%, 4: N20%), stool blood (0: negative, 1: +, 2: ++, 3: +++, 4: ++++) and stool consistency (0: normal, 1 and 2: loose stool, 3 and 4: diarrhea). Body weight loss was calculated as the percent difference between the original body weight (day 0) and the body weight on any particular day. At the end of the experiment, mice were killed and the colons
2.2. Isolation The Coarse powder of dry fruits of E. ribes was extracted exhaustively with n-hexane and the extract so obtained was chromatographed on silica gel column and eluted successively using chloroform and ethanol in the ratio of 1:1. The eluted fractions were collected at an interval of 5 ml each and were monitored by thin layer chromatography and grouped in to five fractions. Fraction two recovered in higher concentration was recrystallized from chloroform to get an orange red needle-like aromatic compound. The structure was confirmed by IR, 1H NMR and mass spectral studies. 2.3. Chemicals and reagents DSS was purchased from MP biomedical (MW; 36,000–50,000, MP Biomedical, Solon, OH). iNOS, β-actin monoclonal antibodies, and peroxidase-conjugated secondary antibody were purchased from Santa Cruz Biotechnology, Inc. (Santa Cruz, CA, USA).The enzyme immunoassay (EIA) kits for TNF-α, IL-1β and IL-6 were obtained from R&D Systems (Minneapolis, MN,USA). Random oligonucleotide Primers and M-MLV reverse transcriptase were purchased from Promega (Madison, WI, USA). Dntp Mix and SYBR green ex Taq were obtained from TaKaRa (Seoul, Korea). TNF-α, IL-1β and IL-6 β-actin oligonucleotide primers were purchased from Bioneer (Seoul, Korea). 5-Aminosalicylicacid (5-ASA) and all other chemicals were purchased from Sigma Chemical Co. (St. Louis, MO, USA).
Fig. 2. Oral administration (p.o.) of embelin ameliorated DSS-induced colitis in mice. Mice were administered 5% DSS in drinking water (ad libitum) for 7 days with or without embelin (10, 30, 50 mg/kg/day p.o. upto7 days), alone. 5-ASA (75 mg/kg/day p.o.) was used as a positive control. Changes in disease activity index level were evaluated daily throughout the 7-day experimental period. Values are the mean± SD of three independent experiments. #P b 0.05 vs. the vehicle-treated control group; *P b 0.05, **P b 0.01, ***P b 0.001 vs. the DSS-induced colitis groups; significance group; significances between treated groups were determined using ANOVA and Dunnett's post hoc test.
726
K. Kumar G. et al. / International Immunopharmacology 11 (2011) 724–731
homogenized in lysis buffer (10mMTris pH 7.4, 200 mM NaCl, 5 mM EDTA,10% glycerol,1 mM PMSF,1 μg/ml leupeptide and 28 μg/ml aprotonine).The homogenate was then centrifuged at 1500×g for 15 min, and the resulting supernatant assayed for MPO assay using EIA kits (Hycult Biotechnology, India). 2.9. Western blot analysis Segments of colon were homogenized by homogenizer and washed once with phosphate-buffered saline (PBS). The washed pellets were resuspended in extraction lysis buffer (50 mM HEPES pH7.0, 250 mM NaCl, 5 mM EDTA, 0.1% Nonidet P-40, 1 mM phenylmethylsulfonyl fluoride, 0.5 mM dithiothreitol, 5 mM Na fluoride, and 0.5 mM Na orthovanadate) containing μg/ml each of leupeptin and aprotinin and incubated with 20 min at 4 °C. Cell debris was removed by micro-centrifugation, followed by quick freezing of the supernatants. The protein concentration was determined using the Bio-Rad protein assay reagent according to the manufacturer's instruction. Forty micrograms of cellular protein from treated and untreated cell extracts was electroblotted onto a PVDF membrane following separation on a 10% SDS-polyacrylamide gel electrophoresis. The immunoblot was incubated for 1 h with blocking solution (5% skim milk) at RT, followed by incubation overnight with a primary antibody. Blots were washed four times with Tween 20/Tris-buffered saline (TTBS) and incubated with a 1:1000 dilution of horseradish peroxidase-conjugated secondary antibody for 2 h at room temperature. Blots were again washed three times with TTBS, and then developed by enhanced chemiluminescence (Amersham Life Science). The intensity of the bands was quantified using ImageJ software. 2.10. Measurement of NO and cytokines Fig. 3. Embelin shortened colon lengths and increased spleen weights in mice with DSSinduced colitis. Mice were administered 5% DSS in drinking water (ad libitum) for 7 days with or without embelin (10, 30, 50 mg/kg/day p.o. up to 7 days), 5-ASA (75 mg/ kg/day p.o.) was used as a positive control. On day 7, mice were sacrificed and colons and spleens removed, the change of colon lengths measured (A), and spleen weights were recorded (B). Values are the mean ± SD of three independent experiments. # P b 0.05 vs. the vehicle-treated control group; *P b 0.05, **P b 0.01, ***P b 0.001 vs. the DSS-induced colitis group; significances between treated groups were determined using ANOVA and Dunnett's post hoc test.
were separated from the proximal rectum, close to its passage under the pelvisternum. The colon length was measured between the ileocecal junction and the proximal rectum. The spleens were also obtained and their weight was measured. 2.7. Histopathology The resected large intestine was grossly examined for the mucosal defect, hemorrhage, or ulcerative lesions, and then fixed immediately in 4% neutral formalin. For histopathological analysis, tissue sections were made from the representative region of large intestine by the conventional tissue preparation methods, and viewed under the light microscope (100×) after hematoxylin and eosin (H&E) staining. 2.8. Myeloperoxidase assay MPO accumulation was measured in soft tissue from colon, as a marker of neutrophil influx into the tissue. The tissue was thawed and
Colon tissues corresponding to the mid-colon were washed with DMEM medium containing 2% FBS and penicillin and streptomycin before cut into smaller pieces. Then 0.5 cm of tissue was placed 1 ml of DMEM medium containing 0.2% FBS, distributed into 48-well plate, incubated 24 h at 37°C in 5% CO2. The cell-free culture supernatants of the colon tissue were using to measure NO and cytokines [45]. Nitrite levels in culture media were determined using the Griess reaction assay and presumed to reflect NO levels [44]. Briefly, 100 μl of cell-free supernatant was mixed with 100 μl of Griess reagent [equal volumes of 1% (w/v) sulfanilamide in 5%(v/v) phosphoric acid and 0.1%(w/v) naphtylethylenediamine–HCl], incubated at room temperature for10 min, and then the absorbance at 540 nm was measured in a microplate reader (Perkin Elmer Cetus Foster City, CA, USA).Fresh culture medium was used as the blank in all experiments. The amount of nitrite in the samples was measured with the serial dilution standard curve of sodium nitrite. Also, levels of TNF-α, IL-1β and IL-6 in the culture media were quantified using EIA kits (R&D Systems, Minneapolis, MN, USA). 2.11. Quantitative real-time reverse-transcriptase polymerase chain reaction (RT-PCR) The total RNA from the colon homogenates was isolated with RNeasy mini kit (Qiagen, Valencia, CA, and USA). From each sample, 1 μg of RNA was reverse-transcribed (RT) using MuLV reverse transcriptase, 1 mM deoxyribonucleotide triphosphate (dNTP), and oligo (dT 12–18) 0.5 μg/μl. PCR amplification was performed using the incorporation of SYBR green. The oligonucleotide primers for TNF-α designed from
Fig. 4. Effects of embelin on colorectal histology and on MPO activities in mice with DSS-induced colitis. (A) Representative sections of colonic tissues from mice administered 5% DSS in drinking water (ad libitum) for 7 days with embelin (50 mg/kg/day p.o. upto 7 days). 5-ASA (75 mg/kg/day p.o.) was used as a positive control. Histological changes were determined by H&E staining. (B) Colon segments from mice treated with DSS (2%, dissolved in drinking water) and embelin (10, 30, 50 mg/kg/day p.o.) or 5-ASA (75 mg/kg/day p.o.) were used to determine MPO levels. Values are the mean ± SD of three independent experiments. #P b 0.05 vs. the vehicle-treated control group; *P b 0.05, **P b 0.01, ***P b 0.001 vs. theDSS-induced colitis group; significances between treated groups were determined using ANOVA and Dunnett's post hoc test.
