- Email: [email protected]
Enhanced growth performance, immune responses, immune-related gene expression and disease resistance of red swamp crayfish (Procambarus clarkii) fed dietary glycyrrhizic acid
Aquaculture 533 (2021) 736202
Contents lists available at ScienceDirect
Aquaculture journal homepage: www.elsevier.com/locate/aquaculture
Enhanced growth performance, immune responses, immune-related gene expression and disease resistance of red swamp crayfish (Procambarus clarkii) fed dietary glycyrrhizic acid Fei Liu a, b, Gui-Yan Shao a, Qing-Qing Tian a, Bo-Xing Cheng c, *, Chen Shen a, Ai-Ming Wang a, *, Jia-Hong Zhang d, Hong-Yan Tian a, Wen-Ping Yang a, Ye-Bing Yu a a
Department of Marine Science and Technology, School of Marine and Bioengineering, Yancheng Institute of Technology, Yancheng 224051, PR China Hunan Provincial Key Laboratory of Nutrition and Quality Control of Aquatic Animals, Department of Biological and Environmental Engineering, Changsha University, Changsha 410022, PR China c School of Biological Sciences, Guizhou Education University, Guiyang, China d Agricultural Science Institute of Lixiahe District, Jiangsu Province, Yangzhou 225007, PR China b
A R T I C L E I N F O
A B S T R A C T
Keywords: Glycyrrhizic acid Procambarus clarkia Growth performance Immune responses Disease resistance
Glycyrrhizic acid (GA) is an effective antiviral agent and is widely used in humans and animals. However, while the impact of disease on crustaceans is increasingly serious, research on the application of GA in crustaceans is very rare. The effects of GA on the growth performance, immune response, immune-related gene expression and disease resistance of crayfish were studied. A total of 900 healthy and equal weight crayfish were randomly divided into six groups for a feeding experiment, which lasted 60 days: the GA25, GA50, GA75, GA100 and GA150 groups were fed a basal diet supplemented with 25, 50, 75, 100 and 150 mg⋅kg− 1 GA, respectively, and the control group was fed a basal diet. The results showed that the crayfish in the groups supplemented with 75 to 100 mg⋅kg− 1 GA had an increased final body weight (FBW), weight gain (WG) and specific growth rate (SGR) and decreased feed conversion ratio (FCR) compared with the controls (P < 0.05). The total hemocyte count (THC) and phenoloxidase (PO) content in the hemolymph of crayfish in the groups supplemented with 75 to 100 mg⋅kg− 1 GA were significantly increased compared with those in the control group. Additionally, the total antioxidant capacity (T-AOC) and the total superoxide dismutase (T-SOD), glutathione peroxidase (GPX), acid phosphatase (ACP) and alkaline phosphatase (AKP), and lysozyme (LZM) in the hemolymph and hepatopancreas of crayfish were significantly increased, while the content of malondialdehyde (MDA) and reactive oxygen species (ROS) were significantly decreased in the groups supplemented with 50 to 150 mg⋅kg− 1 GA compared with the control group (P < 0.05). Furthermore, supplementation with 50 to 100 mg⋅kg− 1 GA downregulated the expression of bax and upregulated the expression of bax inhibitor-1 (bi-1), toll-like receptor (tlr), lectin, nuclear factor kappa-B (NF-κB) and heat shock protein 70 (hsp70) (P < 0.05). In addition, supplementation with 50–150 mg⋅kg− 1 GA could decrease the mortality of crayfish infected with white spot syndrome virus (WSSV). These results showed that growth performance, immune responses and immune-related gene expression can be improved by adding GA at the optimal dose of 50–150 mg⋅kg− 1 in crayfish.
1. Introduction
´ et al., 2007). GA can significantly improve (Kao et al., 2010; Raˇckova resistance to Enterococcus seriola infection in Seriola quinqueradiata (Edahiro et al., 1990) and significantly increase the respiratory burst activity of macrophages in rainbow trout (Jang et al., 1995). GA can also significantly increase growth performance and immune responses in Carassius auratus gibelio (Wang et al., 2007) and Apostichopus japonicus Selenka (Chen et al., 2010). However, few studies on the effects of GA on
Glycyrrhizic acid (GA), also known as glycyrrhizin, is an effective medicinal component extracted from Glycyrrhiza glabra. In mammals, GA can effectively improve resistance to diseases (Crance et al., 1994). GA has many pharmacological properties, such as antivirus, antiinflammatory, antiallergy, antiulcer and immunoregulatory effects
* Corresponding authors. E-mail addresses: [email protected] (B.-X. Cheng), [email protected] (A.-M. Wang). https://doi.org/10.1016/j.aquaculture.2020.736202 Received 31 August 2020; Received in revised form 14 November 2020; Accepted 22 November 2020 Available online 26 November 2020 0044-8486/© 2020 Elsevier B.V. All rights reserved.
F. Liu et al.
Aquaculture 533 (2021) 736202
the growth performance, immune responses and immune-related gene expression and disease resistance of crustaceans have been performed. Red swamp crayfish (Procambarus clarkii), commonly known as crayfish, is popular among consumers due to its delicious meat and rich nutrition. Crayfish is also an important aquaculture species in China, accounting for 70%–80% of the total output of freshwater crustaceans (Shen et al., 2014). In recent years, with the continuous expansion of artificial breeding areas, the occurrence of diseases is becoming increasingly frequent and serious. Among these diseases, white spot syndrome virus (WSSV) has become a fatal disease in crayfish aqua culture, causing very large losses to the breeding industry (Zhu et al., 2009). WSSV is a kind of double-stranded DNA virus with an envelope and no inclusion body, which can infect most freshwater aquatic animals of Crustacea and Insecta, including shrimp, crayfish, river crab and copepod. Similar to most crustaceans, crayfish mainly rely on nonspe cific immunity but lack an adaptive immune system (Loker et al., 2004). Traditionally, the prevention and treatment of crayfish diseases mainly depend on chemical drugs and antibiotics. Thus, the abuse of antibiotics and other drugs can easily cause many negative effects, such as drug residues, drug resistance in pathogenic microorganisms, environmental pollution, immunosuppression and destruction of organismal micro ecological balance, which seriously impair the cultivation of crayfish. Therefore, Chinese herbal extracts have become a new generation of feed additives to replace antibiotics (Liu et al., 2019). There are few studies on the effects of GA on the growth, anti oxidation, natural immunity and disease resistance of crayfish. There fore, we studied the effects of different doses of GA on the nonspecific immunity and antioxidant capacity of the hemolymph and hepatopan creas in crayfish to identify the optimal concentration of GA to improve the growth and disease resistance of crayfish. We also evaluated the expression of immune-related genes in the crayfish hepatopancreas to support the use of GA as an antioxidant and immunopotentiator. Our aim was to evaluate the effects of GA on the immune responses, immunerelated gene expression and WSSV infection of crayfish to find a kind of immunopotentiator suitable for crayfish feed and to provide a more theoretical basis for disease control.
Table 1 Basal diet and nutrient levels. Nutrient levels (%)c
Ingredients (% dry weight) Fish meal Soybean meal Rapeseed meal Cottonseed meal Soybean oil Flour Rice bran α-Starch Ca(H2PO4)2 Vitamin premixa Mineral premixb Lys Met
3.00 31.30 14.00 8.00 2.50 27.00 6.00 4.00 2.00 1.00 1.00 0.15 0.05
Crude protein Crude lipid Energy/(MJ⋅Kg− 1)
27.17 ± 0.32 5.97 ± 0.03 11.36 ± 0.15
Note a Vitamin premix supplementation of the diet with (mg⋅kg− 1 diet) the following compounds: retinyl acetate, 12,500 IU; vitamin D3, 2800 IU; vitamin K, 5.5; vitamin B1, 3.5; vitamin B2, 21; vitamin B12 0.4, DL-α-tocopherol ace tate, 65; calcium pantothenate, 48; inositol, 870; nicotinic acid, 200; biotin, 1.8; folic acid, 3.4. b Mineral premix (mg⋅kg− 1 diet): FeSO4⋅H2O, 80; CuSO4⋅5H2O, 10; MnSO4⋅H2O, 45; KI, 60; MgSO4⋅7H2O, 1200; ZnSO4⋅H2O, 50; CoCl2⋅6H2O, 50; Na2SeO3, 20. c Nutrient levels: protein, lipids and ash levels are presented as the mean percentages of dry matter (n = 3).
2.2. Sample collection At the end of the 60-day experiment, the crayfish in each pool were not fed for 24 h. Prior to batch sampling, each individual crayfish was compressed in ice for 10 min to induce hypothermic anesthesia and weighed to calculate various growth performance parameters (weight gain, WG; specific growth rate, SGR; feed conversion ratio, FCR; and survival rate, SR). Then, 10 crayfish were randomly selected from each pool to evaluate antioxidant capacity and nonspecific immune index, and 25 crayfish were used in the challenge experiment. To assess the antioxidant capacity and nonspecific immune index of the hemolymph and hepatopancreas, of the hemolymph was collected from the pericardium of each ten crayfish with a one milliliter sterile syringe. The hemolymph was mixed with 1:1 precooled anticoagulant solution (100 mmol⋅L− 1 glucose, 26 mmol⋅L− 1 citrate, 450 mmol⋅L− 1 NaCl, 30 mmol⋅L− 1 citric acid, 10 mmol⋅L− 1 EDTA, pH 7.2) and imme diately centrifuged for 25 min at 9000 rpm and 4 ◦ C (Reinhold, 1953). The supernatant was then collected and stored in a refrigerator at − 20 ◦ C and then used to analyze antioxidant capacity and nonspecific immune indicators. In addition, the hepatopancreas was quickly removed and frozen in liquid nitrogen and then stored in a refrigerator at − 80 ◦ C for RNA extraction and analysis. Hepatopancreas tissue (0.3 g) was used to prepare hepatopancreas homogenate. The hepatopancreas homogenate was further homogenized in 0.86% frozen normal saline (w/v, 1:9) by an Ultra-Turrax homogenizer (Tekmar Company, Cincin nati, Ohio, USA) and centrifuged at 4 ◦ C and 5000 r/min for 10 min for further analysis (Reinhold, 1953).
2. Materials and methods 2.1. Crayfish management experimental diets Crayfish were provided by Jiangsu Jinfeng Agricultural Technology Co., Ltd. Jianhu, Jiangsu, China. Crayfish feed was provided by Tongwei (Dafeng) Feed Co., Ltd. Jiangsu, China. To adapt the crayfish to the new environment, the crayfish were fed twice a day for two consecutive weeks. Crayfish (900 healthy and equal weight crayfish, approximately 5.80 ± 0.10 g) were randomly transferred into six separate tanks (50 in each cement tank, 1.0 × 1.0 × 0.8 m, L:W:H, repeated three times) as different groups. The water temperature was set at 25 ± 1.0 ◦ C, the pH was controlled at 7.40–8.50, and dissolved oxygen (DO) was maintained at more than 6.0 during the experiment. GA (purity of 98%) was provided by Xi’an Shengqing Biotechnology Co. Xi’an, China. The feed composition and formula fed to the experi mental crayfish are shown in Table 1. According to Tian et al., the diet contained approximately 27.17% crude protein and 5.97% crude fat (Tian et al., 2020). GA was supplemented in the diet at 25, 50, 75, 100 and 150 mg⋅kg− 1 (designated the GA25, GA50, GA75, GA100 and GA150 diets, respectively), and the diet without GA (CON diet) was used as a control diet (Table 1). The daily feeding amount was 5% of the body weight of the crayfish. The feeding amount at 6:00 a.m. was 30% of the daily feeding amount and 70% at 18:00 p.m. It was adjusted according to the feeding and growth conditions. The crayfish were fed until full ness every day.
2.3. Nonspecific immunity response assays in the hemolymph and hepatopancreas 2.3.1. Total hemocyte count (THC) measurement According to Alagappan et al. (2016), the hemolymph was diluted 10 times with anticoagulant. A blood cell analyzer was used to measure THC, and the conventional medical analysis method (Olympus IX-71, Tokyo, Japan) was used to count all 4 or 5 squares under an optical microscope. The measurement was repeated three times for each sample.
2
F. Liu et al.
Aquaculture 533 (2021) 736202
2.3.2. PO activity assay According to Ashida (1971), spectrophotometry was used to analyze the activity of phenoloxidase (PO) in hemolymph. Then, 10 μL of he molymph, 300 μL of phosphate buffer (0.1 M, pH 6.0) and 10 μL dihy droxyphenylalanine solution (0.01 M) were added to a 96-well microtitration plate, and the absorbance (optical density of 490 nm [OD490]) was measured every 2 min. An increase in OD490 of 0.001/ min was considered to be an active unit.
between 1.9 and 2.0. An ExScript RT-PCR Kit (China Dalian Takara Co., Ltd.) was used to generate cDNA with 500 ng of DNase-treated RNA, and reverse-transcription PCR and real-time PCR were carried out according to Liu et al. (2016). The mRNA expression levels were analyzed using a SYBR Green I fluorescence kit via a quantitative thermal cycler (Mastercycler EP Realplex, Eppendorf, Germany) (Ming et al., 2012). Relative bax, bi-1, tlr, lectin, NF-κB and hsp70 mRNA levels were quantified using the 2-ΔΔCT method (Livak and Schmittgen, 2001). According to the standard curve, the PCR efficiency was determined by serial dilutions of cDNA: ΔΔCT = (CT, Target - CT, β-actin) time x - (CT, Target - CT, β-actin) time 0. The ExScript RT-PCR Kit, RQ1 RNase-Free DNase and TRIzol reagent were obtained from Dalian Takara Co., Ltd.
2.3.3. Enzyme activities and content assays According to the manufacturer’s guidelines, the enzyme activities and content assays were performed using the corresponding detection kits (Nanjing Jiancheng Bioengineering Institute, Nanjing, Jiangsu, China). The aggregated hemolymph and hepatopancreas were stored at − 80 ◦ C before determined. The T-AOC activity present in the hemo lymph and hepatopancreas samples were determined via colorimetric assays (Marklund and Marklund, 1974). The activity of total superoxide dismutase (T-SOD) in hepatopancreas and hemolymph was determined by a simple micro-plate WST-1 method introduced by Zhou and Prognon (2006). The activity of glutathione peroxidase (GPx) was estimated by H2O2 in the presence of glutathione (GSH) according to Lygren et al. (1999). Malondialdehyde (MDA) in hepatopancreas and hemolymph specimens was determined by reaction of thiobarbituric acid with malondialdehyde and other aldehydes for 60 min at low pH at 95 ◦ C, and the maximum light absorption complex was formed at 534 nm (Satoh, 1978). The ROS were detected by fluorescent probe (Liu et al., 2020a, 2020b). The activity of LZM in hepatopancreas and hemolymph was measured using a micrococcus lysodeikticus lyophilized powder as a substrate (Nanjing Jiancheng Bioengineering Institute, Nanjing, Jiangsu, China) according to Yin et al. (2006). Disodium phenyl phos phate-4-aminoantipyrine‑potassium ferricyanide was used to determine the activity of AKP and disodium phenyl phosphate method was used to determine the activity of ACP according to Liu et al. (2019).
2.5. Challenge experiments Shrimp WSSV was provided by Yellow Sea Fisheries Research (Qingdao, China). The WSSV was purified from shrimp by differential centrifugation. WSSV was injected into the last abdominal segment of crayfish (2.6 × 107 virions per crayfish) for each experimental group according to Liu et al. (2020a, 2020b) and Zhang et al. (2018). After WSSV infection, mortality was recorded at 0, 24, 48, 72, 96, 120 and 168 h. The challenge experiment was conducted in a separate tank. The cumulative mortality (%) was calculated by the following formula : Cumulative mortality (%) ( ) Total mortality in each treatment after challenge = × 100 Total number of crayfish challenged for same treatment 2.6. Statistical analysis Duncan’s multiple range test was performed, and SPSS (version 18.0) software were used for independent sample t-tests. Significant differ ences were identified. The data are expressed as X ± SEM. Before the post test, a homogeneity test and variance analysis were carried out.
2.4. Hepatopancreas immune-related gene expression measurements The expression of bax (Zhang et al., 2018), bax inhibitor-1 (bi-1) (Zhang et al., 2018), toll-like receptor (tlr) (Wang et al., 2015), lectin (Zhang et al., 2011a, 2011b), NF-κB (Qian and Zhu, 2019), heat shock protein 70 (hsp70) (Sun et al., 2009) and 18S rRNA (β-actin) (Dai et al., 2016a, 2016b) in the crayfish hepatopancreas was analyzed via realtime qPCR. The sequences of the primers used in this study are shown in Table 2 (Shanghai Invitrogen Corp). TRIzol reagent was used to extract total RNA from 100 mg of hepatopancreas tissue, and the RNA samples were treated with RQ1 RNase-Free DNase. Total RNA was extracted from 100 mg of hepatopancreas tissue with TRIzol reagent. Subsequently, the quality of RNA was analyzed by a microspectropho tometric method and 1.5% agarose gel electrophoresis. The electro phoresis band was clear and not easy to degrade. The A260/A280 was
3. Results 3.1. Effect of GA on the growth of crayfish The effect of GA on the growth performance of crayfish is shown in Table 3. Four GA-supplemented groups (GA50, GA75, GA100 and GA150) showed significant increases in final body weight (FBW) (P < 0.05) compared with the control group. All five GA-supplemented groups showed significant increases in WG and SGR (P < 0.05) and decreases in FCR compared with the control group. There were no sig nificant changes in SR among the control group and all five treatment groups (P > 0.05).
Table 2 Primers used in this study. Name
Sequence (5′ -3′ )
Annealing temperature (◦ C)
Amplification efficiency
References
bax-F bax-R bi-1-F bi-1-R tlr-F tlr-R lectin-F lectin-R NF-κB -F NF-κB -R hsp70-F hsp70-R 18S rRNA-F 18S rRNA-R
TATAGTTGGCTCATTAGCAG ATACTAAGTGAAGATGACTG TGCCATTACATCTTGGGTTCT CGACCTAATCCCATCTCAAGC TTGCGTAGTGACTTGTGGAGC CTACTGTAACGCAGGCGATGG ACTTTGCTAACGCCAATCCAC CTACGCTGTCATCGACGAACC TAGTGCGTGATGATGGGTCTT GCTGATTATGGAGGCAGAAAA GGTGTTGGTGGGAGGGTCTA GGCTCGCTCTCCCTCATACAC CTGTGATGCCCTTAGATGTT GCGAGGGGTAGAACATCCAA
58
99.16
Zhang et al., 2018
58
98.95
Zhang et al., 2018
58
100.21
Wang et al., 2015
60
99.83
Zhang et al., 2011a, b
51
98.07
Qian et al., 2019
59
101.82
Sun et al., 2009
58
102.63
Dai et al., 2016a, b
3
F. Liu et al.
Aquaculture 533 (2021) 736202
Group
IBW (g)
FBW (g)
WG (%)
SGR (%)
FCR
SR (%)
Control
5.87 ± 0.06 5.77 ± 0.06 5.77 ± 0.12 5.83 ± 0.06 5.80 ± 0.10 5.77 ± 0.06
29.07 ± 1.10d 31.22 ± 0.84cd 32.51 ± 1.48bc 36.46 ± 1.10a 35.92 ± 1.582a 34.77 ± 1.58ab
395.66 ± 19.54d 441.51 ± 19.47c 464.16 ± 34.65bc 525.01 ± 19.94a 519.21 ± 20.92a 503.14 ± 32.21ab
2.67 ± 0.07d 2.81 ± 0.06c 2.89 ± 0.10bc 3.05 ± 0.05a 3.04 ± 0.06a 2.99 ± 0.09ab
2.87 ± 0.03a 2.71 ± 0.08b 2.48 ± 0.76c 2.01 ± 0.08e 2.10 ± 0.10e 2.28 ± 0.10d
98.84a
supplemented groups compared with the control group (P < 0.05) (Fig. 5B, D and E). The mRNA expression levels of tlr and hsp70 were significantly increased in the hepatopancreas of crayfish fed the GA50, GA75, GA100 and GA150 diets compared with the CON diet (P < 0.05) (Fig. 5C and F).
98.29a
3.5. Effect of GA on the crayfish challenge experiment
Table 3 Effects of glycyrrhizic acid on the growth of crayfish.
GA25 GA50 GA75 GA100 GA150
98.82a
The cumulative mortality after WSSV infection is shown in Fig. 6, showing the fastest increase from 72 to 120 h after infection. The cu mulative mortality of the control, GA25, GA50, GA75, GA100 and GA150 groups were 100.00%, 96.33%, 94.00%, 72.00%, 80.00% and 87.67%, respectively. At 72, 96, 120 and 168 h after infection, the cu mulative mortality was significantly higher in the control and GA25 groups than the GA50, GA75, GA100 and GA150 groups (P < 0.05, Fig. 6).
98.59a 98.28a 98.92a
Note: Values labeled with different superscripted lowercase letters in the same column are significantly different according to Duncan’s multiple range test and independent-samples t-test (P < 0.05); data are expressed as− X ± SEM (n = 3). IBW: initial body weight (g); FBW: final body weight (g); SR: survival (%). WG (weight gain) = 100 × [(FBW - IBW)/IBW]. SGR (specific growth rate) = 100 × [ln (FBW) − ln (IBW)/test days]. FCR (feed conversion ratio) = total feed consumption/total weight gain. SR (survival rate) = 100 × (final number of fish/initial number of fish).
4. Discussion 4.1. Effect of GA on the growth and mortality of crayfish after challenge The immunopotentiator effects of GA on the growth, nonspecific immune response and antioxidant capacity of crustaceans were reported for the first time. Many studies have shown that medicinal plant extracts can indirectly or directly promote the growth of crustaceans, improve digestive enzyme activity and feed use efficiency and enhance antioxi dant capacity, immunity and disease resistance (Zheng et al., 2019; Radhakrishnan et al., 2014; Zhu et al., 2018). GA can increase SGR in A. japonicus (Chen et al., 2010). In this study, compared with the CON diet-fed group, the groups fed the GA50, GA75, GA100 and GA150 diets had increased FWB, WG and SGR, decreased FCR, and notably decreased SR after WSSV challenge, which showed that GA could promote the growth of crayfish. Until now, no study has examined the antiviral effect of GA in crustaceans; however, a recent study described the antiviral functions of GA against many viruses, including influenza virus, coro navirus, herpesvirus, human immunodeficiency virus and hepatitis B virus (Yang, 2020). In addition, GA can reduce the mortality of A. japonicus after infection with Vibrio splendidus (Chen et al., 2010) and the mortality of C. auratus after infection with Aeromonas hydrophila (Wang et al., 2007). In this study, the cumulative mortality rates were significantly higher after infection, supporting the anti-WSSV function of GA. This effect may be due to a decrease in oxidative stress by inhibiting pathogenic microorganism infection and improving antioxi dant levels and nonspecific immune indices (Citarasu et al., 2006; Wu et al., 2016). It is well known that there are significant differences in physiological structure between mammals and aquatic animals, including shrimp. However, based on the current research methods and technical conditions, the mechanism underlying this phenomenon is not well understood and needs further study.
3.2. Effect of GA on nonspecific immunity responses in crayfish The nonspecific immunity responses of crayfish hemolymph are presented in Fig. 1. The THC was significantly higher in all five GAsupplemented groups than in the control group (P < 0.05) (Fig. 1A). The activities of PO, T-AOC and GPx were significantly increased (Fig. 1B, C and E), while the activity of MDA was significantly decreased in the hemolymph of crayfish fed the GA50, GA75, GA100 and GA150 diets compared with the CON diet (P < 0.05) (Fig. 1F). T-SOD activity was significantly increased in the hemolymph of crayfish fed the GA75, GA100 and GA150 diets compared with the CON diet (P < 0.05) (Fig. 1D). The nonspecific immune responses of crayfish hepatopancreas are presented in Fig. 2. The activities of T-AOC and GPx were significantly higher (Fig. 2A and C), while the activity of MDA was significantly decreased in the hepatopancreas of crayfish fed the GA50, GA75, GA100 and GA150 diets compared with the CON diet (P < 0.05) (Fig. 2D). TSOD activity was significantly higher in all five GA-supplemented groups than the control group (P < 0.05) (Fig. 2B). 3.3. Effect of GA on the antioxidant capacities of crayfish The antioxidant abilities of crayfish hemolymph are presented in Fig. 3. The ROS content was significantly decreased (Fig. 3A), while the activities of LZM, ACP and AKP in crayfish hemolymph were signifi cantly increased in all five GA-supplemented groups compared with the control group (P < 0.05) (Fig. 3B, C and D). The antioxidant abilities of crayfish hepatopancreas are presented in Fig. 4. The content of ROS was significantly decreased (Fig. 4A), while the activities of LZM and AKP were significantly increased in the hepatopancreas of crayfish fed the GA50, GA75, GA100 and GA150 diets compared with the CON diet (P < 0.05) (Fig. 4B and D). The activity of ACP in crayfish hepatopancreas was significantly increased in all five GA-supplemented groups compared with the control group (P < 0.05) (Fig. 4C).
4.2. Effect of GA on the nonspecific immune response of crayfish THC and PO, T-SOD, GPX and MDA activities have been used to assess the health status of crustaceans. THC is an important sensitive index that reflects the immune response of crustacean blood cells (Zhou et al., 2017). A previous study on Litopenaeus vannamei showed that THC was higher in the group fed Angelica sinensis extract than in the control group (Pan et al., 2018). Additionally, in crayfish, THC was higher in the group fed Rhodiola rosea extract than the control group (Cheng, 2019). In the present study, THC was higher in all five GA-supplemented groups compared with the control group. PO, a key enzyme in the melanin synthesis pathway, plays a prominent role in the immune defense of invertebrates, including crustaceans. PO activity was significantly increased in the hemolymph of crayfish fed the GA50, GA75, GA100 and GA150 diets compared with those that received the CON diet. These results are consistent with the observation that β-1,4-mannobiose could
3.4. Effect of GA on the expression of immune-related genes in crayfish The expression of immune-related genes in crayfish is shown in Fig. 5. The mRNA expression level of bax was significantly decreased (Fig. 5A), while the mRNA expression levels of bi-1, lectin and NF-κB in the crayfish hepatopancreas were significantly increased in all five GA4
F. Liu et al.
Aquaculture 533 (2021) 736202
Fig. 1. Effects of dietary GA on the total hemocyte count (THC) (A), phenoloxidase (PO) activity (B), total antioxidant capacity (T-AOC) (C) and total superoxide dismutase (T-SOD) (D), glutathione peroxidase (GPX) (E) and malondialdehyde (MDA) activities (F) in the hemolymph of crayfish fed the experimental diets for 60 days (means ± SEMs, n = 10). Different letters indicate significant differences (P < 0.05).
enhance PO activity in Marsupenaeus japonicus (Elshopakey et al., 2018). T-AOC reflects the ability of the nonenzymatic system and antioxidant enzymes to externally respond to stimulation and maintain homeostasis, and it is a comprehensive index used to measure the function of the antioxidant system (Xie et al., 2008). T-SOD is an antioxidant enzyme
with a metal cofactor that exists in organisms that can catalyze super oxide anion free radical disproportionation to produce oxygen and hydrogen peroxide and plays an important role in the balance of oxidation and antioxidation. T-SOD is closely related to the occurrence and development of many diseases. GPx is an important member of the 5
F. Liu et al.
Aquaculture 533 (2021) 736202
Fig. 2. Effects of dietary GA on the total antioxidant capacity (T-AOC) (A) and total superoxide dismutase (T-SOD) (B), glutathione peroxidase (GPX) (C) and malondialdehyde (MDA) activities (D) in the hepatopancreas of crayfish fed the experimental diets for 60 days (means ± SEMs, n = 10). Different letters indicate significant differences (P < 0.05).