K. Kumar G. et al. / International Immunopharmacology 11 (2011) 724–731
727
728
K. Kumar G. et al. / International Immunopharmacology 11 (2011) 724–731
mouse (Genbank ID: NM_013693.2) were AGCACA GAAAGCATGATCCG (forward) and CTGATGAGAGGGAGGCCATT (reverse), for IL-1β (Genbank ID: NM_008361.3) were ACCTGCTGGTGTGTGACGTT (forward) and TCGTTGCTTGGTT CTC-CTTG (reverse), for IL-6 (Genbank ID: NM_031168) were GAGGATACCACTCCCAACAGACC (forward) and AAGTGCATCATCGTTGTT CAT ACA (reverse) and the suitable size of synthesized cDNA were 220, 187 and 142 bp, respectively. The oligonucleotide primers for β-actin used as a house-keeping gene designed from mouse (Genbank ID: NM_007393) were ATCACTATTGGCAACG-AGCG (forward) and TCAGCAATGCCTGGGTACAT (reverse), and the suitable size of synthesized cDNA were 200 bp. Steady-state mRNA levels of TNF-α, IL-1β, IL-6, and β-actin were determined by real-time quantitative PCR (qPCR) using the Light cycler1.5 (Roche Diagnostics, Germany). The results were expressed as the ratio of optimal density to β-actin. 2.12. Statistical analyses Results are expressed as the mean ± SEM. Statistical analysis was performed using one-way ANOVA followed by Dunnett's post hoc test. P b 0.05 was considered statistically significant.
the rectum with reducing proximal severity [39]. Pathological examinations of colons and rectums were carried out after H&E staining and representative results are shown in Fig. 3A. Tissue sections from representative areas of large intestine showed decreases in crypts epithelium distortion and in the mucosal and submucosal infiltrations of acute and chronic inflammatory cells, which significantly reduced histopathological scores. Interestingly, crypts structures were rather well-preserved and inflammatory reactions were significantly lower in tissue samples from mice with DSS-induced colitis treated with embelin (50 mg/kg) or 5-ASA (75 mg/kg) than vehicle-treated control mice. Myeloperoxidase (MPO) is an enzyme found in neutrophils and in much smaller quantities in monocytes and macrophages. Furthermore, MPO activity reflects degree of neutrophil infiltration, a marker of acute inflammation [20]. Our histopathological study indicated that one mechanism underlying the protective effects of embelin involved a reduction in inflammatory cell infiltration into colonic mucosa. Thus, colon inflammation was quantitatively assayed by determining MPO levels in colonic tissues. We found that an elevated MPO level was correlated with the development of colonic inflammation and that the administration of embelin (50 mg/kg) or 5-ASA (75 mg/kg) significantly suppressed MPO accumulation in the colonic tissues of mice with DSSinduced colitis (Fig. 4A and B).
3. Results 3.1. Embelin attenuated the severity of DSS-induced acute colitis In Swiss albino mice with DSS-induced acute colitis, which resembles the acute phase of human ulcerative colitis, a combinatorial DAI, which incorporated body weight loss, stool consistency, and gross bleeding, was used to analyze the therapeutic effects of embelin, 5-ASA (75 mg/kg) was used as a positive control. DSS (5%) administration was found to be associated with significant clinical changes, which included weight loss, diarrhea, and the appearance of occult fecal blood in untreated mice. Treatment with embelin (10, 30, or 50 mg/kg/day, p.o. for 7 days) dose-dependently suppressed these pathological conditions and significantly reduced intestinal inflammation (Fig. 2). In particular, the administration of embelin at 50 mg/ kg/day, p.o. for 7 days had a better therapeutic effect than 5-ASA at 75 mg/kg/day, p.o. for 7 days. 3.2. Embelin prevented the colonic shortening and spleen enlargement induced by DSS It is generally accepted that colon length is inversely associated with the severity of DSS-induced colitis. To determine whether embelin has a beneficial effect on DSS-induced colonic shortening, we measured and compared the colon lengths of vehicle-treated control mice, mice with DSS-induced colitis, 5-ASA-treated mice with DSS-induced colitis, embelin (10, 30, or 50 mg/kg) treated mice with DSS-induced colitis. While the significant shortening of colon length was observed in mice with DSS-induced colitis as compared with vehicle-treated controls (10.01±0.78 cm vs. 5.76±0.71 cm Pb 0.001), oral administration of embelin reduced this shortening of colon length in a dose-dependent manner; mice with DSS-induced colitis versus 5-ASA (75 mg/kg) treated mice with DSS-induced colitis (5.76±0.71 cm vs. 8.86±0.96 cm, Pb 0.05), mice with DSS-induced colitis versus embelin (30 mg/kg) treated mice with DSS-induced colitis(6.76±0.76 cm vs.76.96±6.71 cm, Pb 0.05), and mice with DSS-induced colitis versus embelin (50 mg/kg) treated mice with DSS-induced colitis (5.76±0.71 cm vs. 8.90±1.08 cm, Pb 0.001) (Fig. 3A and B). 3.3. Embelin decreased histological changes and elevated MPO levels in mice with DSS-induced colitis Consistent with the previous findings, histological changes in the colons of mice with DSS-induced colitis showed mucosal inflammation in
3.4. Embelin inhibited NO production and iNOS expression in mice with DSS-induced colitis Nitric oxide (NO) production and the expression of inducible nitric oxide synthase (iNOS) in intestinal mucosa appear to be enhanced in active ulcerative colitis, and when present in excess, these play proinflammatory role [16]. Interestingly, several iNOS inhibitors have been shown to protect mice effectively from colitis [21, 22]. Therefore, we evaluated the effect of embelin on NO production and iNOS expression in mice with DSS-induced colitis and compared findings with those of untreated mice with DSS-induced colitis and vehicletreated controls. As shown in Fig. 5A, the oral administration of embelin significantly inhibited DSS-induced NO production in mice at day 7 after DSS treatment. Next, we examined the effect of embelin on the expression of iNOS in colon by Western blotting. The expression of iNOS was found to be remarkably induced in the colons of mice with DSS-induced colitis, and embelin significantly and dose-dependently reduced this iNOS expression (Fig. 5B). 3.5. Embelin suppressed the production and the mRNA expressions of inflammatory cytokines in mice with DSS-induced colitis Several reports have concluded that colonic inflammation due to the aberrant activations of intestinal immune cells causes excessive proinflammatory cytokine secretion [9, 23, 36]. In particular, the bindings of TNF-α, IL-1β, and IL-6 to intestinal immune cells amplify immune response by enhancing the proliferation of T cells, and thus, promoting leukocyte infiltration and facilitating cell–cell signaling [30]. Accordingly, we investigated the suppressive effect of embelin in mice with DSSinduced colitis. Using enzyme immunoassays and real-time PCR, we evaluated the production and the mRNA expressions of pro-inflammatory cytokines in embelin treated mice with DSS-induced colitis and compared these with those of untreated mice with DSS-induced colitis and vehicletreated controls. DSS administration was found to induce TNF-α, IL-1β, and IL-6 levels significantly, and embelin (50 mg/kg) reduced these increases by 45.7%, 54.5%, and 49.5%, respectively (Fig. 6A–C). To gain further insight of the molecular mechanisms underlying the suppression of colitis by embelin, we measured the mRNA expression levels of these inflammatory cytokines in colon by qRT-PCR. As shown in (Fig. 7A–C), colonic tissues treated with DSS alone showed elevated TNF-α, IL-1β, and IL-6 mRNA expressions up to 14.2-, 12.9-, and 13.4-fold over basal levels, respectively. Furthermore, these mRNA expressions were dose-dependently reduced by embelin.
K. Kumar G. et al. / International Immunopharmacology 11 (2011) 724–731
Fig. 5. Effects of embelin on NO production and iNOS expression in mice with DSSinduced colitis. Mice were administered 5% DSS in drinking water (ad libitum) for 7 days with embelin (10, 30, 50 mg/kg/day p.o. upto 7 days), 5-ASA (75 mg/kg/day p.o.) was used as a positive control. (A) Nitrite levels in culture media were determined using Griess reaction assays and (B) Western blotting was performed to detect iNOS expression using Image J software. Values are the mean ± SD of three independent experiments. #P b 0.05 vs. the vehicle-treated control group; *P b 0.05, **P b 0.01, ***P b 0.001 vs. the DSS-induced colitis group; significances between treated groups were determined using ANOVA and Dunnett's post hoc test.
729
Fig. 6. Effects of embelin on the productions of pro-inflammatory cytokines (TNF-α, IL-1β, and IL-6) in the colonic tissues of mice with DSS-induced colitis. Mice were administered 5% DSS in drinking water (ad libitum) for7 days with embelin (10, 30, 50 mg/kg/day p.o. up to 7 days). 5-ASA (75 mg/kg/day p.o.) was used as a positive control. The productions of (A) TNF-α, IL-1β and (C) IL-6 were determined. Values are the mean ± SD of three independent experiments. #P b 0.05 vs. the vehicle-treated control group; *P b 0.05, **P b 0.01, ***P b 0.001 vs. the DSS-induced colitis group; significances between treated groups were determined using ANOVA and Dunnett's post hoc test.
4. Discussion Crohn's disease (CD) and ulcerative colitis (UC), which belong to the group of inflammatory bowel disease (IBD), are chronic inflammatory disorders of the gastrointestinal tract with profound emotional and social impacts profound emotional and social impacts
730
K. Kumar G. et al. / International Immunopharmacology 11 (2011) 724–731
Fig. 7. Effect of embelin on the mRNA expressions of pro-inflammatory cytokines (TNF-α, IL-1β, and IL-6) in mice with DSS-induced colitis. Mice were administered 5% DSS in drinking water (ad libitum) for 7 days with embelin (10, 30, 50 mg/kg/day p.o. upto 7 days). 5-ASA (75 mg/kg/day p.o.) was used as a positive control. The mRNA expressions of TNF-α, IL-1β, and IL-6 were determined as described. Values are the mean ± SD of three independent experiments. #P b 0.05 vs. the vehicle-treated control group; *P b 0.05, **P b 0.01, ***P b 0.001 vs. the DSS-induced colitis group; significances between treated groups were determined using ANOVA and Dunnett's post hoc test.
[2] and in addition dysregulated inflammation to the intestinal track, contributes to colon cancer [9]. While the cause of ulcerative colitis is still unknown, several, possibly interrelated, causes have been suggested including genetic, environmental and autoimmune factors. Although UC is generally treated with anti-inflammatory or immunosuppressive drugs, most of these treatments often prove to be
inadequate. Consequently, many patients turn to alternative strategies, including traditional plant-based remedies. This study is focused mainly on identifying the treatment strategies which effectively attenuate the mucosal inflammation associated with fewer side effects. A previous clinical study found that a decoction of E. ribes was effective at treating variety of gastrointestinal ailments for thousands of years [15]. Based on the ethnopharmacological uses of embelin, we investigated the anti-inflammatory effects of a in an in vivo model of inflammatory bowel disease (IBD) induced by dextran sulfate sodium (DSS) in Balb C mice. This model exhibits symptoms comparable to those of human ulcerative colitis [32], such as body weight loss, diarrhea, bloody feces, mucosal ulceration, and colonic shortening [27, 42]. We administered embelin orally during DSS consumption (co-administration) and assessed clinical colitis using body weight loss, stool consistency, and stool blood. Finally, we evaluated the therapeutic effects of embelin. Our findings demonstrate that embelin significantly suppresses DSS-induced colitis in mice, and that it improves body weight, stool consistency, and decreases intestinal bleeding. In the present study, 5ASA was used as a reference drug. The active component from E. ribes was isolated and named embelin [13] and later chemically synthesized [10]. Embelin has been shown to have antitumor, antiinflammatory, and analgesic properties [6]. Embelin administration was found to attenuate the colonic shortening and spleen size enlargement induced by DSS, and to markedly reduced neutrophil and macrophage infiltration into the colonic tissues of mice with DSSinduced colitis. Histopathologic findings were in line with our DAI data. The colons of mice treated with DSS presented more severe acute and chronic inflammatory cell infiltration, mucosal erosion, and distortion and loss of crypts. Embelin reduced all of these inflammatory changes, and thus, ameliorated the inflammatory condition. MPO, a member of the hemeperoxidase cyclooxygenase super-family, is abundantly expressed in neutrophils, and to a lesser extent in monocytes and certain types of macrophages, and thus, is a specific biomarker of inflammation [29]. In IBD, oxidative stress is believed to be a major cause of tissue destruction [24]. Furthermore, several reports have suggested that reactive oxygen and nitrogen metabolites are involved in the initiation and progression of IBD [5, 8]. In a previous study, the severity of DSS-induced colitis was found to be significantly attenuated in iNOS knockout and specific iNOS inhibitor treated mice [23]. In our DSS-induced colitis experiment, embelin diminished NO production and iNOS expression in the colonic tissues of DSS treated mice (Fig. 4A and B), which provides a clue as to how embelin has an anti-inflammatory effect on mice with DSS-induced colitis. The hyperactivation of immune cells is another important factor of IBD progress, and is known to produce high levels of pro-inflammatory cytokines like TNF-α, IL-6 and IFN-γ, which are known to damage the colon [14, 19, 34]. Cytokines are important mediators of inflammation, and elevated levels of pro-inflammatory cytokines are observed not only in the inflamed gut of IBD patients but also in animals with DSSinduced colitis [11, 33]. TNF-α is considered to be one of the most important proinflammatory cytokines, and directly influences intestinal epithelial tissues. For example, TNF-α disrupts the epithelial barrier, and induces the apoptosis of epithelial cells and the secretions of chemokines from intestinal epithelial cells. It also activates the adaptive immune system of the bowel by recruiting and activating neutrophils and macrophages [3, 17, 31]. Infliximab, an anti-TNF-α mouse monoclonal antibody, has been found to have therapeutic effects on ulcerative colitis during clinical studies, and has been used as a practical remission of IBD [26, 28]. However, the mechanisms underlying iNOS and TNF-α induction in IBD remain unclear, although the inhibition of TNF-α release was found to iNOS and subsequent colonic damage and inflammation in a murine colitis model [7]. In addition, IL-1β and IL-6 are key mediators of the progression of IBD. IL-1β receptor antagonist was found to suppress the infiltration of
K. Kumar G. et al. / International Immunopharmacology 11 (2011) 724–731
inflammatory cells into the large intestine, the MPO activities of cells in areas of edema, and large intestine necrosis in animals with acute experimental colitis [12, 40]. In addition, anti-murine IL-1β antibody was found to attenuate not only the pathological symptoms of DSSinduced colitis but also IL-6 mRNA expression [25]. These findings indicate that reduction of pro-inflammatory cytokines offers an effective approach to the prevention and treatment of IBD. In the present study, it was observed that the levels of pro-inflammatory cytokines, like TNF-α, IL-1β, and IL-6, were elevated in the colonic tissues of mice with DSS-induced colitis. Furthermore, the administration of embelin greatly reduced these cytokines production as well as mRNA level. These results show that embelin ameliorates colitis by suppressing pro-inflammatory mediators, such as, TNF-α, IL-1β, and IL-6, in the colonic tissues of mice with DSS-induced colitis. Results of this study suggest the potent anti-inflammatory effects of embelin in DSS-induced colitis model are mediated via the inhibition of pro-inflammatory mediator production. Furthermore, embelin (50 mg/kg) was found to have better therapeutic effects than 5-ASA (75 mg/kg), which is currently used to treat IBD. However, further studies are required to elucidate the mechanism responsible for therapeutic effects of embelin. Acknowledgments We sincerely thank Mr. A. Pradeep Kumar (Kan Health Care), for providing sample kits for our research work to carry out Western blot and ELISA; Mr. Saravanan Biosys Ltd., Chennai, for providing lab space to carry out cell culture work; and Prof. Venkataraman, Director C.L. Baid Mehta College, Chennai, for providing facility for animal studies. References [1] Ardizzone and Bianchi Porro. Biologic therapy for inflammatory bowel disease. Drugs 2005;65:2253–86. [2] Asakura H. Ulcerative colitis and intestinal bleeding. Nippon Rinsho 1998;56: 2354–9. [3] Bischoff S, Lorentz A, Schwengberg S, Weier G, Raab R, Manns MP. Mast cells are an important cellular source of tumour necrosis factor alpha in human intestinal tissue. Gut 1999;44:643–52. [4] Blumberg RS, Saubermann LJ, Strober W. Animal models of mucosal inflammation and their relation to human inflammatory bowel disease. Curr Opin Immunol 1999;11:648. [5] Boughton-Smith N. Pathological and therapeutic implications for nitric oxide in inflammatory bowel disease. J R Soc Med 1994;87:312–4. [6] Chitra M, Sukumar E, Suja V, Devi CS. Antitumor, anti-inflammatory and analgesic property of embelin, a plant product. Chemotherapy 1994;40:109–13. [7] Colon A, Menchen LA, Hurtado O, De Cristobal J, Lizasoain I, Leza JC, et al. Implication of TNF-alpha convertase (TACE/ADAM17) in inducible nitric oxide synthase expression and inflammation in an experimental model of colitis. Cytokine 2001;16:220–6. [8] Cross R, Wilson KT. Nitric oxide in inflammatory bowel disease. Inflamm Bowel Dis 2003;9:179–89. [9] Cuzzocrea S. Emerging biotherapies for inflammatory bowel disease. Expert Opin Emerg Drugs 2003;8:339–47. [10] Dallacker F, Lohnert G. Derivatives of methylene dioxybenzene, a novel synthesis of 3,6 dihydroxy-2-ethyl-1,4-benzoquinone, embelin, vilangin, rapanone, dihydromaesa quinone, bhogatin, spinulosin and oosporein. Chem Ber 1972;105: 614–24. [11] Dieleman L, Palmen MJ, Akol H, Bloemena E, Pena AS, Meuwissen SG, et al. Chronic experimental colitis induced by dextran sulphate sodium (DSS) is characterized by Th1 and Th2 cytokines. Clin Experi mental Immunol 1998;114:385–91. [12] Dionne S, D'Agata ID, Hiscott J, Vanounou T, Seidman EG. Colonic explant production of IL-1and its receptor antagonist is imbalanced in inflammatory bowel disease (IBD). Clin Exp Immunol 1998;112:385–91. [13] Du Y, Wie JS. Study of vermifuges. Isolation of embelin from the fruit of muguawha(Embelia oblongifolia hems). Yao Xue Xue Bao 1963;10:578–80. [14] Fiocchi C. Inflammatory bowel disease: etiology and pathogenesis. Gastroenterology 1998;115:182–5. [15] Gupta Ali MM, Ray Ghatak BJ, Atal CK. Some pharmacological investigations of embelin and its semi synthetic derivatives. Indian J Physiol Pharmacol 1977;21: 31–9.