antioxidant enzyme system. It can effectively eliminate free radicals in organisms by catalyzing the reduction of hydroperoxides to glutathione (GSH) to protect cells from oxidative damage. GPx has potential me dicinal value for the prevention and treatment of various diseases caused by active oxygen (Mosleh et al., 2006). MDA content is an important parameter that reflects the potential antioxidant capacity of the body, the rate and intensity of lipid peroxidation and, indirectly, the degree of tissue peroxidation damage (Freeman and Crapo, 1982). Studies have shown that extracts from A. sinensis could enhance T-SOD and GPX ac tivities, decrease MDA content (Liu et al., 2011) and increase T-AOC and GPX activities in white shrimp (L. vannamei) (Pan et al., 2018). Addi tionally, a S. fusiforme extract enhanced SOD activity in shrimp (Huang et al., 2006). Similarly, Tsai et al. showed that hesperidin from dried tangerine peel could enhance cellular antioxidant capacity (Tsai et al., 2019) and enhance antioxidant status in broiler chicks by reducing the contents of MDA and increasing the activities of T-AOC and GPx (Jiang et al., 2016). In addition, medical research has shown that GA can enhance GPX activity and reduce MDA content in mice (Zhang et al., 2009). Furthermore, GA can enhance SOD activity of A. japonicus (Chen et al., 2010). The above studies mainly focused on broiler chicks and mice, which are different from crustaceans, and no study has examined GA in crustaceans. However, it can be inferred that GA has similar functions in crustaceans to a certain extent. Therefore, the increased TAOC, T-SOD and GPX activities and decreased MDA contents in blood cells and the hepatopancreas inferred that GA could protect the
hepatopancreas and blood cells from lipid peroxidation and protein oxidative carbonylation by increasing the activity of the antioxidant enzymes T-AOC, T-SOD and GPX and by reducing MDA production. The related research requires further strengthening. 4.3. Effect of GA on the antioxidant capacity of crayfish One of the main mechanisms of hemophagocytosis is the production of ROS with a respiratory burst, which leads to oxidative damage. Studies have shown that ROS, including superoxide anion radicals (O−2 ⋅), hydrogen peroxide (H2O2), hydroxyl radicals (OH⋅) and singlet oxy gen, are byproducts of aerobic metabolism (Yu, 1994). Therefore, ROS can be used as a marker of poor animal health. Studies have shown that an Astragalus membranaceus extract could decrease the ROS content in sea cucumber (A. japonicus) (Wang et al., 2009). In our study, ROS content was decreased in the groups of crayfish fed the GA50, GA75, GA100 and GA150 diets compared with the control group. LZM is an important nonspecific immune factor in animals that has a strong killing ¨ck and Peters, 1990). The activities, effect on gram-positive bacteria (Mo including the antibacterial activity, of LZM are directly related to the immune function and health of aquatic animals. Li et al. showed that immune function increases with increasing LZM activity in crustaceans (Li and Li, 2013). AKP, one of the most important metabolic enzymes, can directly participate in the transfer of phosphate groups and meta bolism of calcium and phosphorus. AKP plays an important role in the 6
F. Liu et al.
Aquaculture 533 (2021) 736202
Fig. 3. Effects of dietary GA on reactive oxygen species (ROS) (A), lysozyme (LZM) (B), acid phosphatase (ACP) (C) and alkaline phosphatase (AKP) (D) activities in the hemolymph of crayfish fed the experimental diets for 60 days (means ± SEMs, n = 10). Different letters indicate significant differences (P < 0.05).
absorption and utilization of nutrients in shrimp and fish, which helps to improve the immunity and disease resistance of shrimp and fish (Zhang et al., 2011a, 2011b). ACP is closely related to substance metabolism, is a marker enzyme of macrophage lysosomes, can be induced by exoge nous substances and plays an important role in the immune response. ACP is a typical lysosomal enzyme with similar activity to LZM (Cheng, 1989). Studies have shown that icariin extract from Epimedium grandi florum (Zheng et al., 2019), a honeysuckle stem ethanol extract (Zhao et al., 2018), and taurine (Dong et al., 2018) could increase the activities of LZM, ACP, and AKP in Eriocheir sinensis. Furthermore, fructooligo saccharides (Li et al., 2007) and an A. sinensis extract (Pan et al., 2018) could increase the activity of LZM, ACP and AKP in L. vannamei. Medical research has shown that GA can regulate AKP activity in liver cirrhosis (Song et al., 2020). Additionally, GA can enhance the activities of LZM and ACP in A. japonicus (Chen et al., 2010). In the present study, the LZM, ACP and AKP activities in both hemocytes and the hepatopancreas were significantly increased in the groups of crayfish fed the GA50, GA75, GA100 and GA150 diets compared with the control group. Thus, the decrease in ROS content and increase in LZM, ACP and AKP activities both in hemocytes and the hepatopancreas indicated that dietary GA could enhance immunity in crayfish.
4.4. Effect of GA on the expression of immune-related genes in crayfish The PI3K/AkT signaling pathway plays a key role in the regulation of apoptosis. Bax, an important gene in the PI3K/AkT signaling pathway, is involved in apoptosis and a member of the Bcl-2 family; this gene is normally expressed in the cytoplasm, but it localizes in mitochondria during apoptotic signaling, which induces cytochrome release (Cui et al., 2016). AKT activates bax transport from the cytoplasm to mito chondria (Tsuruta et al., 2002). The Bi-1 protein, as the main inhibitor of Bax-induced cell death, balances and neutralizes Bax activity and acts as a protective force in environmental responses (Kawai et al., 1999). Ac cording to the results of Zhang, bax mRNA expression levels increase after WSSV infection, indicating that WSSV induces mitochondrial bax production and causes bax to be redistributed, resulting in cytochrome release and apoptosis (Zhang et al., 2018). Additionally, regardless of the WSSV infection status, the expression level of bi-1 was found to be significantly decreased by pretreatment with a PI3K-specific inhibitor compared with Tris-HCl pretreatment (Zhang et al., 2018). The crayfish Bi-1 protein inhibits WSSV replication and functions as an antiapoptosis factor that prevents cell procedural death (Du et al., 2013). In this study, bax mRNA expression levels were significantly decreased and bi-1 mRNA expression levels significantly increased in the group of crayfish fed the GA25, GA50, GA75, GA100 and GA150 diets compared with the control group, which suggested that GA could effectively inhibit 7
F. Liu et al.
Aquaculture 533 (2021) 736202
Fig. 4. Effects of dietary GA on reactive oxygen species (ROS) (A), lysozyme (LZM) (B), acid phosphatase (ACP) (C) and alkaline phosphatase (AKP) (D) activities in the hepatopancreas of crayfish fed the experimental diets for 60 days (means ± SEMs, n = 10). Different letters indicate significant differences (P < 0.05).
apoptosis in crayfish. Many studies have shown that a group of proteins called pattern recognition receptors (PRRs) mediate non-self-recognition and function in the first line of defense to enhance the immune response (Lan et al., 2016; Dai et al., 2016a, 2016b). The tlr family is an ancient PRR family member and plays a key role in the innate immune response of in vertebrates to WSSV (Feng et al., 2016). Lectin is also an important PRR that is widely distributed in organisms with diverse functions, including protein synthesis, cell-cell interactions and signal transduction (Tian et al., 2018). Zhang et al. and Wang et al. have shown the role of tlr and lectin in the natural immunity of prawns; it is upregulated upon bacterial infection (Zhang et al., 2018; Wang et al., 2015). In addition, NF-κB is closely related to apoptosis, participates in the transcriptional regulation of many apoptosis-related genes and can both inhibit and promote apoptosis (Dutta et al., 2006). Additionally, hesperetin was found to significantly increase lectin and NF-κB mRNA expression levels (Qian and Zhu, 2019). Thus, the observed upregulated tlr, lectin and NF-κB expression indicated that crayfish immunity was increased and apoptosis inhibited. HSP70 has a variety of functions that promote the immune response and the protection of cytoplasmic components under various stress conditions (Basu et al., 2002). It has been found that hsp70 is upregu lated by immunopotentiator supplementation in yellow catfish
(Pelteobagrus fulvidraco) (Liu et al., 2019) and Megalobrama amblycephala (Liu et al., 2012). Additionally, hesperidin and Codonopsis pilosula polysaccharide led to increased expression of hsp70 in crayfish hepato pancreas (Liu et al., 2020a, 2020b). Therefore, the results showing upregulated hsp70 expression demonstrated increased crayfish immu nity and inhibited apoptosis. Therefore, the downregulated expression of bax and upregulated expression of bi-1, tlr, lectin, NF-κB and hsp70 could indicate that dietary supplementation with 75 to 100 mg⋅kg− 1 GA improves crayfish immu nity. However, the underlying mechanism requires further study. 5. Conclusions In summary, the present results show that at the optimal dose of 75 to 100 mg⋅kg− 1, addition of GA can significantly improve the growth performance, immune response, immune-related gene expression and disease resistance of crayfish. In addition, GA can be used as a new antioxidant, immunopotentiator and antiviral agent for further culti vation of crayfish. However, additional studies with different animal and cellular models are needed to fully evaluate the immune-enhancing and antioxidant activities of GA, as well as the exact molecular mechanisms.
8
F. Liu et al.
Aquaculture 533 (2021) 736202
Fig. 5. Relative expression levels of bax (A), bi-1 (B), tlr (C), lectin (D), NF-κB (E) and hsp70 (F) in the hepatopancreas of crayfish subjected to different levels of dietary GA for 60 days (means ± SEM, n = 10). Different letters indicate significant differences (P < 0.05).
Declaration of Competing Interest
work, there is no professional or other personal interest of any nature or kind in any product, service and/or company that could be construed as influencing the position presented in, or the review of, the manuscript entitled, “Enhanced growth performance, immune responses, immune-
We declare that we have no financial and personal relationships with other people or organizations that can inappropriately influence our 9
F. Liu et al.
Aquaculture 533 (2021) 736202 Dutta, J., Fan, Y., Gupta, N., Fan, G., G´elinas, C., 2006. Current insights into the regulation of programmed cell death by NF-kappaB. Oncogene 25, 6800–6816. Edahiro, T., Hamoguchi, M., Kusuda, R., 1990. Effect of glycyrrhizine against streptococcal infection of young yellowtail, Seriola quinqueradiata. Suisanzoshoku 38, 239–243. Elshopakey, G.E., Risha, E.F., Abdalla, O.A., Okamura, Y., Hanh, V.D., Ibuki, M., Sudhakaran, R., Itami, T., 2018. Enhancement of immune response and resistance against Vibrio parahaemolyticus in kuruma shrimp (Marsupenaeus japonicus) by dietary supplementation of β-1,4-mannobiose. Fish Shellfish Immunol. 74, 26–34. Feng, J., Zhao, L., Jin, M., Li, T., Wu, L., Chen, Y., Ren, Q., 2016. Toll receptor response to white spot syndrome virus challenge in giant freshwater prawns (Macrobrachium rosenbergii). Fish Shellfish Immunol. 57, 148–159. Freeman, B.A., Crapo, J.D., 1982. Biology of disease: free adicals and tissue injury. Lab. Investig. 47, 412–426. Huang, X.X., Zhou, H.Q., Zhang, H., 2006. The effect of Sargassum fusiforme polysaccharide extracts on vibriosis resistance and immune activity of the shrimp, Fenneropenaeus chinensis. Fish Shellfish Immunol. 20, 750–757. Jang, S.I., Marsden, M.J., Kim, Y.G., Choi, M.S., Secombes, C.J., 1995. The effect of glycyrrhizin on rainbow trout, Oncorhynchus mykiss (Walbaum), leucocyte responses. J. Fish Dis. 18, 307–315. Jiang, X.R., Zhang, H.J., Wang, J., Wu, S.G., Yue, H.Y., Lü, H.Y., Cui, H., Bontempo, V., Qi, G.H., 2016. Effect of dried tangerine peel extract supplementation on the growth performance and antioxidant status of broiler chicks. Ital. J. Anim. Sci. 15, 642–648. Kao, T.C., Shyu, M.H., Yen, G.C., 2010. Glycyrrhizic acid and 18 β-glycyrrhetinic acid inhibit inflammation via PI3K/Akt/GSK3β signaling and glucocorticoid receptor activation. J. Agric. Food Chem. 58, 8623–8629. Kawai, M., Pan, L., Reed, J.C., Uchimiya, H., 1999. Evolutionally conserved plant homologue of the Bax inhibitor-1 (BI-1) gene capable of suppressing Bax-induced cell death in yeast(1). FEBS Lett. 464, 143–147. Lan, J.F., Wei, S., Wang, Y.Q., Dai, Y.J., Tu, J.G., Zhao, L.J., Li, X.C., Qin, Q.W., Chen, N., Lin, L., 2016. PcToll3 was involved in anti-Vibrio response by regulating the expression of antimicrobial peptides in red swamp crayfish, Procambarus clarkii. Fish Shellfish Immunol. 57, 17–24. Li, H., Zhang, T.E., Li, Q., 2013. Influence of compound Chinese herbal medicine on nonspecific immunity of turbot Scophthalmus maximus. J Dalian Ocean Univ. 28 (2), 115–120. Li, P., Burr, G.S., Gatlin, D.M., Hume, M.E., Patnaik, S., Castille, F.L., Lawrence, A.L., 2007. Dietary supplementation of short-chain fructooligosaccharides influences gastrointestinal microbiota composition and immunity characteristics of Pacific white shrimp, Litopenaeus vannamei, cultured in a recirculating system. J. Nutr. 137 (12), 2763–2768. Liu, X.L., Xi, Q.Y., Yang, L., Li, H.Y., Jiang, Q.Y., Shu, G., Wang, S.B., Gao, P., Zhu, X.T., Zhang, Y.L., 2011. The effect of dietary Panax ginseng polysaccharide extract on the immune responses in white shrimp, Litopenaeus vannamei. Fish Shellfish Immunol. 30, 495–500. Liu, B., Ge, X., Xie, J., Xu, P., He, Y., Cui, Y., Ming, J., Zhou, Q., Pan, L., 2012. Effects of anthraquinone extract from rheum officinale bail on the physiological responses and HSP70 gene expression of Megalobrama amblycephala under Aeromonas hydrophila infection. Fish Shellfish Immunol. 32 (2012), 1–7. Liu, F., Shi, H.Z., Guo, Q.S., Yu, Y.B., Wang, A.M., Lv, F., Shen, W.B., 2016. Effects of astaxanthin and emodin on the growth, stress resistance and disease resistance of yellow catfish (Pelteobagrus fulvidraco). Fish Shellfish Immunol. 51, 125–135. Liu, F., Qu, Y.K., Wang, A.M., Yu, Y.B., Yang, W.P., Lv, F., Nie, Q., 2019. Effects of carotenoids on the growth performance, biochemical parameters, immune responses and disease resistance of yellow catfish (Pelteobagrus fulvidraco) under hightemperature stress. Aquaculture 503, 293–303. Liu, F., Qu, Y.Q., Geng, C., Wang, A.M., Zhang, J.H., Chen, K.J., Liu, B., Tian, H.Y., Yang, W.P., Yu, Y.B., 2020a. Effects of hesperidin on the growth performance, antioxidant capacity, immune responses and disease resistance of red swamp crayfish (Procambarus clarkii). Fish Shellfish Immunol. 99, 154–166. Liu, F., Geng, C., Qu, Y.K., Cheng, B.X., Zhang, Y., Wang, A.M., Zhang, J.H., Liu, B., Tian, H.Y., Yang, W.P., Yu, Y.B., Chen, Z.B., 2020b. The feeding of dietary Codonopsis pilosula polysaccharide enhances the immune responses, the expression of immunerelated genes and the growth performance of red swamp crayfish (Procambarus clarkii). Fish Shellfish Immunol. 103, 321–331. Livak, K.J., Schmittgen, T.D., 2001. Analysis of relative gene expression data using realtime quantitative PCR and the 2− ΔΔCT method. Methods 25 (4), 402–408. Loker, E.S., Adema, C.M., Zhang, S.M., Kepler, T., 2004. Invertebrate immune systemsnot homogeneous, not simple, not well understood. Immunol. Rev. 198 (1), 10–24. Lygren, B., Hamre, K., Waagbø, R., 1999. Effects of dietary pro- and antioxidants on some protective mechanisms and health parameters in Atlantic salmon. J. Aquat. Anim. Health 11 (3), 211–221. Marklund, S., Marklund, G., 1974. Involvement of the superoxide anion radical in the autoxidation of pyrogallol and a convenient assay for superoxide dismutase. Eur. J. Biochem. 47, 469–474. Ming, J., Xie, J., Xu, P., Ge, X., Liu, W., Ye, J., 2012. Effects of emodin and vitamin C on growth performance, biochemical parameters and two HSP70s mRNA expression of Wuchang bream (Megalobrama amblycephala Yih) under high temperature stress. Fish Shellfish Immunol. 32, 651–661. M¨ ock, A., Peters, G., 1990. Lysozyme activity in rainbow trout, Oncorhynchus mykiss (Walbaum), stressed by handling, transport and water pollution. J. Fish Biol. 37 (6), 873–885. Mosleh, Y.Y., Paris-Palacios, S., Biagianti-Risbourg, S., 2006. Metallothioneins induction and antioxidative response in aquatic worms Tubifex tubifex (Oligochaeta, Tubificidae) exposed to copper. Chemosphere 64, 121–128.