731
[16] Guslandi M. Nitric oxide and inflammatory bowel diseases. European Journal of Clinical Investigation; 28:904–907. [17] Guy-Grand D, DiSanto JP, Henchoz P, Malassis-Seris M, Vassalli P. Small bowel enteropathy: role of intraepithelial lymphocytes and of cytokines (IL-12, IFNgamma, TNF) in the induction of epithelial cell death and renewal. Eur J Immunol 1998;28:730–44. [18] Hanauer S. Inflammatory bowel disease. N Engl J Med 1996;334:841–8. [19] Hendrickson BA, Gokhale R, Cho JH. Clinical aspects and pathophysiology of inflammatory bowel disease. Clin Microbiol Rev 2002;15:79–85. [20] Islam M, Murata T, Fujisawa M, Nagasaka R, Ushio H, Bari AM, et al. Antiinflammatory effects of phytosteryl ferulates in colitis induced by dextran sulphate sodium in mice. Br J Pharmacol 2008;154:812–24. [21] Kankuri E, Hamalainen M, Hukkanen M, Salmenpera P, Kivilaakso E, Vapaatalo H, et al. Suppression of pro-inflammatory cytokine release by selective inhibition of inducible nitric oxide synthase in mucosal explants from patients with ulcerative colitis. Scand J Gastroenterol 2003;38:186–92. [22] Kankuri E, Vaali K, Knowles RG, Lahde M, Korpela R, Vapaatalo H, et al. Suppression of acute experimental colitis by a highly selective inducible nitric-oxide synthase inhibitor, N-[3-(aminomethyl)benzyl]acetamidine. J Pharmacol Exp Ther 2001;298:1128–32. [23] Krieglstein C, Cerwinka WH, Laroux FS, Salter JW, Russell JM, Schuermann G, et al. Regulation of murine intestinal inflammation by reactive metabolites of oxygen and nitrogen: divergent roles of superoxide and nitric oxide. J Exp Med 2001;194: 1207–18. [24] Kruidenier L, Verspaget HW. Review article: oxidative stress as a pathogenic factor in inflammatory bowel disease radicals or ridiculous? Aliment Pharmacol Ther 2002;16:1997–2015. [25] Kwon K, Murakami A, Hayashi R, Ohigashi H. Interleukin-1beta tar- gets interleukin-6 in progressing dextran sulfate sodium-induced experimental colitis. Biochem Biophys Res Commun 2005;337:647–54. [26] Lawson M, Thomas AG, Akobeng AK. Tumor necrosis factor alpha blocking agents for induction of remission in ulcerative colitis. Cochrane Database Syst Rev 2006;3:CD005112. [27] Lee S, Lim KT. Glycoprotein isolated from Ulmus davidiana Nakai regulates expression of iNOS and COX-2 in vivo and in vitro. Food Chem Toxicol 2007;45:990–1000. [28] Levin A, Shibolet O. Infliximab in ulcerative colitis. Biologics 2008;2:379–88. [29] Malle E, Furtmuller PG, Sattler W, Obinger C. Myeloperoxidase: a target for new drug development? Br J Pharmacol 2007;152:838–54. [30] Neuman M. Signaling for inflammation and repair in inflammatory bowel disease. Rom J Gastroenterol 2004;13:309–16. [31] Nilsen EM, Johansen FE, Jahnsen FL, Lundin KE, Scholz T, Brandtzaeg P, et al. Cytokine profiles of cultured microvascular endothelial cells from the human intestine. Gut 1998;42:635–42. [32] Okayasu I, Hatakeyama S, Yamada M, Ohkusa T, Inagaki Y, Nakaya R. A novel method in the induction of reliable experimental acute and chronic ulcerative colitis in mice. Gastroenterology 1990;98:694–702. [33] Pullman W, Elsbury S, Kobayashi M, Hapel AJ, Doe WF. Enhanced mucosal cytokine production in inflammatory bowel disease. Gastroenterology 1992;102:529–37. [34] Rojas-Cartagena C, Flores I, Appleyard CB. Role of tumor necrosis factor receptors in an animal model of acute colitis. Cytokine 2005;32:85–93. [35] Russel MG. Changes in the incidence of inflammatory bowel disease: what does it mean? Eur J Intern Med 2000;11:191–6. [36] Sartor R. Pathogenesis and immune mechanisms of chronic inflammatory bowel diseases. Am J Gastroenterol 1997;92:11S. [37] Sreepriya MaB G. Chemopreventive effects of embelin and curcumin against N-nitroso diethylamine/phenobarbital-induced hepatocarcinogenesis in Wistar rats. Fitoterapia 2005;76:549–55. [38] Strober W, Fuss IJ, Blumberg RS. The immunology of mucosal models of inflammation. Annu Rev Immunol 2002;20:495–500. [39] Tanaka FK, Ochi M, Tanigawa T, Watanabe T, Fujiwara Y, Ohta K, et al. Exogenous administration of mesenchymal stem cells ameliorates dextran sulfate sodiuminduced colitisvia anti-inflammatory action in damaged tissue in rats. Life Sci 2008;83:771–9. [40] Tountas N, Casini-Raggi V, Yang H, Di Giovine FS, Vecchi M, Kam L, et al. Functional and ethnic association of allele 2 of the interleukin-1 receptor antagonist gene in ulcerative colitis. Gastroenterology 1999;117:806–13. [41] Vuorelaa PLM, Saikkuc P, Tammelaa P, Rauhad JP, Wennberge T, Vuorela H. Natural products in the process of finding new drug candidates. Curr Med Chem 2004;11:1375–89. [42] Wirtz S, Neurath MF. Mouse models of inflammatory bowel disease. Adv Drug Deliv Rev 2007;59:1073–83. [43] Xu C, Meng SY, Pan BR. Drug therapy for ulcerative colitis. World J Gastroenterol 2004;10:2311–7. [44] Kim JY, Park SJ, Yun KJ, Cho YW, Park HJ, Lee KT. Isoliquiritigenin isolated from the roots of Glycyrrhiza uralensis inhibits LPS-induced iNOS and COX-2 expression via the attenuation of NF-kappaB in RAW264.7 macrophages. Eur J Pharmacol 2008;584:175–84. [45] Kim YH, Kwon HS, Kim DH, Shin EK, Kang YH, Park JH, Shin HK, Kim JK. 3,3Diindolylmethane attenuates colonic inflammation and tumorigenesis in mice. Inflamm Bowel Dis 2009;15:1164–73.
Contents lists available at ScienceDirect
International Immunopharmacology j o u r n a l h o m e p a g e : w w w. e l s ev i e r. c o m / l o c a t e / i n t i m p
Embelin ameliorates dextran sodium sulfate-induced colitis in mice Kalyan Kumar G. a,⁎, Dhamotharan R. a, Nagaraj M. Kulkarni b, Srinivasa Honnegowda c, Murugesan S. d a
Post-Graduate Research Center, Department of Plant Biology and Biotechnology, Presidency College, Chennai-600005, India Department of Pharmacology and Toxicology, K.L.E.S's College of Pharmacy, J N Medical College Campus, Nehru Nagar, Belgaum-590010, Karnataka, India c Department of Pharmacology, Medical Education Building(MEB) School of Medicine, Louisiana State University, New Orleans, LA 70112, USA d Post Graduate and Research, Department of Botany, Pachaiyaappa's College, Chennai-600030, India b
a r t i c l e
i n f o
Article history: Received 25 November 2010 Received in revised form 4 January 2011 Accepted 17 January 2011 Available online 3 February 2011 Keywords: Embelin Ulcerative colitis DSS Cytokines
a b s t r a c t Embelin has been used to treat fever, inflammatory diseases, and a variety of gastrointestinal ailments for thousands of years. Although reports indicate that embelin has anti-inflammatory and anti-tumor effects, its effects on ulcerative colitis have not been previously explored. The purpose of the present work was to evaluate the anti-inflammatory effect of embelin on dextran sulfate sodium (DSS)-induced colitis. Experimental colitis was induced in BALB/c mice by dissolving 5% DSS in their drinking water for 7 days. Embelin (10, 30 or 50 mg/kg body weight) was administrated daily per oral route for 7 days. Embelin significantly attenuated DSS-induced DAI scores and tissue MPO accumulation, which implied that it suppressed weight loss, diarrhea, gross bleeding, and the infiltrations of immune cells. Embelin administration also effectively and dose-dependently prevented shortening of colon length and enlargement of spleen size. Histological examinations indicated that embelin suppressed edema, mucosal damage, and the loss of crypts induced by DSS. Furthermore, embelin inhibited the abnormal secretions and mRNA expressions of pro-inflammatory cytokines, such as, TNF-α, IL-1β, and IL-6. These results suggest that embelin has an antiinflammatory effect at colorectal sites that is due to the down-regulations of the productions and expressions of inflammatory mediators, and that it may have therapeutic value in the setting of inflammatory bowel disease (IBD). © 2011 Elsevier B.V. All rights reserved.
1. Introduction Inflammatory bowel diseases (IBD), Crohn's disease and ulcerative colitis (UC) are chronic, relapsing, remitting gastrointestinal (GI) diseases characterized by chronic inflammation of the intestine [4, 35, 38]. UC and Crohn's disease are associated with intestinal and extra intestinal clinical manifestations of disease, which include weight loss, diarrhea accompanied by blood and/or mucus, fever, gastric dysmotility, and shortening of the colon [14, 19]. The pathogenesis of IBD remains unclear, but imbalances between pro-inflammatory cytokines, such as, tumor necrosis factor (TNF-α), interferongamma (IFN-γ), interleukin-1 (IL-1), IL-6, and IL-12, and antiInflammatory cytokines, such as IL-4,IL-10,IL-11, are believed to play a central role in modulating inflammation [1]. Current treatment strategies for IBD, consisting predominantly of 5-aminosalicylic acid (5-ASA) is well tolerated but diarrhea, cramps, and abdominal pain are occasional side effects, and these may be accompanied by a fever, rash, or kidney problems. Corticosteroids have also been used for many years to treat patients with severe CD ⁎ Corresponding author at: Present address: Vanta Bioscience (Kemin Industries South Asia) K2, 11th Cross Street SIPCOT Industries Complex, Gummidipundi, Chennai, Tamilnadu-601201, India. Tel.: +91 9176401243. E-mail address: [email protected] (K. Kumar G.). 1567-5769/$ – see front matter © 2011 Elsevier B.V. All rights reserved. doi:10.1016/j.intimp.2011.01.022
and UC which produce systemic immunosuppression, are fraught with significant clinical sequelae which limit their long-term usage of 5-ASA, and have well-known side effects, which include rounding of the face, acne, increased body hair, diabetes, weight gain, and high blood pressure [43]. In addition, some immunomodulators, such as, azathioprine and 6-mercaptopurine, and antibiotics are becoming important in the setting of steroid resistant and steroid-dependent patients [18]. However, all of these drugs have short comings. Treatment strategies which effectively attenuate the mucosal inflammation associated with fewer side effects are needed. Naturally occurring compounds have given rise to the development of approximately half of all pharmaceuticals introduced to the market over the past 20 years [41]. The fruit of the Embelia ribes Burm. plant (Myrsinaceae) (called false black pepper in English, Vidanda in Sanskrit, and Babrang in Hindi languages) has been used to treat fever, inflammatory diseases, and a variety of gastrointestinal ailments for thousands of years [15]. More than 4 decades ago, the active component from this plant was isolated and named embelin [13]; see structure in Fig. 1) and later chemically synthesized [10]. Previous studies have reported that embelin has been shown to have antitumor, anti-inflammatory, and analgesic properties [6]. Embelin regulation over cell proliferation, apoptosis, invasion, and tumor cell migration is poorly established. Embelin has been shown to suppress carcinogenesis [6, 37]. Earlier results demonstrate that
K. Kumar G. et al. / International Immunopharmacology 11 (2011) 724–731
725
2.4. Experimental animals
Fig. 1. Structure of Embelin.