Fig. 6. Effects of GA on the cumulative mortality of crayfish after infection with WSSV (2.6 × 107 virions per crayfish, n = 25). Note: Different lowercase letters at each sampling point for the different dosage groups indicate signifi cant differences according to Duncan’s multiple range test (P < 0.05).
related gene expression and disease resistance of red swamp crayfish (Procambarus clarkii) fed dietary glycyrrhizic acid”. Acknowledgments This study was financially supported by the Fund for Jiangsu Agri cultural Industry Technology System (Red Swamp Crayfish) (JATS [2019]229, JATS[2019]463), the NSFC (Grant No. 82073968), the Hunan Provincial Key Laboratory of Nutrition and Quality Control of Aquatic Animals (No. 2018TP1027) and the Fishery Science and Tech nology in Jiangsu Province (D2018-5). References Alagappan, K., Karuppiah, V., Deivasigamani, B., 2016. Protective effect of phages on experimental V. parahaemolyticus infection and immune response in shrimp (Fabricius, 1798). Aquaculture 453, 86–92. Ashida, M., 1971. Purification and characterization of pre-phenoloxidase from haemolymph of the silkworm Bombyx mori. Arch. Biochem. Biophys. 144 (2), 749–762. Basu, N., Todgham, A.E., Ackerman, P.A., Bibeau, M.R., Nakano, K., Schulte, P.M., Iwama, G.K., 2002. Heat shock protein genes and their functional significance in fish. Gene 295, 173–183. Chen, X.R., Zhang, W.B., Mai, K.S., Tan, B.P., Ai, Q.H., Xu, W., Ma, H.M., Wang, X.J., Liufu, Z.G., 2010. Effects of dietary glycyrrhizin on growth, immunity of sea cucumber and its resistance against Vibrio splendidus. Acta Hydrobiol. Sinica 34, 731–738. Cheng, T.C., 1989. Immunodeficiency diseases in marine mollusks: measurements of some variables. J. Aquat. Anim. Health 1 (3), 209–216. Cheng, Y., 2019. The growth performance and nonspecific immunity of red swamp crayfish Procambarus clarkia affected by dietary Rhodiola rosea polysaccharide. Fish Shellfish Immunol. 93, 796–800. Citarasu, T., Sivaram, V., Immanuel, G., Rout, N., Murugan, V., 2006. Influence of selected Indian immunostimulant herbs against white spot syndrome virus (WSSV) infection in black tiger shrimp, Penaeus monodon with reference to haematological, biochemical and immunological changes. Fish Shellfish Immunol. 21 (4), 372–384. Crance, J., Leveque, F., Biziagos, E., 1994. Studies on mechanism of action of glycyrrhizin against hepatitis a virus replication in vitro. Antivir. Res. 23, 63–76. Cui, Y., Lu, P., Song, G., Liu, Q., Zhu, D., Liu, X., 2016. Involvement of PI3K/AKT, ERK and p38 signaling pathways in emodin-mediated extrinsic and intrinsic human hepatoblastoma cell apoptosis. Food Chem. Toxicol. 92, 26–37. Dai, L.S., Sun, Y., Sun, Y.X., Zhu, B.J., Liu, C.L., 2016a. Characterization and function of a cathepsin B in red crayfish (Procambarus clarkii) following lipopolysaccharide challenge. Fish Shellfish Immunol. 56, 162–168. Dai, Y., Wang, Y., Zhao, L., Qin, Z., Yuan, J., Qin, Q., Lin, L., Lan, J., 2016b. A novel Ltype lectin was required for the multiplication of WSSV in red swamp crayfish (Procambarus clakii). Fish Shellfish Immunol. 55, 48–55. Dong, J., Cheng, R.J., Yang, Y.H., Zhao, Y.Y., Wu, G.F., Zhang, R.Y., Zhu, X.C., Li, L., Li, X.D., 2018. Effects of dietary taurine on growth, non-specific immunity, antioxidative properties and gut immunity in the Chinese mitten crab Eriocheir sinensis. Fish Shellfish Immunol. 82, 212–219. Du, Z.Q., Lan, J.F., Weng, Y.D., Zhao, X.F., Wang, J.X., 2013. BAX inhibitor-1 silencing suppresses white spot syndrome virus replication in red swamp crayfish, Procambarus clarkii. Fish Shellfish Immunol. 35, 46–53.
10
F. Liu et al.
Aquaculture 533 (2021) 736202 expression in the freshwater crayfish. Procambarus clarkii. Fish Shellfish Immunol. 43, 219–229. Wu, P., Li, Y.L., Cheng, J., Chen, L., Zhu, X., Feng, Z.G., Zhang, J.S., Chu, W.Y., 2016. Daily rhythmicity of clock gene transcript levels in fast and slow muscle fibers from Chinese perch (Siniperca chuatsi). BMC Genomics 17, 1008. Xie, J., Liu, B., Zhou, Q., Su, Y., He, Y., Pan, L., Ge, X., Xu, P., 2008. Effects of anthraquinone extract from rhubarb Rheum officinale bail on the crowding stress response and growth of common carp (Cyprinus carpio var. Jian). Aquaculture 281, 5–11. Yang, X.W., 2020. Antiviral effect of glycyrrhizic acid. Modern Chin. Med. https://doi. org/10.13313/j.issn.1673-4890.20200221002. Yin, G.J., Jeney, G., Racz, T., Xu, P., Xie, J., Jeney, Z., 2006. Effect of two Chinese herbs (Astragalus radix and Scutellaria radix) on non-specific immune response of tilapia, Oreochromis niloticus. Aquaculture 253 (1–4), 39–47. Yu, B., 1994. Cellular defenses against damage from reactive oxygen species. Physiol. Rev. 74, 139–162. Zhang, Z.S., Cui, C.C., Sun, Y., 2009. Protection effect of glycyrrhizic acid against alcohol-induced liver injury in mice. Food Sci.Technol. 34 (5), 225–227. Zhang, X.W., Wang, X.W., Sun, C., Zhao, X.F., Wang, J.X., 2011a. C-type lectin from red swamp crayfish Procambarus clarkii participates in cellular immune response. Arch Insect Biochem. 76, 168–184. Zhang, H.J., Li, Z.J., Zhang, J.S., Guo, Z.X., Wen, G.L., Cao, Y.C., Wu, Y., 2011b. Changes in non-specific immune parameters and water quality in Pacific white leg shrimp Litopenaeus vannamei culture ponds. J. Dalian Ocean Univ. 26 (4), 356–361. Zhang, H., Yao, X., Ding, Y., Xu, Z., Liang, R., Zhang, Y., Wu, Y., Li, B., Guan, B., 2018. PI3K signaling pathways modulated white spot syndrome virus (WSSV) replication in Procambarus clarkia. Fish Shellfish Immunol. 76, 279–286. Zhao, Z.L., Zhang, H.J., Wang, M.Q., Zhang, C., Kuang, P.Q., Zhou, Z., Zhang, G.Z., Wang, Z., Zhang, B.B., Shi, X.W., 2018. The ethanol extract of honeysuckle stem modulatesthe innate immunity of Chinese mitten crab Eriocheir sinensis against Aeromonas hydrophila. Fish Shellfish Immunol. 82 (2018), 304–311. Zheng, X., Chi, C., Xu, C., Liu, J., Zhang, C., Zhang, L., Huang, Y., He, C., He, Chang, Jia, X., Liu, W., 2019. Effects of dietary supplementation with icariin on growth performance, antioxidant capacity and non-specific immunity of Chinese mitten crab (Eriocheir sinensis). Fish Shellfish Immunol. 90, 264–273. Zhou, J.Y., Prognon, P., 2006. Raw material enzymatic activity determination: a specific case for validation and comparison of analytical methods-the example of superoxide dismutase (SOD). J. Pharm. Biomed. Anal. 40 (5), 1143–1148. Zhou, M., Wu, Z., Liang, R., Gu, N., 2017. Effects of dietary taurine, carnitine and cholesterol supplementation on growth performance and immunological status of Litopenaeus vannamei under cold exposure. Aquac. Res. 48, 1279–1290. Zhu, F., Du, H.H., Miao, Z.G., Quan, H.Z., Xu, Z.R., 2009. Protection of Procambarus clarkia against white spot syndrome virus using inactivated WSSV. Fish Shellfish Immunol. 26, 685–690. Zhu, M., Long, X.H., Wu, S.H., 2018. Effects of dietary trehalose on the growth performance and nonspecific immunity of white shrimps (Litopenaeus vannamei). Fish Shellfish Immunol. 78, 127–130.
Pan, S., Jiang, L., Wu, S., 2018. Stimulating effects of polysaccharide from Angelica sinensis on the nonspecific immunity of white shrimps (Litopenaeus vannamei). Fish Shellfish Immunol. 74, 170–174. Qian, X., Zhu, F., 2019. Hesperetin protects crayfish Procambarus clarkii against white spot syndrome virus infection. Fish Shellfish Immunol. 93, 116–123. ˇ Raˇckov´ a, L., Janˇcinov´ a, V., Petríkov´ a, M., Dr´ abikov´ a, K., Nos´ aˇl, R., Stefek, M.,
Kost´ alov´ a, D., Pr´ onayov´ a, N., Kov´ acov´ a, M., 2007. Mechanism of anti-inflammatory action of liquorice extract and glycyrrhizin. Nat. Prod. Res. 21, 1234–1241. Radhakrishnan, S., Bhavan, P.S., Seenivasan, C., Shanthi, R., Poongodi, R., 2014. Influence of medicinal herbs (Alteranthera sessilis, Eclipta alba and Cissus qudrangularis) on growth and biochemical parameters of the freshwater prawn Macrobrachium rosenbergii. Aquac. Int. 22 (2), 551–572. Reinhold, J.G., 1953. Manual determination of total serum proteins, albumin and globulin fractions by biuret method. In: Reiner, M. (Ed.), Standard Method of Clinical Chemistry. Academic Press, New York, p. 88. Satoh, K., 1978. Serum lipid peroxide in cerebrovascular disorders determined by a new colorimetric method. Clin. Chim. Acta 90 (1), 37–43. Shen, H., Hu, Y., Ma, Y., Zhou, X., Xu, Z., Shui, Y., Li, C., Xu, P., Sun, X., 2014. In-depth transcriptome analysis of the red swamp crayfish Procambarus clarkia. PLoS One 10, e110548. Song, Q., Wang, W., Lu, Y., 2020. Clinical observation of magnesium isoglycyrrhizinate combined with somatostatin in treatment of liver cirrhosis. Drug Eval. Res. 43 (4), 725–728. Sun, Y., Zhang, L., Li, M.C., Wu, R., Lei, L.M., Xie, S.T., 2009. Cloning and expression analysis of an inducible heat shock protein 70 gene from red swamp crayfish. Acta Hydrobiol. Sin. 33, 627–635. Tian, Y., Chen, T., Huang, W., Luo, P., Huo, D., Yun, L., Hu, C., Cai, Y., 2018. A new Ltype lectin (LvLTLC1) from the shrimp Litopenaeus vannamei facilitates the clearance of Vibrio harveyi. Fish Shellfish Immunol. 73 (2018), 185–191. Tian, H., Yang, C., Yu, Y., Yang, W., Lu, N., Wang, H., Liu, F., Wang, A., Xu, X., 2020. Dietary cholesterol level affects growth, molting performance and ecdysteroid signal transduction in Procambarus clarkii. Aquaculture 523, 735198. Tsai, Y.F., Chen, Y.R., Che, N.J.P., Tang, Y., Yang, K.C., 2019. Effect of hesperidin on anti-inflammation and cellular antioxidant capacity in hydrogen peroxidestimulated human articular chondrocytes. Process Biochem. 85, 175–184. Tsuruta, F., Masuyama, N., Gotoh, Y., 2002. The phosphatidylinositol 3-kinase (PI3K)AKT pathway suppresses Bax translocation to mitochondria. J. Biol. Chem. 277, 14040–14047. Wang, W.B., Fang, P., Lin, X.T., Xia, L., Qi, C.B., Wang, J.G., Sun, J., 2007. Effect of liquorice extracts on the resistance of Carassius auratus to stress and pathogen infection. Freshwater Fish. 37, 3–6. Wang, T., Sun, Y., Jin, L., Xu, Y., Wang, L., Ren, T., Wang, K., 2009. Enhancement of nonspecific immune response in sea cucumber (Apostichopus japonicus) by Astragalus membranaceus and its polysaccharides. Fish Shellfish Immunol. 27, 757–762. Wang, Z., Chen, Y.H., Dai, Y.J., Tan, J.M., Huang, Y., Lan, J.F., Ren, Q., 2015. A novel vertebrates toll-like receptor counterpart regulating the antimicrobial peptides
11
Contents lists available at ScienceDirect
Aquaculture journal homepage: www.elsevier.com/locate/aquaculture
Enhanced growth performance, immune responses, immune-related gene expression and disease resistance of red swamp crayfish (Procambarus clarkii) fed dietary glycyrrhizic acid Fei Liu a, b, Gui-Yan Shao a, Qing-Qing Tian a, Bo-Xing Cheng c, *, Chen Shen a, Ai-Ming Wang a, *, Jia-Hong Zhang d, Hong-Yan Tian a, Wen-Ping Yang a, Ye-Bing Yu a a
Department of Marine Science and Technology, School of Marine and Bioengineering, Yancheng Institute of Technology, Yancheng 224051, PR China Hunan Provincial Key Laboratory of Nutrition and Quality Control of Aquatic Animals, Department of Biological and Environmental Engineering, Changsha University, Changsha 410022, PR China c School of Biological Sciences, Guizhou Education University, Guiyang, China d Agricultural Science Institute of Lixiahe District, Jiangsu Province, Yangzhou 225007, PR China b
A R T I C L E I N F O
A B S T R A C T
Keywords: Glycyrrhizic acid Procambarus clarkia Growth performance Immune responses Disease resistance
Glycyrrhizic acid (GA) is an effective antiviral agent and is widely used in humans and animals. However, while the impact of disease on crustaceans is increasingly serious, research on the application of GA in crustaceans is very rare. The effects of GA on the growth performance, immune response, immune-related gene expression and disease resistance of crayfish were studied. A total of 900 healthy and equal weight crayfish were randomly divided into six groups for a feeding experiment, which lasted 60 days: the GA25, GA50, GA75, GA100 and GA150 groups were fed a basal diet supplemented with 25, 50, 75, 100 and 150 mg⋅kg− 1 GA, respectively, and the control group was fed a basal diet. The results showed that the crayfish in the groups supplemented with 75 to 100 mg⋅kg− 1 GA had an increased final body weight (FBW), weight gain (WG) and specific growth rate (SGR) and decreased feed conversion ratio (FCR) compared with the controls (P < 0.05). The total hemocyte count (THC) and phenoloxidase (PO) content in the hemolymph of crayfish in the groups supplemented with 75 to 100 mg⋅kg− 1 GA were significantly increased compared with those in the control group. Additionally, the total antioxidant capacity (T-AOC) and the total superoxide dismutase (T-SOD), glutathione peroxidase (GPX), acid phosphatase (ACP) and alkaline phosphatase (AKP), and lysozyme (LZM) in the hemolymph and hepatopancreas of crayfish were significantly increased, while the content of malondialdehyde (MDA) and reactive oxygen species (ROS) were significantly decreased in the groups supplemented with 50 to 150 mg⋅kg− 1 GA compared with the control group (P < 0.05). Furthermore, supplementation with 50 to 100 mg⋅kg− 1 GA downregulated the expression of bax and upregulated the expression of bax inhibitor-1 (bi-1), toll-like receptor (tlr), lectin, nuclear factor kappa-B (NF-κB) and heat shock protein 70 (hsp70) (P < 0.05). In addition, supplementation with 50–150 mg⋅kg− 1 GA could decrease the mortality of crayfish infected with white spot syndrome virus (WSSV). These results showed that growth performance, immune responses and immune-related gene expression can be improved by adding GA at the optimal dose of 50–150 mg⋅kg− 1 in crayfish.