embelin inhibits the expression of COX-2, MMP-9, cyclin D1, VEGF, and ICAM-1, all regulated by NF-κB. More recently, embelin was also identified as a cell-permeable, small molecular weight inhibitor of the X chromosome linked inhibitor of apoptosis protein (XIAP), an antiapoptotic protein that binds the BIR3 domain and abolishes its activity to inhibit caspase-9. Previous phytochemical investigations of embelin beyond its use in parasitic infections however, used has an important remedy in both Vattic and Kaphaja conditions, used in dryness of the bowels, constipation, colic and flatulence. No reports have been issued on its anti-inflammatory effects on intestinal epithelial cells or the mechanism involved. In the present study, we investigated whether the embelin from E. ribes extract of the fruits suppresses gut inflammation in an in vivo inflammatory model of bowel disease (IBD)-induced by DSS. 2. Materials and methods
Male Swiss albino mice weighing 28–30 g were purchased from C.L. Baid Mehta College, India. All mice were housed 2/cage and fed standard laboratory chow in the animal room with 12-h dark/light cycles and constant temperature of 20 ± 5 °C. All animal experiments were conducted under university guideline and approved by ethical committee for Animal Care and Use of the Madras University according to an animal protocol. 2.5. Induction of colitis Experimental colitis was induced by giving mice drinking water ad libitum containing 5% (w/v) DSS for 7 days. Mice of each of the groups were monitored carefully every day to confirm that they consumed an approximately equal volume of DSS-containing water. For each experiment, mice were divided into six experimental groups. The first group was kept as vehicle-treated control and treated with saline as the same routes embelin, and the second group was given drinking water with DSS only throughout the experimental period. Other 4 groups consisted of mice receiving 5% DSS were administrated embelin (10, 30, 50 mg/kg/day p.o.) or 5-ASA (75 mg/kg/day p.o.) daily for 7 days according to experimental design. All materials were dissolved in vehicle (0.5% sodium carboxymethyl cellulose). Control groups were given vehicle daily for 7 days as appropriate. Administration of each drug was started with the DSS treatment at the same time. The experiments were conducted two times with six mice in each group.
2.1. Plant materials 2.6. Evaluation of disease activity index (DAI) Dry fruits of E. ribes (Myrsinaceae) were collected from PERD Centre, Ahmedabad, and Gujarat, India. The plant was authenticated by comparing with the herbarium voucher specimen deposited at Presidency College Madras University Herbarium (Specimen No. PBPB-26). The material was air dried in shade, powdered mechanically and stored in airtight containers. One kilogram of the powdered material was refluxed with ethanol in a soxhlet apparatus for 48 h in batches of 250 g each. The extract was filtered, pooled and the solvent was removed under reduced pressure at 40 ± 50 C using rotary flash evaporator and the yield was 5.27 g.
Body weight, stool consistency and gross bleeding were recorded daily. Disease activity index (DAI) was determined by combining scores of (i) body weight loss, (ii) stool consistency and (iii) gross bleeding, divided by 3. Each score was determined as follows: change in body weight loss (0: none, 1: 1–5%, 2: 5–10%, 3: 10–20%, 4: N20%), stool blood (0: negative, 1: +, 2: ++, 3: +++, 4: ++++) and stool consistency (0: normal, 1 and 2: loose stool, 3 and 4: diarrhea). Body weight loss was calculated as the percent difference between the original body weight (day 0) and the body weight on any particular day. At the end of the experiment, mice were killed and the colons
2.2. Isolation The Coarse powder of dry fruits of E. ribes was extracted exhaustively with n-hexane and the extract so obtained was chromatographed on silica gel column and eluted successively using chloroform and ethanol in the ratio of 1:1. The eluted fractions were collected at an interval of 5 ml each and were monitored by thin layer chromatography and grouped in to five fractions. Fraction two recovered in higher concentration was recrystallized from chloroform to get an orange red needle-like aromatic compound. The structure was confirmed by IR, 1H NMR and mass spectral studies. 2.3. Chemicals and reagents DSS was purchased from MP biomedical (MW; 36,000–50,000, MP Biomedical, Solon, OH). iNOS, β-actin monoclonal antibodies, and peroxidase-conjugated secondary antibody were purchased from Santa Cruz Biotechnology, Inc. (Santa Cruz, CA, USA).The enzyme immunoassay (EIA) kits for TNF-α, IL-1β and IL-6 were obtained from R&D Systems (Minneapolis, MN,USA). Random oligonucleotide Primers and M-MLV reverse transcriptase were purchased from Promega (Madison, WI, USA). Dntp Mix and SYBR green ex Taq were obtained from TaKaRa (Seoul, Korea). TNF-α, IL-1β and IL-6 β-actin oligonucleotide primers were purchased from Bioneer (Seoul, Korea). 5-Aminosalicylicacid (5-ASA) and all other chemicals were purchased from Sigma Chemical Co. (St. Louis, MO, USA).
Fig. 2. Oral administration (p.o.) of embelin ameliorated DSS-induced colitis in mice. Mice were administered 5% DSS in drinking water (ad libitum) for 7 days with or without embelin (10, 30, 50 mg/kg/day p.o. upto7 days), alone. 5-ASA (75 mg/kg/day p.o.) was used as a positive control. Changes in disease activity index level were evaluated daily throughout the 7-day experimental period. Values are the mean± SD of three independent experiments. #P b 0.05 vs. the vehicle-treated control group; *P b 0.05, **P b 0.01, ***P b 0.001 vs. the DSS-induced colitis groups; significance group; significances between treated groups were determined using ANOVA and Dunnett's post hoc test.
726
K. Kumar G. et al. / International Immunopharmacology 11 (2011) 724–731
homogenized in lysis buffer (10mMTris pH 7.4, 200 mM NaCl, 5 mM EDTA,10% glycerol,1 mM PMSF,1 μg/ml leupeptide and 28 μg/ml aprotonine).The homogenate was then centrifuged at 1500×g for 15 min, and the resulting supernatant assayed for MPO assay using EIA kits (Hycult Biotechnology, India). 2.9. Western blot analysis Segments of colon were homogenized by homogenizer and washed once with phosphate-buffered saline (PBS). The washed pellets were resuspended in extraction lysis buffer (50 mM HEPES pH7.0, 250 mM NaCl, 5 mM EDTA, 0.1% Nonidet P-40, 1 mM phenylmethylsulfonyl fluoride, 0.5 mM dithiothreitol, 5 mM Na fluoride, and 0.5 mM Na orthovanadate) containing μg/ml each of leupeptin and aprotinin and incubated with 20 min at 4 °C. Cell debris was removed by micro-centrifugation, followed by quick freezing of the supernatants. The protein concentration was determined using the Bio-Rad protein assay reagent according to the manufacturer's instruction. Forty micrograms of cellular protein from treated and untreated cell extracts was electroblotted onto a PVDF membrane following separation on a 10% SDS-polyacrylamide gel electrophoresis. The immunoblot was incubated for 1 h with blocking solution (5% skim milk) at RT, followed by incubation overnight with a primary antibody. Blots were washed four times with Tween 20/Tris-buffered saline (TTBS) and incubated with a 1:1000 dilution of horseradish peroxidase-conjugated secondary antibody for 2 h at room temperature. Blots were again washed three times with TTBS, and then developed by enhanced chemiluminescence (Amersham Life Science). The intensity of the bands was quantified using ImageJ software. 2.10. Measurement of NO and cytokines Fig. 3. Embelin shortened colon lengths and increased spleen weights in mice with DSSinduced colitis. Mice were administered 5% DSS in drinking water (ad libitum) for 7 days with or without embelin (10, 30, 50 mg/kg/day p.o. up to 7 days), 5-ASA (75 mg/ kg/day p.o.) was used as a positive control. On day 7, mice were sacrificed and colons and spleens removed, the change of colon lengths measured (A), and spleen weights were recorded (B). Values are the mean ± SD of three independent experiments. # P b 0.05 vs. the vehicle-treated control group; *P b 0.05, **P b 0.01, ***P b 0.001 vs. the DSS-induced colitis group; significances between treated groups were determined using ANOVA and Dunnett's post hoc test.
were separated from the proximal rectum, close to its passage under the pelvisternum. The colon length was measured between the ileocecal junction and the proximal rectum. The spleens were also obtained and their weight was measured. 2.7. Histopathology The resected large intestine was grossly examined for the mucosal defect, hemorrhage, or ulcerative lesions, and then fixed immediately in 4% neutral formalin. For histopathological analysis, tissue sections were made from the representative region of large intestine by the conventional tissue preparation methods, and viewed under the light microscope (100×) after hematoxylin and eosin (H&E) staining. 2.8. Myeloperoxidase assay MPO accumulation was measured in soft tissue from colon, as a marker of neutrophil influx into the tissue. The tissue was thawed and
Colon tissues corresponding to the mid-colon were washed with DMEM medium containing 2% FBS and penicillin and streptomycin before cut into smaller pieces. Then 0.5 cm of tissue was placed 1 ml of DMEM medium containing 0.2% FBS, distributed into 48-well plate, incubated 24 h at 37°C in 5% CO2. The cell-free culture supernatants of the colon tissue were using to measure NO and cytokines [45]. Nitrite levels in culture media were determined using the Griess reaction assay and presumed to reflect NO levels [44]. Briefly, 100 μl of cell-free supernatant was mixed with 100 μl of Griess reagent [equal volumes of 1% (w/v) sulfanilamide in 5%(v/v) phosphoric acid and 0.1%(w/v) naphtylethylenediamine–HCl], incubated at room temperature for10 min, and then the absorbance at 540 nm was measured in a microplate reader (Perkin Elmer Cetus Foster City, CA, USA).Fresh culture medium was used as the blank in all experiments. The amount of nitrite in the samples was measured with the serial dilution standard curve of sodium nitrite. Also, levels of TNF-α, IL-1β and IL-6 in the culture media were quantified using EIA kits (R&D Systems, Minneapolis, MN, USA). 2.11. Quantitative real-time reverse-transcriptase polymerase chain reaction (RT-PCR) The total RNA from the colon homogenates was isolated with RNeasy mini kit (Qiagen, Valencia, CA, and USA). From each sample, 1 μg of RNA was reverse-transcribed (RT) using MuLV reverse transcriptase, 1 mM deoxyribonucleotide triphosphate (dNTP), and oligo (dT 12–18) 0.5 μg/μl. PCR amplification was performed using the incorporation of SYBR green. The oligonucleotide primers for TNF-α designed from
Fig. 4. Effects of embelin on colorectal histology and on MPO activities in mice with DSS-induced colitis. (A) Representative sections of colonic tissues from mice administered 5% DSS in drinking water (ad libitum) for 7 days with embelin (50 mg/kg/day p.o. upto 7 days). 5-ASA (75 mg/kg/day p.o.) was used as a positive control. Histological changes were determined by H&E staining. (B) Colon segments from mice treated with DSS (2%, dissolved in drinking water) and embelin (10, 30, 50 mg/kg/day p.o.) or 5-ASA (75 mg/kg/day p.o.) were used to determine MPO levels. Values are the mean ± SD of three independent experiments. #P b 0.05 vs. the vehicle-treated control group; *P b 0.05, **P b 0.01, ***P b 0.001 vs. theDSS-induced colitis group; significances between treated groups were determined using ANOVA and Dunnett's post hoc test.
K. Kumar G. et al. / International Immunopharmacology 11 (2011) 724–731
727
728
K. Kumar G. et al. / International Immunopharmacology 11 (2011) 724–731
mouse (Genbank ID: NM_013693.2) were AGCACA GAAAGCATGATCCG (forward) and CTGATGAGAGGGAGGCCATT (reverse), for IL-1β (Genbank ID: NM_008361.3) were ACCTGCTGGTGTGTGACGTT (forward) and TCGTTGCTTGGTT CTC-CTTG (reverse), for IL-6 (Genbank ID: NM_031168) were GAGGATACCACTCCCAACAGACC (forward) and AAGTGCATCATCGTTGTT CAT ACA (reverse) and the suitable size of synthesized cDNA were 220, 187 and 142 bp, respectively. The oligonucleotide primers for β-actin used as a house-keeping gene designed from mouse (Genbank ID: NM_007393) were ATCACTATTGGCAACG-AGCG (forward) and TCAGCAATGCCTGGGTACAT (reverse), and the suitable size of synthesized cDNA were 200 bp. Steady-state mRNA levels of TNF-α, IL-1β, IL-6, and β-actin were determined by real-time quantitative PCR (qPCR) using the Light cycler1.5 (Roche Diagnostics, Germany). The results were expressed as the ratio of optimal density to β-actin. 2.12. Statistical analyses Results are expressed as the mean ± SEM. Statistical analysis was performed using one-way ANOVA followed by Dunnett's post hoc test. P b 0.05 was considered statistically significant.
the rectum with reducing proximal severity [39]. Pathological examinations of colons and rectums were carried out after H&E staining and representative results are shown in Fig. 3A. Tissue sections from representative areas of large intestine showed decreases in crypts epithelium distortion and in the mucosal and submucosal infiltrations of acute and chronic inflammatory cells, which significantly reduced histopathological scores. Interestingly, crypts structures were rather well-preserved and inflammatory reactions were significantly lower in tissue samples from mice with DSS-induced colitis treated with embelin (50 mg/kg) or 5-ASA (75 mg/kg) than vehicle-treated control mice. Myeloperoxidase (MPO) is an enzyme found in neutrophils and in much smaller quantities in monocytes and macrophages. Furthermore, MPO activity reflects degree of neutrophil infiltration, a marker of acute inflammation [20]. Our histopathological study indicated that one mechanism underlying the protective effects of embelin involved a reduction in inflammatory cell infiltration into colonic mucosa. Thus, colon inflammation was quantitatively assayed by determining MPO levels in colonic tissues. We found that an elevated MPO level was correlated with the development of colonic inflammation and that the administration of embelin (50 mg/kg) or 5-ASA (75 mg/kg) significantly suppressed MPO accumulation in the colonic tissues of mice with DSSinduced colitis (Fig. 4A and B).
3. Results 3.1. Embelin attenuated the severity of DSS-induced acute colitis In Swiss albino mice with DSS-induced acute colitis, which resembles the acute phase of human ulcerative colitis, a combinatorial DAI, which incorporated body weight loss, stool consistency, and gross bleeding, was used to analyze the therapeutic effects of embelin, 5-ASA (75 mg/kg) was used as a positive control. DSS (5%) administration was found to be associated with significant clinical changes, which included weight loss, diarrhea, and the appearance of occult fecal blood in untreated mice. Treatment with embelin (10, 30, or 50 mg/kg/day, p.o. for 7 days) dose-dependently suppressed these pathological conditions and significantly reduced intestinal inflammation (Fig. 2). In particular, the administration of embelin at 50 mg/ kg/day, p.o. for 7 days had a better therapeutic effect than 5-ASA at 75 mg/kg/day, p.o. for 7 days. 3.2. Embelin prevented the colonic shortening and spleen enlargement induced by DSS It is generally accepted that colon length is inversely associated with the severity of DSS-induced colitis. To determine whether embelin has a beneficial effect on DSS-induced colonic shortening, we measured and compared the colon lengths of vehicle-treated control mice, mice with DSS-induced colitis, 5-ASA-treated mice with DSS-induced colitis, embelin (10, 30, or 50 mg/kg) treated mice with DSS-induced colitis. While the significant shortening of colon length was observed in mice with DSS-induced colitis as compared with vehicle-treated controls (10.01±0.78 cm vs. 5.76±0.71 cm Pb 0.001), oral administration of embelin reduced this shortening of colon length in a dose-dependent manner; mice with DSS-induced colitis versus 5-ASA (75 mg/kg) treated mice with DSS-induced colitis (5.76±0.71 cm vs. 8.86±0.96 cm, Pb 0.05), mice with DSS-induced colitis versus embelin (30 mg/kg) treated mice with DSS-induced colitis(6.76±0.76 cm vs.76.96±6.71 cm, Pb 0.05), and mice with DSS-induced colitis versus embelin (50 mg/kg) treated mice with DSS-induced colitis (5.76±0.71 cm vs. 8.90±1.08 cm, Pb 0.001) (Fig. 3A and B). 3.3. Embelin decreased histological changes and elevated MPO levels in mice with DSS-induced colitis Consistent with the previous findings, histological changes in the colons of mice with DSS-induced colitis showed mucosal inflammation in
3.4. Embelin inhibited NO production and iNOS expression in mice with DSS-induced colitis Nitric oxide (NO) production and the expression of inducible nitric oxide synthase (iNOS) in intestinal mucosa appear to be enhanced in active ulcerative colitis, and when present in excess, these play proinflammatory role [16]. Interestingly, several iNOS inhibitors have been shown to protect mice effectively from colitis [21, 22]. Therefore, we evaluated the effect of embelin on NO production and iNOS expression in mice with DSS-induced colitis and compared findings with those of untreated mice with DSS-induced colitis and vehicletreated controls. As shown in Fig. 5A, the oral administration of embelin significantly inhibited DSS-induced NO production in mice at day 7 after DSS treatment. Next, we examined the effect of embelin on the expression of iNOS in colon by Western blotting. The expression of iNOS was found to be remarkably induced in the colons of mice with DSS-induced colitis, and embelin significantly and dose-dependently reduced this iNOS expression (Fig. 5B). 3.5. Embelin suppressed the production and the mRNA expressions of inflammatory cytokines in mice with DSS-induced colitis Several reports have concluded that colonic inflammation due to the aberrant activations of intestinal immune cells causes excessive proinflammatory cytokine secretion [9, 23, 36]. In particular, the bindings of TNF-α, IL-1β, and IL-6 to intestinal immune cells amplify immune response by enhancing the proliferation of T cells, and thus, promoting leukocyte infiltration and facilitating cell–cell signaling [30]. Accordingly, we investigated the suppressive effect of embelin in mice with DSSinduced colitis. Using enzyme immunoassays and real-time PCR, we evaluated the production and the mRNA expressions of pro-inflammatory cytokines in embelin treated mice with DSS-induced colitis and compared these with those of untreated mice with DSS-induced colitis and vehicletreated controls. DSS administration was found to induce TNF-α, IL-1β, and IL-6 levels significantly, and embelin (50 mg/kg) reduced these increases by 45.7%, 54.5%, and 49.5%, respectively (Fig. 6A–C). To gain further insight of the molecular mechanisms underlying the suppression of colitis by embelin, we measured the mRNA expression levels of these inflammatory cytokines in colon by qRT-PCR. As shown in (Fig. 7A–C), colonic tissues treated with DSS alone showed elevated TNF-α, IL-1β, and IL-6 mRNA expressions up to 14.2-, 12.9-, and 13.4-fold over basal levels, respectively. Furthermore, these mRNA expressions were dose-dependently reduced by embelin.