1. Introduction
´ et al., 2007). GA can significantly improve (Kao et al., 2010; Raˇckova resistance to Enterococcus seriola infection in Seriola quinqueradiata (Edahiro et al., 1990) and significantly increase the respiratory burst activity of macrophages in rainbow trout (Jang et al., 1995). GA can also significantly increase growth performance and immune responses in Carassius auratus gibelio (Wang et al., 2007) and Apostichopus japonicus Selenka (Chen et al., 2010). However, few studies on the effects of GA on
Glycyrrhizic acid (GA), also known as glycyrrhizin, is an effective medicinal component extracted from Glycyrrhiza glabra. In mammals, GA can effectively improve resistance to diseases (Crance et al., 1994). GA has many pharmacological properties, such as antivirus, antiinflammatory, antiallergy, antiulcer and immunoregulatory effects
* Corresponding authors. E-mail addresses: [email protected] (B.-X. Cheng), [email protected] (A.-M. Wang). https://doi.org/10.1016/j.aquaculture.2020.736202 Received 31 August 2020; Received in revised form 14 November 2020; Accepted 22 November 2020 Available online 26 November 2020 0044-8486/© 2020 Elsevier B.V. All rights reserved.
F. Liu et al.
Aquaculture 533 (2021) 736202
the growth performance, immune responses and immune-related gene expression and disease resistance of crustaceans have been performed. Red swamp crayfish (Procambarus clarkii), commonly known as crayfish, is popular among consumers due to its delicious meat and rich nutrition. Crayfish is also an important aquaculture species in China, accounting for 70%–80% of the total output of freshwater crustaceans (Shen et al., 2014). In recent years, with the continuous expansion of artificial breeding areas, the occurrence of diseases is becoming increasingly frequent and serious. Among these diseases, white spot syndrome virus (WSSV) has become a fatal disease in crayfish aqua culture, causing very large losses to the breeding industry (Zhu et al., 2009). WSSV is a kind of double-stranded DNA virus with an envelope and no inclusion body, which can infect most freshwater aquatic animals of Crustacea and Insecta, including shrimp, crayfish, river crab and copepod. Similar to most crustaceans, crayfish mainly rely on nonspe cific immunity but lack an adaptive immune system (Loker et al., 2004). Traditionally, the prevention and treatment of crayfish diseases mainly depend on chemical drugs and antibiotics. Thus, the abuse of antibiotics and other drugs can easily cause many negative effects, such as drug residues, drug resistance in pathogenic microorganisms, environmental pollution, immunosuppression and destruction of organismal micro ecological balance, which seriously impair the cultivation of crayfish. Therefore, Chinese herbal extracts have become a new generation of feed additives to replace antibiotics (Liu et al., 2019). There are few studies on the effects of GA on the growth, anti oxidation, natural immunity and disease resistance of crayfish. There fore, we studied the effects of different doses of GA on the nonspecific immunity and antioxidant capacity of the hemolymph and hepatopan creas in crayfish to identify the optimal concentration of GA to improve the growth and disease resistance of crayfish. We also evaluated the expression of immune-related genes in the crayfish hepatopancreas to support the use of GA as an antioxidant and immunopotentiator. Our aim was to evaluate the effects of GA on the immune responses, immunerelated gene expression and WSSV infection of crayfish to find a kind of immunopotentiator suitable for crayfish feed and to provide a more theoretical basis for disease control.
Table 1 Basal diet and nutrient levels. Nutrient levels (%)c
Ingredients (% dry weight) Fish meal Soybean meal Rapeseed meal Cottonseed meal Soybean oil Flour Rice bran α-Starch Ca(H2PO4)2 Vitamin premixa Mineral premixb Lys Met
3.00 31.30 14.00 8.00 2.50 27.00 6.00 4.00 2.00 1.00 1.00 0.15 0.05
Crude protein Crude lipid Energy/(MJ⋅Kg− 1)
27.17 ± 0.32 5.97 ± 0.03 11.36 ± 0.15
Note a Vitamin premix supplementation of the diet with (mg⋅kg− 1 diet) the following compounds: retinyl acetate, 12,500 IU; vitamin D3, 2800 IU; vitamin K, 5.5; vitamin B1, 3.5; vitamin B2, 21; vitamin B12 0.4, DL-α-tocopherol ace tate, 65; calcium pantothenate, 48; inositol, 870; nicotinic acid, 200; biotin, 1.8; folic acid, 3.4. b Mineral premix (mg⋅kg− 1 diet): FeSO4⋅H2O, 80; CuSO4⋅5H2O, 10; MnSO4⋅H2O, 45; KI, 60; MgSO4⋅7H2O, 1200; ZnSO4⋅H2O, 50; CoCl2⋅6H2O, 50; Na2SeO3, 20. c Nutrient levels: protein, lipids and ash levels are presented as the mean percentages of dry matter (n = 3).
2.2. Sample collection At the end of the 60-day experiment, the crayfish in each pool were not fed for 24 h. Prior to batch sampling, each individual crayfish was compressed in ice for 10 min to induce hypothermic anesthesia and weighed to calculate various growth performance parameters (weight gain, WG; specific growth rate, SGR; feed conversion ratio, FCR; and survival rate, SR). Then, 10 crayfish were randomly selected from each pool to evaluate antioxidant capacity and nonspecific immune index, and 25 crayfish were used in the challenge experiment. To assess the antioxidant capacity and nonspecific immune index of the hemolymph and hepatopancreas, of the hemolymph was collected from the pericardium of each ten crayfish with a one milliliter sterile syringe. The hemolymph was mixed with 1:1 precooled anticoagulant solution (100 mmol⋅L− 1 glucose, 26 mmol⋅L− 1 citrate, 450 mmol⋅L− 1 NaCl, 30 mmol⋅L− 1 citric acid, 10 mmol⋅L− 1 EDTA, pH 7.2) and imme diately centrifuged for 25 min at 9000 rpm and 4 ◦ C (Reinhold, 1953). The supernatant was then collected and stored in a refrigerator at − 20 ◦ C and then used to analyze antioxidant capacity and nonspecific immune indicators. In addition, the hepatopancreas was quickly removed and frozen in liquid nitrogen and then stored in a refrigerator at − 80 ◦ C for RNA extraction and analysis. Hepatopancreas tissue (0.3 g) was used to prepare hepatopancreas homogenate. The hepatopancreas homogenate was further homogenized in 0.86% frozen normal saline (w/v, 1:9) by an Ultra-Turrax homogenizer (Tekmar Company, Cincin nati, Ohio, USA) and centrifuged at 4 ◦ C and 5000 r/min for 10 min for further analysis (Reinhold, 1953).
2. Materials and methods 2.1. Crayfish management experimental diets Crayfish were provided by Jiangsu Jinfeng Agricultural Technology Co., Ltd. Jianhu, Jiangsu, China. Crayfish feed was provided by Tongwei (Dafeng) Feed Co., Ltd. Jiangsu, China. To adapt the crayfish to the new environment, the crayfish were fed twice a day for two consecutive weeks. Crayfish (900 healthy and equal weight crayfish, approximately 5.80 ± 0.10 g) were randomly transferred into six separate tanks (50 in each cement tank, 1.0 × 1.0 × 0.8 m, L:W:H, repeated three times) as different groups. The water temperature was set at 25 ± 1.0 ◦ C, the pH was controlled at 7.40–8.50, and dissolved oxygen (DO) was maintained at more than 6.0 during the experiment. GA (purity of 98%) was provided by Xi’an Shengqing Biotechnology Co. Xi’an, China. The feed composition and formula fed to the experi mental crayfish are shown in Table 1. According to Tian et al., the diet contained approximately 27.17% crude protein and 5.97% crude fat (Tian et al., 2020). GA was supplemented in the diet at 25, 50, 75, 100 and 150 mg⋅kg− 1 (designated the GA25, GA50, GA75, GA100 and GA150 diets, respectively), and the diet without GA (CON diet) was used as a control diet (Table 1). The daily feeding amount was 5% of the body weight of the crayfish. The feeding amount at 6:00 a.m. was 30% of the daily feeding amount and 70% at 18:00 p.m. It was adjusted according to the feeding and growth conditions. The crayfish were fed until full ness every day.
2.3. Nonspecific immunity response assays in the hemolymph and hepatopancreas 2.3.1. Total hemocyte count (THC) measurement According to Alagappan et al. (2016), the hemolymph was diluted 10 times with anticoagulant. A blood cell analyzer was used to measure THC, and the conventional medical analysis method (Olympus IX-71, Tokyo, Japan) was used to count all 4 or 5 squares under an optical microscope. The measurement was repeated three times for each sample.
2
F. Liu et al.
Aquaculture 533 (2021) 736202
2.3.2. PO activity assay According to Ashida (1971), spectrophotometry was used to analyze the activity of phenoloxidase (PO) in hemolymph. Then, 10 μL of he molymph, 300 μL of phosphate buffer (0.1 M, pH 6.0) and 10 μL dihy droxyphenylalanine solution (0.01 M) were added to a 96-well microtitration plate, and the absorbance (optical density of 490 nm [OD490]) was measured every 2 min. An increase in OD490 of 0.001/ min was considered to be an active unit.
between 1.9 and 2.0. An ExScript RT-PCR Kit (China Dalian Takara Co., Ltd.) was used to generate cDNA with 500 ng of DNase-treated RNA, and reverse-transcription PCR and real-time PCR were carried out according to Liu et al. (2016). The mRNA expression levels were analyzed using a SYBR Green I fluorescence kit via a quantitative thermal cycler (Mastercycler EP Realplex, Eppendorf, Germany) (Ming et al., 2012). Relative bax, bi-1, tlr, lectin, NF-κB and hsp70 mRNA levels were quantified using the 2-ΔΔCT method (Livak and Schmittgen, 2001). According to the standard curve, the PCR efficiency was determined by serial dilutions of cDNA: ΔΔCT = (CT, Target - CT, β-actin) time x - (CT, Target - CT, β-actin) time 0. The ExScript RT-PCR Kit, RQ1 RNase-Free DNase and TRIzol reagent were obtained from Dalian Takara Co., Ltd.
2.3.3. Enzyme activities and content assays According to the manufacturer’s guidelines, the enzyme activities and content assays were performed using the corresponding detection kits (Nanjing Jiancheng Bioengineering Institute, Nanjing, Jiangsu, China). The aggregated hemolymph and hepatopancreas were stored at − 80 ◦ C before determined. The T-AOC activity present in the hemo lymph and hepatopancreas samples were determined via colorimetric assays (Marklund and Marklund, 1974). The activity of total superoxide dismutase (T-SOD) in hepatopancreas and hemolymph was determined by a simple micro-plate WST-1 method introduced by Zhou and Prognon (2006). The activity of glutathione peroxidase (GPx) was estimated by H2O2 in the presence of glutathione (GSH) according to Lygren et al. (1999). Malondialdehyde (MDA) in hepatopancreas and hemolymph specimens was determined by reaction of thiobarbituric acid with malondialdehyde and other aldehydes for 60 min at low pH at 95 ◦ C, and the maximum light absorption complex was formed at 534 nm (Satoh, 1978). The ROS were detected by fluorescent probe (Liu et al., 2020a, 2020b). The activity of LZM in hepatopancreas and hemolymph was measured using a micrococcus lysodeikticus lyophilized powder as a substrate (Nanjing Jiancheng Bioengineering Institute, Nanjing, Jiangsu, China) according to Yin et al. (2006). Disodium phenyl phos phate-4-aminoantipyrine‑potassium ferricyanide was used to determine the activity of AKP and disodium phenyl phosphate method was used to determine the activity of ACP according to Liu et al. (2019).