K. Kumar G. et al. / International Immunopharmacology 11 (2011) 724–731
Fig. 5. Effects of embelin on NO production and iNOS expression in mice with DSSinduced colitis. Mice were administered 5% DSS in drinking water (ad libitum) for 7 days with embelin (10, 30, 50 mg/kg/day p.o. upto 7 days), 5-ASA (75 mg/kg/day p.o.) was used as a positive control. (A) Nitrite levels in culture media were determined using Griess reaction assays and (B) Western blotting was performed to detect iNOS expression using Image J software. Values are the mean ± SD of three independent experiments. #P b 0.05 vs. the vehicle-treated control group; *P b 0.05, **P b 0.01, ***P b 0.001 vs. the DSS-induced colitis group; significances between treated groups were determined using ANOVA and Dunnett's post hoc test.
729
Fig. 6. Effects of embelin on the productions of pro-inflammatory cytokines (TNF-α, IL-1β, and IL-6) in the colonic tissues of mice with DSS-induced colitis. Mice were administered 5% DSS in drinking water (ad libitum) for7 days with embelin (10, 30, 50 mg/kg/day p.o. up to 7 days). 5-ASA (75 mg/kg/day p.o.) was used as a positive control. The productions of (A) TNF-α, IL-1β and (C) IL-6 were determined. Values are the mean ± SD of three independent experiments. #P b 0.05 vs. the vehicle-treated control group; *P b 0.05, **P b 0.01, ***P b 0.001 vs. the DSS-induced colitis group; significances between treated groups were determined using ANOVA and Dunnett's post hoc test.
4. Discussion Crohn's disease (CD) and ulcerative colitis (UC), which belong to the group of inflammatory bowel disease (IBD), are chronic inflammatory disorders of the gastrointestinal tract with profound emotional and social impacts profound emotional and social impacts
730
K. Kumar G. et al. / International Immunopharmacology 11 (2011) 724–731
Fig. 7. Effect of embelin on the mRNA expressions of pro-inflammatory cytokines (TNF-α, IL-1β, and IL-6) in mice with DSS-induced colitis. Mice were administered 5% DSS in drinking water (ad libitum) for 7 days with embelin (10, 30, 50 mg/kg/day p.o. upto 7 days). 5-ASA (75 mg/kg/day p.o.) was used as a positive control. The mRNA expressions of TNF-α, IL-1β, and IL-6 were determined as described. Values are the mean ± SD of three independent experiments. #P b 0.05 vs. the vehicle-treated control group; *P b 0.05, **P b 0.01, ***P b 0.001 vs. the DSS-induced colitis group; significances between treated groups were determined using ANOVA and Dunnett's post hoc test.
[2] and in addition dysregulated inflammation to the intestinal track, contributes to colon cancer [9]. While the cause of ulcerative colitis is still unknown, several, possibly interrelated, causes have been suggested including genetic, environmental and autoimmune factors. Although UC is generally treated with anti-inflammatory or immunosuppressive drugs, most of these treatments often prove to be
inadequate. Consequently, many patients turn to alternative strategies, including traditional plant-based remedies. This study is focused mainly on identifying the treatment strategies which effectively attenuate the mucosal inflammation associated with fewer side effects. A previous clinical study found that a decoction of E. ribes was effective at treating variety of gastrointestinal ailments for thousands of years [15]. Based on the ethnopharmacological uses of embelin, we investigated the anti-inflammatory effects of a in an in vivo model of inflammatory bowel disease (IBD) induced by dextran sulfate sodium (DSS) in Balb C mice. This model exhibits symptoms comparable to those of human ulcerative colitis [32], such as body weight loss, diarrhea, bloody feces, mucosal ulceration, and colonic shortening [27, 42]. We administered embelin orally during DSS consumption (co-administration) and assessed clinical colitis using body weight loss, stool consistency, and stool blood. Finally, we evaluated the therapeutic effects of embelin. Our findings demonstrate that embelin significantly suppresses DSS-induced colitis in mice, and that it improves body weight, stool consistency, and decreases intestinal bleeding. In the present study, 5ASA was used as a reference drug. The active component from E. ribes was isolated and named embelin [13] and later chemically synthesized [10]. Embelin has been shown to have antitumor, antiinflammatory, and analgesic properties [6]. Embelin administration was found to attenuate the colonic shortening and spleen size enlargement induced by DSS, and to markedly reduced neutrophil and macrophage infiltration into the colonic tissues of mice with DSSinduced colitis. Histopathologic findings were in line with our DAI data. The colons of mice treated with DSS presented more severe acute and chronic inflammatory cell infiltration, mucosal erosion, and distortion and loss of crypts. Embelin reduced all of these inflammatory changes, and thus, ameliorated the inflammatory condition. MPO, a member of the hemeperoxidase cyclooxygenase super-family, is abundantly expressed in neutrophils, and to a lesser extent in monocytes and certain types of macrophages, and thus, is a specific biomarker of inflammation [29]. In IBD, oxidative stress is believed to be a major cause of tissue destruction [24]. Furthermore, several reports have suggested that reactive oxygen and nitrogen metabolites are involved in the initiation and progression of IBD [5, 8]. In a previous study, the severity of DSS-induced colitis was found to be significantly attenuated in iNOS knockout and specific iNOS inhibitor treated mice [23]. In our DSS-induced colitis experiment, embelin diminished NO production and iNOS expression in the colonic tissues of DSS treated mice (Fig. 4A and B), which provides a clue as to how embelin has an anti-inflammatory effect on mice with DSS-induced colitis. The hyperactivation of immune cells is another important factor of IBD progress, and is known to produce high levels of pro-inflammatory cytokines like TNF-α, IL-6 and IFN-γ, which are known to damage the colon [14, 19, 34]. Cytokines are important mediators of inflammation, and elevated levels of pro-inflammatory cytokines are observed not only in the inflamed gut of IBD patients but also in animals with DSSinduced colitis [11, 33]. TNF-α is considered to be one of the most important proinflammatory cytokines, and directly influences intestinal epithelial tissues. For example, TNF-α disrupts the epithelial barrier, and induces the apoptosis of epithelial cells and the secretions of chemokines from intestinal epithelial cells. It also activates the adaptive immune system of the bowel by recruiting and activating neutrophils and macrophages [3, 17, 31]. Infliximab, an anti-TNF-α mouse monoclonal antibody, has been found to have therapeutic effects on ulcerative colitis during clinical studies, and has been used as a practical remission of IBD [26, 28]. However, the mechanisms underlying iNOS and TNF-α induction in IBD remain unclear, although the inhibition of TNF-α release was found to iNOS and subsequent colonic damage and inflammation in a murine colitis model [7]. In addition, IL-1β and IL-6 are key mediators of the progression of IBD. IL-1β receptor antagonist was found to suppress the infiltration of
K. Kumar G. et al. / International Immunopharmacology 11 (2011) 724–731