2.5. Challenge experiments Shrimp WSSV was provided by Yellow Sea Fisheries Research (Qingdao, China). The WSSV was purified from shrimp by differential centrifugation. WSSV was injected into the last abdominal segment of crayfish (2.6 × 107 virions per crayfish) for each experimental group according to Liu et al. (2020a, 2020b) and Zhang et al. (2018). After WSSV infection, mortality was recorded at 0, 24, 48, 72, 96, 120 and 168 h. The challenge experiment was conducted in a separate tank. The cumulative mortality (%) was calculated by the following formula : Cumulative mortality (%) ( ) Total mortality in each treatment after challenge = × 100 Total number of crayfish challenged for same treatment 2.6. Statistical analysis Duncan’s multiple range test was performed, and SPSS (version 18.0) software were used for independent sample t-tests. Significant differ ences were identified. The data are expressed as X ± SEM. Before the post test, a homogeneity test and variance analysis were carried out.
2.4. Hepatopancreas immune-related gene expression measurements The expression of bax (Zhang et al., 2018), bax inhibitor-1 (bi-1) (Zhang et al., 2018), toll-like receptor (tlr) (Wang et al., 2015), lectin (Zhang et al., 2011a, 2011b), NF-κB (Qian and Zhu, 2019), heat shock protein 70 (hsp70) (Sun et al., 2009) and 18S rRNA (β-actin) (Dai et al., 2016a, 2016b) in the crayfish hepatopancreas was analyzed via realtime qPCR. The sequences of the primers used in this study are shown in Table 2 (Shanghai Invitrogen Corp). TRIzol reagent was used to extract total RNA from 100 mg of hepatopancreas tissue, and the RNA samples were treated with RQ1 RNase-Free DNase. Total RNA was extracted from 100 mg of hepatopancreas tissue with TRIzol reagent. Subsequently, the quality of RNA was analyzed by a microspectropho tometric method and 1.5% agarose gel electrophoresis. The electro phoresis band was clear and not easy to degrade. The A260/A280 was
3. Results 3.1. Effect of GA on the growth of crayfish The effect of GA on the growth performance of crayfish is shown in Table 3. Four GA-supplemented groups (GA50, GA75, GA100 and GA150) showed significant increases in final body weight (FBW) (P < 0.05) compared with the control group. All five GA-supplemented groups showed significant increases in WG and SGR (P < 0.05) and decreases in FCR compared with the control group. There were no sig nificant changes in SR among the control group and all five treatment groups (P > 0.05).
Table 2 Primers used in this study. Name
Sequence (5′ -3′ )
Annealing temperature (◦ C)
Amplification efficiency
References
bax-F bax-R bi-1-F bi-1-R tlr-F tlr-R lectin-F lectin-R NF-κB -F NF-κB -R hsp70-F hsp70-R 18S rRNA-F 18S rRNA-R
TATAGTTGGCTCATTAGCAG ATACTAAGTGAAGATGACTG TGCCATTACATCTTGGGTTCT CGACCTAATCCCATCTCAAGC TTGCGTAGTGACTTGTGGAGC CTACTGTAACGCAGGCGATGG ACTTTGCTAACGCCAATCCAC CTACGCTGTCATCGACGAACC TAGTGCGTGATGATGGGTCTT GCTGATTATGGAGGCAGAAAA GGTGTTGGTGGGAGGGTCTA GGCTCGCTCTCCCTCATACAC CTGTGATGCCCTTAGATGTT GCGAGGGGTAGAACATCCAA
58
99.16
Zhang et al., 2018
58
98.95
Zhang et al., 2018
58
100.21
Wang et al., 2015
60
99.83
Zhang et al., 2011a, b
51
98.07
Qian et al., 2019
59
101.82
Sun et al., 2009
58
102.63
Dai et al., 2016a, b
3
F. Liu et al.
Aquaculture 533 (2021) 736202
Group
IBW (g)
FBW (g)
WG (%)
SGR (%)
FCR
SR (%)
Control
5.87 ± 0.06 5.77 ± 0.06 5.77 ± 0.12 5.83 ± 0.06 5.80 ± 0.10 5.77 ± 0.06
29.07 ± 1.10d 31.22 ± 0.84cd 32.51 ± 1.48bc 36.46 ± 1.10a 35.92 ± 1.582a 34.77 ± 1.58ab
395.66 ± 19.54d 441.51 ± 19.47c 464.16 ± 34.65bc 525.01 ± 19.94a 519.21 ± 20.92a 503.14 ± 32.21ab
2.67 ± 0.07d 2.81 ± 0.06c 2.89 ± 0.10bc 3.05 ± 0.05a 3.04 ± 0.06a 2.99 ± 0.09ab
2.87 ± 0.03a 2.71 ± 0.08b 2.48 ± 0.76c 2.01 ± 0.08e 2.10 ± 0.10e 2.28 ± 0.10d
98.84a
supplemented groups compared with the control group (P < 0.05) (Fig. 5B, D and E). The mRNA expression levels of tlr and hsp70 were significantly increased in the hepatopancreas of crayfish fed the GA50, GA75, GA100 and GA150 diets compared with the CON diet (P < 0.05) (Fig. 5C and F).
98.29a
3.5. Effect of GA on the crayfish challenge experiment
Table 3 Effects of glycyrrhizic acid on the growth of crayfish.
GA25 GA50 GA75 GA100 GA150
98.82a
The cumulative mortality after WSSV infection is shown in Fig. 6, showing the fastest increase from 72 to 120 h after infection. The cu mulative mortality of the control, GA25, GA50, GA75, GA100 and GA150 groups were 100.00%, 96.33%, 94.00%, 72.00%, 80.00% and 87.67%, respectively. At 72, 96, 120 and 168 h after infection, the cu mulative mortality was significantly higher in the control and GA25 groups than the GA50, GA75, GA100 and GA150 groups (P < 0.05, Fig. 6).
98.59a 98.28a 98.92a
Note: Values labeled with different superscripted lowercase letters in the same column are significantly different according to Duncan’s multiple range test and independent-samples t-test (P < 0.05); data are expressed as− X ± SEM (n = 3). IBW: initial body weight (g); FBW: final body weight (g); SR: survival (%). WG (weight gain) = 100 × [(FBW - IBW)/IBW]. SGR (specific growth rate) = 100 × [ln (FBW) − ln (IBW)/test days]. FCR (feed conversion ratio) = total feed consumption/total weight gain. SR (survival rate) = 100 × (final number of fish/initial number of fish).
4. Discussion 4.1. Effect of GA on the growth and mortality of crayfish after challenge The immunopotentiator effects of GA on the growth, nonspecific immune response and antioxidant capacity of crustaceans were reported for the first time. Many studies have shown that medicinal plant extracts can indirectly or directly promote the growth of crustaceans, improve digestive enzyme activity and feed use efficiency and enhance antioxi dant capacity, immunity and disease resistance (Zheng et al., 2019; Radhakrishnan et al., 2014; Zhu et al., 2018). GA can increase SGR in A. japonicus (Chen et al., 2010). In this study, compared with the CON diet-fed group, the groups fed the GA50, GA75, GA100 and GA150 diets had increased FWB, WG and SGR, decreased FCR, and notably decreased SR after WSSV challenge, which showed that GA could promote the growth of crayfish. Until now, no study has examined the antiviral effect of GA in crustaceans; however, a recent study described the antiviral functions of GA against many viruses, including influenza virus, coro navirus, herpesvirus, human immunodeficiency virus and hepatitis B virus (Yang, 2020). In addition, GA can reduce the mortality of A. japonicus after infection with Vibrio splendidus (Chen et al., 2010) and the mortality of C. auratus after infection with Aeromonas hydrophila (Wang et al., 2007). In this study, the cumulative mortality rates were significantly higher after infection, supporting the anti-WSSV function of GA. This effect may be due to a decrease in oxidative stress by inhibiting pathogenic microorganism infection and improving antioxi dant levels and nonspecific immune indices (Citarasu et al., 2006; Wu et al., 2016). It is well known that there are significant differences in physiological structure between mammals and aquatic animals, including shrimp. However, based on the current research methods and technical conditions, the mechanism underlying this phenomenon is not well understood and needs further study.
3.2. Effect of GA on nonspecific immunity responses in crayfish The nonspecific immunity responses of crayfish hemolymph are presented in Fig. 1. The THC was significantly higher in all five GAsupplemented groups than in the control group (P < 0.05) (Fig. 1A). The activities of PO, T-AOC and GPx were significantly increased (Fig. 1B, C and E), while the activity of MDA was significantly decreased in the hemolymph of crayfish fed the GA50, GA75, GA100 and GA150 diets compared with the CON diet (P < 0.05) (Fig. 1F). T-SOD activity was significantly increased in the hemolymph of crayfish fed the GA75, GA100 and GA150 diets compared with the CON diet (P < 0.05) (Fig. 1D). The nonspecific immune responses of crayfish hepatopancreas are presented in Fig. 2. The activities of T-AOC and GPx were significantly higher (Fig. 2A and C), while the activity of MDA was significantly decreased in the hepatopancreas of crayfish fed the GA50, GA75, GA100 and GA150 diets compared with the CON diet (P < 0.05) (Fig. 2D). TSOD activity was significantly higher in all five GA-supplemented groups than the control group (P < 0.05) (Fig. 2B). 3.3. Effect of GA on the antioxidant capacities of crayfish The antioxidant abilities of crayfish hemolymph are presented in Fig. 3. The ROS content was significantly decreased (Fig. 3A), while the activities of LZM, ACP and AKP in crayfish hemolymph were signifi cantly increased in all five GA-supplemented groups compared with the control group (P < 0.05) (Fig. 3B, C and D). The antioxidant abilities of crayfish hepatopancreas are presented in Fig. 4. The content of ROS was significantly decreased (Fig. 4A), while the activities of LZM and AKP were significantly increased in the hepatopancreas of crayfish fed the GA50, GA75, GA100 and GA150 diets compared with the CON diet (P < 0.05) (Fig. 4B and D). The activity of ACP in crayfish hepatopancreas was significantly increased in all five GA-supplemented groups compared with the control group (P < 0.05) (Fig. 4C).
4.2. Effect of GA on the nonspecific immune response of crayfish THC and PO, T-SOD, GPX and MDA activities have been used to assess the health status of crustaceans. THC is an important sensitive index that reflects the immune response of crustacean blood cells (Zhou et al., 2017). A previous study on Litopenaeus vannamei showed that THC was higher in the group fed Angelica sinensis extract than in the control group (Pan et al., 2018). Additionally, in crayfish, THC was higher in the group fed Rhodiola rosea extract than the control group (Cheng, 2019). In the present study, THC was higher in all five GA-supplemented groups compared with the control group. PO, a key enzyme in the melanin synthesis pathway, plays a prominent role in the immune defense of invertebrates, including crustaceans. PO activity was significantly increased in the hemolymph of crayfish fed the GA50, GA75, GA100 and GA150 diets compared with those that received the CON diet. These results are consistent with the observation that β-1,4-mannobiose could
3.4. Effect of GA on the expression of immune-related genes in crayfish The expression of immune-related genes in crayfish is shown in Fig. 5. The mRNA expression level of bax was significantly decreased (Fig. 5A), while the mRNA expression levels of bi-1, lectin and NF-κB in the crayfish hepatopancreas were significantly increased in all five GA4
F. Liu et al.
Aquaculture 533 (2021) 736202
Fig. 1. Effects of dietary GA on the total hemocyte count (THC) (A), phenoloxidase (PO) activity (B), total antioxidant capacity (T-AOC) (C) and total superoxide dismutase (T-SOD) (D), glutathione peroxidase (GPX) (E) and malondialdehyde (MDA) activities (F) in the hemolymph of crayfish fed the experimental diets for 60 days (means ± SEMs, n = 10). Different letters indicate significant differences (P < 0.05).
enhance PO activity in Marsupenaeus japonicus (Elshopakey et al., 2018). T-AOC reflects the ability of the nonenzymatic system and antioxidant enzymes to externally respond to stimulation and maintain homeostasis, and it is a comprehensive index used to measure the function of the antioxidant system (Xie et al., 2008). T-SOD is an antioxidant enzyme
with a metal cofactor that exists in organisms that can catalyze super oxide anion free radical disproportionation to produce oxygen and hydrogen peroxide and plays an important role in the balance of oxidation and antioxidation. T-SOD is closely related to the occurrence and development of many diseases. GPx is an important member of the 5
F. Liu et al.
Aquaculture 533 (2021) 736202
Fig. 2. Effects of dietary GA on the total antioxidant capacity (T-AOC) (A) and total superoxide dismutase (T-SOD) (B), glutathione peroxidase (GPX) (C) and malondialdehyde (MDA) activities (D) in the hepatopancreas of crayfish fed the experimental diets for 60 days (means ± SEMs, n = 10). Different letters indicate significant differences (P < 0.05).
antioxidant enzyme system. It can effectively eliminate free radicals in organisms by catalyzing the reduction of hydroperoxides to glutathione (GSH) to protect cells from oxidative damage. GPx has potential me dicinal value for the prevention and treatment of various diseases caused by active oxygen (Mosleh et al., 2006). MDA content is an important parameter that reflects the potential antioxidant capacity of the body, the rate and intensity of lipid peroxidation and, indirectly, the degree of tissue peroxidation damage (Freeman and Crapo, 1982). Studies have shown that extracts from A. sinensis could enhance T-SOD and GPX ac tivities, decrease MDA content (Liu et al., 2011) and increase T-AOC and GPX activities in white shrimp (L. vannamei) (Pan et al., 2018). Addi tionally, a S. fusiforme extract enhanced SOD activity in shrimp (Huang et al., 2006). Similarly, Tsai et al. showed that hesperidin from dried tangerine peel could enhance cellular antioxidant capacity (Tsai et al., 2019) and enhance antioxidant status in broiler chicks by reducing the contents of MDA and increasing the activities of T-AOC and GPx (Jiang et al., 2016). In addition, medical research has shown that GA can enhance GPX activity and reduce MDA content in mice (Zhang et al., 2009). Furthermore, GA can enhance SOD activity of A. japonicus (Chen et al., 2010). The above studies mainly focused on broiler chicks and mice, which are different from crustaceans, and no study has examined GA in crustaceans. However, it can be inferred that GA has similar functions in crustaceans to a certain extent. Therefore, the increased TAOC, T-SOD and GPX activities and decreased MDA contents in blood cells and the hepatopancreas inferred that GA could protect the
hepatopancreas and blood cells from lipid peroxidation and protein oxidative carbonylation by increasing the activity of the antioxidant enzymes T-AOC, T-SOD and GPX and by reducing MDA production. The related research requires further strengthening. 4.3. Effect of GA on the antioxidant capacity of crayfish One of the main mechanisms of hemophagocytosis is the production of ROS with a respiratory burst, which leads to oxidative damage. Studies have shown that ROS, including superoxide anion radicals (O−2 ⋅), hydrogen peroxide (H2O2), hydroxyl radicals (OH⋅) and singlet oxy gen, are byproducts of aerobic metabolism (Yu, 1994). Therefore, ROS can be used as a marker of poor animal health. Studies have shown that an Astragalus membranaceus extract could decrease the ROS content in sea cucumber (A. japonicus) (Wang et al., 2009). In our study, ROS content was decreased in the groups of crayfish fed the GA50, GA75, GA100 and GA150 diets compared with the control group. LZM is an important nonspecific immune factor in animals that has a strong killing ¨ck and Peters, 1990). The activities, effect on gram-positive bacteria (Mo including the antibacterial activity, of LZM are directly related to the immune function and health of aquatic animals. Li et al. showed that immune function increases with increasing LZM activity in crustaceans (Li and Li, 2013). AKP, one of the most important metabolic enzymes, can directly participate in the transfer of phosphate groups and meta bolism of calcium and phosphorus. AKP plays an important role in the 6
F. Liu et al.
Aquaculture 533 (2021) 736202
Fig. 3. Effects of dietary GA on reactive oxygen species (ROS) (A), lysozyme (LZM) (B), acid phosphatase (ACP) (C) and alkaline phosphatase (AKP) (D) activities in the hemolymph of crayfish fed the experimental diets for 60 days (means ± SEMs, n = 10). Different letters indicate significant differences (P < 0.05).
absorption and utilization of nutrients in shrimp and fish, which helps to improve the immunity and disease resistance of shrimp and fish (Zhang et al., 2011a, 2011b). ACP is closely related to substance metabolism, is a marker enzyme of macrophage lysosomes, can be induced by exoge nous substances and plays an important role in the immune response. ACP is a typical lysosomal enzyme with similar activity to LZM (Cheng, 1989). Studies have shown that icariin extract from Epimedium grandi florum (Zheng et al., 2019), a honeysuckle stem ethanol extract (Zhao et al., 2018), and taurine (Dong et al., 2018) could increase the activities of LZM, ACP, and AKP in Eriocheir sinensis. Furthermore, fructooligo saccharides (Li et al., 2007) and an A. sinensis extract (Pan et al., 2018) could increase the activity of LZM, ACP and AKP in L. vannamei. Medical research has shown that GA can regulate AKP activity in liver cirrhosis (Song et al., 2020). Additionally, GA can enhance the activities of LZM and ACP in A. japonicus (Chen et al., 2010). In the present study, the LZM, ACP and AKP activities in both hemocytes and the hepatopancreas were significantly increased in the groups of crayfish fed the GA50, GA75, GA100 and GA150 diets compared with the control group. Thus, the decrease in ROS content and increase in LZM, ACP and AKP activities both in hemocytes and the hepatopancreas indicated that dietary GA could enhance immunity in crayfish.
4.4. Effect of GA on the expression of immune-related genes in crayfish The PI3K/AkT signaling pathway plays a key role in the regulation of apoptosis. Bax, an important gene in the PI3K/AkT signaling pathway, is involved in apoptosis and a member of the Bcl-2 family; this gene is normally expressed in the cytoplasm, but it localizes in mitochondria during apoptotic signaling, which induces cytochrome release (Cui et al., 2016). AKT activates bax transport from the cytoplasm to mito chondria (Tsuruta et al., 2002). The Bi-1 protein, as the main inhibitor of Bax-induced cell death, balances and neutralizes Bax activity and acts as a protective force in environmental responses (Kawai et al., 1999). Ac cording to the results of Zhang, bax mRNA expression levels increase after WSSV infection, indicating that WSSV induces mitochondrial bax production and causes bax to be redistributed, resulting in cytochrome release and apoptosis (Zhang et al., 2018). Additionally, regardless of the WSSV infection status, the expression level of bi-1 was found to be significantly decreased by pretreatment with a PI3K-specific inhibitor compared with Tris-HCl pretreatment (Zhang et al., 2018). The crayfish Bi-1 protein inhibits WSSV replication and functions as an antiapoptosis factor that prevents cell procedural death (Du et al., 2013). In this study, bax mRNA expression levels were significantly decreased and bi-1 mRNA expression levels significantly increased in the group of crayfish fed the GA25, GA50, GA75, GA100 and GA150 diets compared with the control group, which suggested that GA could effectively inhibit 7
F. Liu et al.
Aquaculture 533 (2021) 736202
Fig. 4. Effects of dietary GA on reactive oxygen species (ROS) (A), lysozyme (LZM) (B), acid phosphatase (ACP) (C) and alkaline phosphatase (AKP) (D) activities in the hepatopancreas of crayfish fed the experimental diets for 60 days (means ± SEMs, n = 10). Different letters indicate significant differences (P < 0.05).
apoptosis in crayfish. Many studies have shown that a group of proteins called pattern recognition receptors (PRRs) mediate non-self-recognition and function in the first line of defense to enhance the immune response (Lan et al., 2016; Dai et al., 2016a, 2016b). The tlr family is an ancient PRR family member and plays a key role in the innate immune response of in vertebrates to WSSV (Feng et al., 2016). Lectin is also an important PRR that is widely distributed in organisms with diverse functions, including protein synthesis, cell-cell interactions and signal transduction (Tian et al., 2018). Zhang et al. and Wang et al. have shown the role of tlr and lectin in the natural immunity of prawns; it is upregulated upon bacterial infection (Zhang et al., 2018; Wang et al., 2015). In addition, NF-κB is closely related to apoptosis, participates in the transcriptional regulation of many apoptosis-related genes and can both inhibit and promote apoptosis (Dutta et al., 2006). Additionally, hesperetin was found to significantly increase lectin and NF-κB mRNA expression levels (Qian and Zhu, 2019). Thus, the observed upregulated tlr, lectin and NF-κB expression indicated that crayfish immunity was increased and apoptosis inhibited. HSP70 has a variety of functions that promote the immune response and the protection of cytoplasmic components under various stress conditions (Basu et al., 2002). It has been found that hsp70 is upregu lated by immunopotentiator supplementation in yellow catfish
(Pelteobagrus fulvidraco) (Liu et al., 2019) and Megalobrama amblycephala (Liu et al., 2012). Additionally, hesperidin and Codonopsis pilosula polysaccharide led to increased expression of hsp70 in crayfish hepato pancreas (Liu et al., 2020a, 2020b). Therefore, the results showing upregulated hsp70 expression demonstrated increased crayfish immu nity and inhibited apoptosis. Therefore, the downregulated expression of bax and upregulated expression of bi-1, tlr, lectin, NF-κB and hsp70 could indicate that dietary supplementation with 75 to 100 mg⋅kg− 1 GA improves crayfish immu nity. However, the underlying mechanism requires further study. 5. Conclusions In summary, the present results show that at the optimal dose of 75 to 100 mg⋅kg− 1, addition of GA can significantly improve the growth performance, immune response, immune-related gene expression and disease resistance of crayfish. In addition, GA can be used as a new antioxidant, immunopotentiator and antiviral agent for further culti vation of crayfish. However, additional studies with different animal and cellular models are needed to fully evaluate the immune-enhancing and antioxidant activities of GA, as well as the exact molecular mechanisms.
8
F. Liu et al.
Aquaculture 533 (2021) 736202
Fig. 5. Relative expression levels of bax (A), bi-1 (B), tlr (C), lectin (D), NF-κB (E) and hsp70 (F) in the hepatopancreas of crayfish subjected to different levels of dietary GA for 60 days (means ± SEM, n = 10). Different letters indicate significant differences (P < 0.05).
Declaration of Competing Interest
work, there is no professional or other personal interest of any nature or kind in any product, service and/or company that could be construed as influencing the position presented in, or the review of, the manuscript entitled, “Enhanced growth performance, immune responses, immune-
We declare that we have no financial and personal relationships with other people or organizations that can inappropriately influence our 9
F. Liu et al.
Aquaculture 533 (2021) 736202 Dutta, J., Fan, Y., Gupta, N., Fan, G., G´elinas, C., 2006. Current insights into the regulation of programmed cell death by NF-kappaB. Oncogene 25, 6800–6816. Edahiro, T., Hamoguchi, M., Kusuda, R., 1990. Effect of glycyrrhizine against streptococcal infection of young yellowtail, Seriola quinqueradiata. Suisanzoshoku 38, 239–243. Elshopakey, G.E., Risha, E.F., Abdalla, O.A., Okamura, Y., Hanh, V.D., Ibuki, M., Sudhakaran, R., Itami, T., 2018. Enhancement of immune response and resistance against Vibrio parahaemolyticus in kuruma shrimp (Marsupenaeus japonicus) by dietary supplementation of β-1,4-mannobiose. Fish Shellfish Immunol. 74, 26–34. Feng, J., Zhao, L., Jin, M., Li, T., Wu, L., Chen, Y., Ren, Q., 2016. Toll receptor response to white spot syndrome virus challenge in giant freshwater prawns (Macrobrachium rosenbergii). Fish Shellfish Immunol. 57, 148–159. Freeman, B.A., Crapo, J.D., 1982. Biology of disease: free adicals and tissue injury. Lab. Investig. 47, 412–426. Huang, X.X., Zhou, H.Q., Zhang, H., 2006. The effect of Sargassum fusiforme polysaccharide extracts on vibriosis resistance and immune activity of the shrimp, Fenneropenaeus chinensis. Fish Shellfish Immunol. 20, 750–757. Jang, S.I., Marsden, M.J., Kim, Y.G., Choi, M.S., Secombes, C.J., 1995. The effect of glycyrrhizin on rainbow trout, Oncorhynchus mykiss (Walbaum), leucocyte responses. J. Fish Dis. 18, 307–315. Jiang, X.R., Zhang, H.J., Wang, J., Wu, S.G., Yue, H.Y., Lü, H.Y., Cui, H., Bontempo, V., Qi, G.H., 2016. Effect of dried tangerine peel extract supplementation on the growth performance and antioxidant status of broiler chicks. Ital. J. Anim. Sci. 15, 642–648. Kao, T.C., Shyu, M.H., Yen, G.C., 2010. Glycyrrhizic acid and 18 β-glycyrrhetinic acid inhibit inflammation via PI3K/Akt/GSK3β signaling and glucocorticoid receptor activation. J. Agric. Food Chem. 58, 8623–8629. Kawai, M., Pan, L., Reed, J.C., Uchimiya, H., 1999. Evolutionally conserved plant homologue of the Bax inhibitor-1 (BI-1) gene capable of suppressing Bax-induced cell death in yeast(1). FEBS Lett. 464, 143–147. Lan, J.F., Wei, S., Wang, Y.Q., Dai, Y.J., Tu, J.G., Zhao, L.J., Li, X.C., Qin, Q.W., Chen, N., Lin, L., 2016. PcToll3 was involved in anti-Vibrio response by regulating the expression of antimicrobial peptides in red swamp crayfish, Procambarus clarkii. Fish Shellfish Immunol. 57, 17–24. Li, H., Zhang, T.E., Li, Q., 2013. Influence of compound Chinese herbal medicine on nonspecific immunity of turbot Scophthalmus maximus. J Dalian Ocean Univ. 28 (2), 115–120. Li, P., Burr, G.S., Gatlin, D.M., Hume, M.E., Patnaik, S., Castille, F.L., Lawrence, A.L., 2007. Dietary supplementation of short-chain fructooligosaccharides influences gastrointestinal microbiota composition and immunity characteristics of Pacific white shrimp, Litopenaeus vannamei, cultured in a recirculating system. J. Nutr. 137 (12), 2763–2768. Liu, X.L., Xi, Q.Y., Yang, L., Li, H.Y., Jiang, Q.Y., Shu, G., Wang, S.B., Gao, P., Zhu, X.T., Zhang, Y.L., 2011. The effect of dietary Panax ginseng polysaccharide extract on the immune responses in white shrimp, Litopenaeus vannamei. Fish Shellfish Immunol. 30, 495–500. Liu, B., Ge, X., Xie, J., Xu, P., He, Y., Cui, Y., Ming, J., Zhou, Q., Pan, L., 2012. Effects of anthraquinone extract from rheum officinale bail on the physiological responses and HSP70 gene expression of Megalobrama amblycephala under Aeromonas hydrophila infection. Fish Shellfish Immunol. 32 (2012), 1–7. Liu, F., Shi, H.Z., Guo, Q.S., Yu, Y.B., Wang, A.M., Lv, F., Shen, W.B., 2016. Effects of astaxanthin and emodin on the growth, stress resistance and disease resistance of yellow catfish (Pelteobagrus fulvidraco). Fish Shellfish Immunol. 51, 125–135. Liu, F., Qu, Y.K., Wang, A.M., Yu, Y.B., Yang, W.P., Lv, F., Nie, Q., 2019. Effects of carotenoids on the growth performance, biochemical parameters, immune responses and disease resistance of yellow catfish (Pelteobagrus fulvidraco) under hightemperature stress. Aquaculture 503, 293–303. Liu, F., Qu, Y.Q., Geng, C., Wang, A.M., Zhang, J.H., Chen, K.J., Liu, B., Tian, H.Y., Yang, W.P., Yu, Y.B., 2020a. Effects of hesperidin on the growth performance, antioxidant capacity, immune responses and disease resistance of red swamp crayfish (Procambarus clarkii). Fish Shellfish Immunol. 99, 154–166. Liu, F., Geng, C., Qu, Y.K., Cheng, B.X., Zhang, Y., Wang, A.M., Zhang, J.H., Liu, B., Tian, H.Y., Yang, W.P., Yu, Y.B., Chen, Z.B., 2020b. The feeding of dietary Codonopsis pilosula polysaccharide enhances the immune responses, the expression of immunerelated genes and the growth performance of red swamp crayfish (Procambarus clarkii). Fish Shellfish Immunol. 103, 321–331. Livak, K.J., Schmittgen, T.D., 2001. Analysis of relative gene expression data using realtime quantitative PCR and the 2− ΔΔCT method. Methods 25 (4), 402–408. Loker, E.S., Adema, C.M., Zhang, S.M., Kepler, T., 2004. Invertebrate immune systemsnot homogeneous, not simple, not well understood. Immunol. Rev. 198 (1), 10–24. Lygren, B., Hamre, K., Waagbø, R., 1999. Effects of dietary pro- and antioxidants on some protective mechanisms and health parameters in Atlantic salmon. J. Aquat. Anim. Health 11 (3), 211–221. Marklund, S., Marklund, G., 1974. Involvement of the superoxide anion radical in the autoxidation of pyrogallol and a convenient assay for superoxide dismutase. Eur. J. Biochem. 47, 469–474. Ming, J., Xie, J., Xu, P., Ge, X., Liu, W., Ye, J., 2012. Effects of emodin and vitamin C on growth performance, biochemical parameters and two HSP70s mRNA expression of Wuchang bream (Megalobrama amblycephala Yih) under high temperature stress. Fish Shellfish Immunol. 32, 651–661. M¨ ock, A., Peters, G., 1990. Lysozyme activity in rainbow trout, Oncorhynchus mykiss (Walbaum), stressed by handling, transport and water pollution. J. Fish Biol. 37 (6), 873–885. Mosleh, Y.Y., Paris-Palacios, S., Biagianti-Risbourg, S., 2006. Metallothioneins induction and antioxidative response in aquatic worms Tubifex tubifex (Oligochaeta, Tubificidae) exposed to copper. Chemosphere 64, 121–128.