inflammatory cells into the large intestine, the MPO activities of cells in areas of edema, and large intestine necrosis in animals with acute experimental colitis [12, 40]. In addition, anti-murine IL-1β antibody was found to attenuate not only the pathological symptoms of DSSinduced colitis but also IL-6 mRNA expression [25]. These findings indicate that reduction of pro-inflammatory cytokines offers an effective approach to the prevention and treatment of IBD. In the present study, it was observed that the levels of pro-inflammatory cytokines, like TNF-α, IL-1β, and IL-6, were elevated in the colonic tissues of mice with DSS-induced colitis. Furthermore, the administration of embelin greatly reduced these cytokines production as well as mRNA level. These results show that embelin ameliorates colitis by suppressing pro-inflammatory mediators, such as, TNF-α, IL-1β, and IL-6, in the colonic tissues of mice with DSS-induced colitis. Results of this study suggest the potent anti-inflammatory effects of embelin in DSS-induced colitis model are mediated via the inhibition of pro-inflammatory mediator production. Furthermore, embelin (50 mg/kg) was found to have better therapeutic effects than 5-ASA (75 mg/kg), which is currently used to treat IBD. However, further studies are required to elucidate the mechanism responsible for therapeutic effects of embelin. Acknowledgments We sincerely thank Mr. A. Pradeep Kumar (Kan Health Care), for providing sample kits for our research work to carry out Western blot and ELISA; Mr. Saravanan Biosys Ltd., Chennai, for providing lab space to carry out cell culture work; and Prof. Venkataraman, Director C.L. Baid Mehta College, Chennai, for providing facility for animal studies. References [1] Ardizzone and Bianchi Porro. Biologic therapy for inflammatory bowel disease. Drugs 2005;65:2253–86. [2] Asakura H. Ulcerative colitis and intestinal bleeding. Nippon Rinsho 1998;56: 2354–9. [3] Bischoff S, Lorentz A, Schwengberg S, Weier G, Raab R, Manns MP. Mast cells are an important cellular source of tumour necrosis factor alpha in human intestinal tissue. Gut 1999;44:643–52. [4] Blumberg RS, Saubermann LJ, Strober W. Animal models of mucosal inflammation and their relation to human inflammatory bowel disease. Curr Opin Immunol 1999;11:648. [5] Boughton-Smith N. Pathological and therapeutic implications for nitric oxide in inflammatory bowel disease. J R Soc Med 1994;87:312–4. [6] Chitra M, Sukumar E, Suja V, Devi CS. Antitumor, anti-inflammatory and analgesic property of embelin, a plant product. Chemotherapy 1994;40:109–13. [7] Colon A, Menchen LA, Hurtado O, De Cristobal J, Lizasoain I, Leza JC, et al. Implication of TNF-alpha convertase (TACE/ADAM17) in inducible nitric oxide synthase expression and inflammation in an experimental model of colitis. Cytokine 2001;16:220–6. [8] Cross R, Wilson KT. Nitric oxide in inflammatory bowel disease. Inflamm Bowel Dis 2003;9:179–89. [9] Cuzzocrea S. Emerging biotherapies for inflammatory bowel disease. Expert Opin Emerg Drugs 2003;8:339–47. [10] Dallacker F, Lohnert G. Derivatives of methylene dioxybenzene, a novel synthesis of 3,6 dihydroxy-2-ethyl-1,4-benzoquinone, embelin, vilangin, rapanone, dihydromaesa quinone, bhogatin, spinulosin and oosporein. Chem Ber 1972;105: 614–24. [11] Dieleman L, Palmen MJ, Akol H, Bloemena E, Pena AS, Meuwissen SG, et al. Chronic experimental colitis induced by dextran sulphate sodium (DSS) is characterized by Th1 and Th2 cytokines. Clin Experi mental Immunol 1998;114:385–91. [12] Dionne S, D'Agata ID, Hiscott J, Vanounou T, Seidman EG. Colonic explant production of IL-1and its receptor antagonist is imbalanced in inflammatory bowel disease (IBD). Clin Exp Immunol 1998;112:385–91. [13] Du Y, Wie JS. Study of vermifuges. Isolation of embelin from the fruit of muguawha(Embelia oblongifolia hems). Yao Xue Xue Bao 1963;10:578–80. [14] Fiocchi C. Inflammatory bowel disease: etiology and pathogenesis. Gastroenterology 1998;115:182–5. [15] Gupta Ali MM, Ray Ghatak BJ, Atal CK. Some pharmacological investigations of embelin and its semi synthetic derivatives. Indian J Physiol Pharmacol 1977;21: 31–9.
731
[16] Guslandi M. Nitric oxide and inflammatory bowel diseases. European Journal of Clinical Investigation; 28:904–907. [17] Guy-Grand D, DiSanto JP, Henchoz P, Malassis-Seris M, Vassalli P. Small bowel enteropathy: role of intraepithelial lymphocytes and of cytokines (IL-12, IFNgamma, TNF) in the induction of epithelial cell death and renewal. Eur J Immunol 1998;28:730–44. [18] Hanauer S. Inflammatory bowel disease. N Engl J Med 1996;334:841–8. [19] Hendrickson BA, Gokhale R, Cho JH. Clinical aspects and pathophysiology of inflammatory bowel disease. Clin Microbiol Rev 2002;15:79–85. [20] Islam M, Murata T, Fujisawa M, Nagasaka R, Ushio H, Bari AM, et al. Antiinflammatory effects of phytosteryl ferulates in colitis induced by dextran sulphate sodium in mice. Br J Pharmacol 2008;154:812–24. [21] Kankuri E, Hamalainen M, Hukkanen M, Salmenpera P, Kivilaakso E, Vapaatalo H, et al. Suppression of pro-inflammatory cytokine release by selective inhibition of inducible nitric oxide synthase in mucosal explants from patients with ulcerative colitis. Scand J Gastroenterol 2003;38:186–92. [22] Kankuri E, Vaali K, Knowles RG, Lahde M, Korpela R, Vapaatalo H, et al. Suppression of acute experimental colitis by a highly selective inducible nitric-oxide synthase inhibitor, N-[3-(aminomethyl)benzyl]acetamidine. J Pharmacol Exp Ther 2001;298:1128–32. [23] Krieglstein C, Cerwinka WH, Laroux FS, Salter JW, Russell JM, Schuermann G, et al. Regulation of murine intestinal inflammation by reactive metabolites of oxygen and nitrogen: divergent roles of superoxide and nitric oxide. J Exp Med 2001;194: 1207–18. [24] Kruidenier L, Verspaget HW. Review article: oxidative stress as a pathogenic factor in inflammatory bowel disease radicals or ridiculous? Aliment Pharmacol Ther 2002;16:1997–2015. [25] Kwon K, Murakami A, Hayashi R, Ohigashi H. Interleukin-1beta tar- gets interleukin-6 in progressing dextran sulfate sodium-induced experimental colitis. Biochem Biophys Res Commun 2005;337:647–54. [26] Lawson M, Thomas AG, Akobeng AK. Tumor necrosis factor alpha blocking agents for induction of remission in ulcerative colitis. Cochrane Database Syst Rev 2006;3:CD005112. [27] Lee S, Lim KT. Glycoprotein isolated from Ulmus davidiana Nakai regulates expression of iNOS and COX-2 in vivo and in vitro. Food Chem Toxicol 2007;45:990–1000. [28] Levin A, Shibolet O. Infliximab in ulcerative colitis. Biologics 2008;2:379–88. [29] Malle E, Furtmuller PG, Sattler W, Obinger C. Myeloperoxidase: a target for new drug development? Br J Pharmacol 2007;152:838–54. [30] Neuman M. Signaling for inflammation and repair in inflammatory bowel disease. Rom J Gastroenterol 2004;13:309–16. [31] Nilsen EM, Johansen FE, Jahnsen FL, Lundin KE, Scholz T, Brandtzaeg P, et al. Cytokine profiles of cultured microvascular endothelial cells from the human intestine. Gut 1998;42:635–42. [32] Okayasu I, Hatakeyama S, Yamada M, Ohkusa T, Inagaki Y, Nakaya R. A novel method in the induction of reliable experimental acute and chronic ulcerative colitis in mice. Gastroenterology 1990;98:694–702. [33] Pullman W, Elsbury S, Kobayashi M, Hapel AJ, Doe WF. Enhanced mucosal cytokine production in inflammatory bowel disease. Gastroenterology 1992;102:529–37. [34] Rojas-Cartagena C, Flores I, Appleyard CB. Role of tumor necrosis factor receptors in an animal model of acute colitis. Cytokine 2005;32:85–93. [35] Russel MG. Changes in the incidence of inflammatory bowel disease: what does it mean? Eur J Intern Med 2000;11:191–6. [36] Sartor R. Pathogenesis and immune mechanisms of chronic inflammatory bowel diseases. Am J Gastroenterol 1997;92:11S. [37] Sreepriya MaB G. Chemopreventive effects of embelin and curcumin against N-nitroso diethylamine/phenobarbital-induced hepatocarcinogenesis in Wistar rats. Fitoterapia 2005;76:549–55. [38] Strober W, Fuss IJ, Blumberg RS. The immunology of mucosal models of inflammation. Annu Rev Immunol 2002;20:495–500. [39] Tanaka FK, Ochi M, Tanigawa T, Watanabe T, Fujiwara Y, Ohta K, et al. Exogenous administration of mesenchymal stem cells ameliorates dextran sulfate sodiuminduced colitisvia anti-inflammatory action in damaged tissue in rats. Life Sci 2008;83:771–9. [40] Tountas N, Casini-Raggi V, Yang H, Di Giovine FS, Vecchi M, Kam L, et al. Functional and ethnic association of allele 2 of the interleukin-1 receptor antagonist gene in ulcerative colitis. Gastroenterology 1999;117:806–13. [41] Vuorelaa PLM, Saikkuc P, Tammelaa P, Rauhad JP, Wennberge T, Vuorela H. Natural products in the process of finding new drug candidates. Curr Med Chem 2004;11:1375–89. [42] Wirtz S, Neurath MF. Mouse models of inflammatory bowel disease. Adv Drug Deliv Rev 2007;59:1073–83. [43] Xu C, Meng SY, Pan BR. Drug therapy for ulcerative colitis. World J Gastroenterol 2004;10:2311–7. [44] Kim JY, Park SJ, Yun KJ, Cho YW, Park HJ, Lee KT. Isoliquiritigenin isolated from the roots of Glycyrrhiza uralensis inhibits LPS-induced iNOS and COX-2 expression via the attenuation of NF-kappaB in RAW264.7 macrophages. Eur J Pharmacol 2008;584:175–84. [45] Kim YH, Kwon HS, Kim DH, Shin EK, Kang YH, Park JH, Shin HK, Kim JK. 3,3Diindolylmethane attenuates colonic inflammation and tumorigenesis in mice. Inflamm Bowel Dis 2009;15:1164–73.