Fig. 6. Effects of GA on the cumulative mortality of crayfish after infection with WSSV (2.6 × 107 virions per crayfish, n = 25). Note: Different lowercase letters at each sampling point for the different dosage groups indicate signifi cant differences according to Duncan’s multiple range test (P < 0.05).
related gene expression and disease resistance of red swamp crayfish (Procambarus clarkii) fed dietary glycyrrhizic acid”. Acknowledgments This study was financially supported by the Fund for Jiangsu Agri cultural Industry Technology System (Red Swamp Crayfish) (JATS [2019]229, JATS[2019]463), the NSFC (Grant No. 82073968), the Hunan Provincial Key Laboratory of Nutrition and Quality Control of Aquatic Animals (No. 2018TP1027) and the Fishery Science and Tech nology in Jiangsu Province (D2018-5). References Alagappan, K., Karuppiah, V., Deivasigamani, B., 2016. Protective effect of phages on experimental V. parahaemolyticus infection and immune response in shrimp (Fabricius, 1798). Aquaculture 453, 86–92. Ashida, M., 1971. Purification and characterization of pre-phenoloxidase from haemolymph of the silkworm Bombyx mori. Arch. Biochem. Biophys. 144 (2), 749–762. Basu, N., Todgham, A.E., Ackerman, P.A., Bibeau, M.R., Nakano, K., Schulte, P.M., Iwama, G.K., 2002. Heat shock protein genes and their functional significance in fish. Gene 295, 173–183. Chen, X.R., Zhang, W.B., Mai, K.S., Tan, B.P., Ai, Q.H., Xu, W., Ma, H.M., Wang, X.J., Liufu, Z.G., 2010. Effects of dietary glycyrrhizin on growth, immunity of sea cucumber and its resistance against Vibrio splendidus. Acta Hydrobiol. Sinica 34, 731–738. Cheng, T.C., 1989. Immunodeficiency diseases in marine mollusks: measurements of some variables. J. Aquat. Anim. Health 1 (3), 209–216. Cheng, Y., 2019. The growth performance and nonspecific immunity of red swamp crayfish Procambarus clarkia affected by dietary Rhodiola rosea polysaccharide. Fish Shellfish Immunol. 93, 796–800. Citarasu, T., Sivaram, V., Immanuel, G., Rout, N., Murugan, V., 2006. Influence of selected Indian immunostimulant herbs against white spot syndrome virus (WSSV) infection in black tiger shrimp, Penaeus monodon with reference to haematological, biochemical and immunological changes. Fish Shellfish Immunol. 21 (4), 372–384. Crance, J., Leveque, F., Biziagos, E., 1994. Studies on mechanism of action of glycyrrhizin against hepatitis a virus replication in vitro. Antivir. Res. 23, 63–76. Cui, Y., Lu, P., Song, G., Liu, Q., Zhu, D., Liu, X., 2016. Involvement of PI3K/AKT, ERK and p38 signaling pathways in emodin-mediated extrinsic and intrinsic human hepatoblastoma cell apoptosis. Food Chem. Toxicol. 92, 26–37. Dai, L.S., Sun, Y., Sun, Y.X., Zhu, B.J., Liu, C.L., 2016a. Characterization and function of a cathepsin B in red crayfish (Procambarus clarkii) following lipopolysaccharide challenge. Fish Shellfish Immunol. 56, 162–168. Dai, Y., Wang, Y., Zhao, L., Qin, Z., Yuan, J., Qin, Q., Lin, L., Lan, J., 2016b. A novel Ltype lectin was required for the multiplication of WSSV in red swamp crayfish (Procambarus clakii). Fish Shellfish Immunol. 55, 48–55. Dong, J., Cheng, R.J., Yang, Y.H., Zhao, Y.Y., Wu, G.F., Zhang, R.Y., Zhu, X.C., Li, L., Li, X.D., 2018. Effects of dietary taurine on growth, non-specific immunity, antioxidative properties and gut immunity in the Chinese mitten crab Eriocheir sinensis. Fish Shellfish Immunol. 82, 212–219. Du, Z.Q., Lan, J.F., Weng, Y.D., Zhao, X.F., Wang, J.X., 2013. BAX inhibitor-1 silencing suppresses white spot syndrome virus replication in red swamp crayfish, Procambarus clarkii. Fish Shellfish Immunol. 35, 46–53.
10
F. Liu et al.
Aquaculture 533 (2021) 736202 expression in the freshwater crayfish. Procambarus clarkii. Fish Shellfish Immunol. 43, 219–229. Wu, P., Li, Y.L., Cheng, J., Chen, L., Zhu, X., Feng, Z.G., Zhang, J.S., Chu, W.Y., 2016. Daily rhythmicity of clock gene transcript levels in fast and slow muscle fibers from Chinese perch (Siniperca chuatsi). BMC Genomics 17, 1008. Xie, J., Liu, B., Zhou, Q., Su, Y., He, Y., Pan, L., Ge, X., Xu, P., 2008. Effects of anthraquinone extract from rhubarb Rheum officinale bail on the crowding stress response and growth of common carp (Cyprinus carpio var. Jian). Aquaculture 281, 5–11. Yang, X.W., 2020. Antiviral effect of glycyrrhizic acid. Modern Chin. Med. https://doi. org/10.13313/j.issn.1673-4890.20200221002. Yin, G.J., Jeney, G., Racz, T., Xu, P., Xie, J., Jeney, Z., 2006. Effect of two Chinese herbs (Astragalus radix and Scutellaria radix) on non-specific immune response of tilapia, Oreochromis niloticus. Aquaculture 253 (1–4), 39–47. Yu, B., 1994. Cellular defenses against damage from reactive oxygen species. Physiol. Rev. 74, 139–162. Zhang, Z.S., Cui, C.C., Sun, Y., 2009. Protection effect of glycyrrhizic acid against alcohol-induced liver injury in mice. Food Sci.Technol. 34 (5), 225–227. Zhang, X.W., Wang, X.W., Sun, C., Zhao, X.F., Wang, J.X., 2011a. C-type lectin from red swamp crayfish Procambarus clarkii participates in cellular immune response. Arch Insect Biochem. 76, 168–184. Zhang, H.J., Li, Z.J., Zhang, J.S., Guo, Z.X., Wen, G.L., Cao, Y.C., Wu, Y., 2011b. Changes in non-specific immune parameters and water quality in Pacific white leg shrimp Litopenaeus vannamei culture ponds. J. Dalian Ocean Univ. 26 (4), 356–361. Zhang, H., Yao, X., Ding, Y., Xu, Z., Liang, R., Zhang, Y., Wu, Y., Li, B., Guan, B., 2018. PI3K signaling pathways modulated white spot syndrome virus (WSSV) replication in Procambarus clarkia. Fish Shellfish Immunol. 76, 279–286. Zhao, Z.L., Zhang, H.J., Wang, M.Q., Zhang, C., Kuang, P.Q., Zhou, Z., Zhang, G.Z., Wang, Z., Zhang, B.B., Shi, X.W., 2018. The ethanol extract of honeysuckle stem modulatesthe innate immunity of Chinese mitten crab Eriocheir sinensis against Aeromonas hydrophila. Fish Shellfish Immunol. 82 (2018), 304–311. Zheng, X., Chi, C., Xu, C., Liu, J., Zhang, C., Zhang, L., Huang, Y., He, C., He, Chang, Jia, X., Liu, W., 2019. Effects of dietary supplementation with icariin on growth performance, antioxidant capacity and non-specific immunity of Chinese mitten crab (Eriocheir sinensis). Fish Shellfish Immunol. 90, 264–273. Zhou, J.Y., Prognon, P., 2006. Raw material enzymatic activity determination: a specific case for validation and comparison of analytical methods-the example of superoxide dismutase (SOD). J. Pharm. Biomed. Anal. 40 (5), 1143–1148. Zhou, M., Wu, Z., Liang, R., Gu, N., 2017. Effects of dietary taurine, carnitine and cholesterol supplementation on growth performance and immunological status of Litopenaeus vannamei under cold exposure. Aquac. Res. 48, 1279–1290. Zhu, F., Du, H.H., Miao, Z.G., Quan, H.Z., Xu, Z.R., 2009. Protection of Procambarus clarkia against white spot syndrome virus using inactivated WSSV. Fish Shellfish Immunol. 26, 685–690. Zhu, M., Long, X.H., Wu, S.H., 2018. Effects of dietary trehalose on the growth performance and nonspecific immunity of white shrimps (Litopenaeus vannamei). Fish Shellfish Immunol. 78, 127–130.
Pan, S., Jiang, L., Wu, S., 2018. Stimulating effects of polysaccharide from Angelica sinensis on the nonspecific immunity of white shrimps (Litopenaeus vannamei). Fish Shellfish Immunol. 74, 170–174. Qian, X., Zhu, F., 2019. Hesperetin protects crayfish Procambarus clarkii against white spot syndrome virus infection. Fish Shellfish Immunol. 93, 116–123. ˇ Raˇckov´ a, L., Janˇcinov´ a, V., Petríkov´ a, M., Dr´ abikov´ a, K., Nos´ aˇl, R., Stefek, M.,
Kost´ alov´ a, D., Pr´ onayov´ a, N., Kov´ acov´ a, M., 2007. Mechanism of anti-inflammatory action of liquorice extract and glycyrrhizin. Nat. Prod. Res. 21, 1234–1241. Radhakrishnan, S., Bhavan, P.S., Seenivasan, C., Shanthi, R., Poongodi, R., 2014. Influence of medicinal herbs (Alteranthera sessilis, Eclipta alba and Cissus qudrangularis) on growth and biochemical parameters of the freshwater prawn Macrobrachium rosenbergii. Aquac. Int. 22 (2), 551–572. Reinhold, J.G., 1953. Manual determination of total serum proteins, albumin and globulin fractions by biuret method. In: Reiner, M. (Ed.), Standard Method of Clinical Chemistry. Academic Press, New York, p. 88. Satoh, K., 1978. Serum lipid peroxide in cerebrovascular disorders determined by a new colorimetric method. Clin. Chim. Acta 90 (1), 37–43. Shen, H., Hu, Y., Ma, Y., Zhou, X., Xu, Z., Shui, Y., Li, C., Xu, P., Sun, X., 2014. In-depth transcriptome analysis of the red swamp crayfish Procambarus clarkia. PLoS One 10, e110548. Song, Q., Wang, W., Lu, Y., 2020. Clinical observation of magnesium isoglycyrrhizinate combined with somatostatin in treatment of liver cirrhosis. Drug Eval. Res. 43 (4), 725–728. Sun, Y., Zhang, L., Li, M.C., Wu, R., Lei, L.M., Xie, S.T., 2009. Cloning and expression analysis of an inducible heat shock protein 70 gene from red swamp crayfish. Acta Hydrobiol. Sin. 33, 627–635. Tian, Y., Chen, T., Huang, W., Luo, P., Huo, D., Yun, L., Hu, C., Cai, Y., 2018. A new Ltype lectin (LvLTLC1) from the shrimp Litopenaeus vannamei facilitates the clearance of Vibrio harveyi. Fish Shellfish Immunol. 73 (2018), 185–191. Tian, H., Yang, C., Yu, Y., Yang, W., Lu, N., Wang, H., Liu, F., Wang, A., Xu, X., 2020. Dietary cholesterol level affects growth, molting performance and ecdysteroid signal transduction in Procambarus clarkii. Aquaculture 523, 735198. Tsai, Y.F., Chen, Y.R., Che, N.J.P., Tang, Y., Yang, K.C., 2019. Effect of hesperidin on anti-inflammation and cellular antioxidant capacity in hydrogen peroxidestimulated human articular chondrocytes. Process Biochem. 85, 175–184. Tsuruta, F., Masuyama, N., Gotoh, Y., 2002. The phosphatidylinositol 3-kinase (PI3K)AKT pathway suppresses Bax translocation to mitochondria. J. Biol. Chem. 277, 14040–14047. Wang, W.B., Fang, P., Lin, X.T., Xia, L., Qi, C.B., Wang, J.G., Sun, J., 2007. Effect of liquorice extracts on the resistance of Carassius auratus to stress and pathogen infection. Freshwater Fish. 37, 3–6. Wang, T., Sun, Y., Jin, L., Xu, Y., Wang, L., Ren, T., Wang, K., 2009. Enhancement of nonspecific immune response in sea cucumber (Apostichopus japonicus) by Astragalus membranaceus and its polysaccharides. Fish Shellfish Immunol. 27, 757–762. Wang, Z., Chen, Y.H., Dai, Y.J., Tan, J.M., Huang, Y., Lan, J.F., Ren, Q., 2015. A novel vertebrates toll-like receptor counterpart regulating the antimicrobial peptides
11