Epigenetic upregulation of alpha-synuclein in the rats exposed to methamphetamine

European Journal of Pharmacology 745 (2014) 243–248

Contents lists available at ScienceDirect

European Journal of Pharmacology journal homepage: www.elsevier.com/locate/ejphar

Behavioural pharmacology

Epigenetic upregulation of alpha-synuclein in the rats exposed to methamphetamine Wenda Jiang a,n, Ji Li a, Zhuang Zhang a, Hongxin Wang b, Zhejian Wang c a

Department of Neurology Fist Affiliated Hospital of Liaoning Medical University, 5-2 Renmin Street, Jinzhou, Liaoning 121000, China Institute of Medicine Liaoning Medical University, Jinzhou 121000, China c Dalian Medical University, Dalian, Liaoning 116044, China b

art ic l e i nf o

a b s t r a c t

Article history: Received 14 April 2014 Received in revised form 23 October 2014 Accepted 23 October 2014 Available online 5 November 2014

Abuse of methamphetamine (METH) increases the risk of occurrence of Parkinson's disease (PD) in the individuals. Increased expression of synaptic protein α-synuclein (encoded by gene Snca) is remarkably associated with the neuronal loss and motor dysfunction in the patients with PD. The present study aimed to explore the epigenetic mechanism underlying the altered expression of α-synuclein in substantia nigra in the rats previously exposed to METH. Exposure to METH induced significant behavioral impairments in the rotarod test and open field test, as well as the upregulation of cytokine synthesis in the substantia nigra. Significantly increased expression of α-synuclein was also observed in the substantia nigra in the rats exposed to METH. Further chromatin immunoprecipitation and bisulfite sequencing studies revealed a significantly decreased cytosine methylation in the Snca promoter region in the rats exposed to METH. It was found that the occupancy of methyl CpG binding protein 2 and DNA methyltransferase 1 in Snca promoter region was also significantly decreased in the substantia nigra in the modeled rats. These results advanced our understanding on the mechanism of the increased incidence of PD in the individuals with history use of METH, and shed novel lights on the development of therapeutic approaches for the patients conflicted with this neurological disorder. & 2014 Elsevier B.V. All rights reserved.

Keywords: α-synuclein Methamphetamine DNA methylation Methyl CpG binding protein 2 DNA methyltransferase 1

1. Introduction Abuse of methamphetamine (METH) may induce substantial neurotoxicity in dopaminergic neurons in several brain regions and impair the motor and cognitive function in the individuals (Ares-Santos et al., 2013; Silverstein et al., 2011). A recent retrospective population-based large-scale cohort study found a significantly increased risk for developing Parkinson's disease in the individual with a history use of METH or amphetamine (Callaghan et al., 2012). METH is a potent inducer of dopamine release and is toxic to dopaminergic neurons. Previous studies found that exposure to METH induced significant oxidative stress resulting from the dysregulation of the dopaminergic system, hyperthermia, apoptosis, and neuroinflammation, thus leading to neurotoxicity and impairments of brain function (Silverstein et al., 2011). Although many efforts have made, currently the question remains unanswered why previous exposure to METH induces the longlasting risk of the occurrence of Parkinson's-like behavior in the individuals.

n

Corresponding author. Tel.: þ 86 4162942717. E-mail address: [email protected] (W. Jiang).

http://dx.doi.org/10.1016/j.ejphar.2014.10.043 0014-2999/& 2014 Elsevier B.V. All rights reserved.

Parkinson's disease (PD) is characterized by the selective degeneration of projecting dopaminergic neurons in the substantia nigra and the diminished dopamine levels in the striatum (Bagetta et al., 2010), and the presence of Lewy bodies and neurites containing α-synuclein aggregates in these brain regions (Dauer and Przedborski, 2003; Goedert, 2001), which leads to the impairments of motor coordination and balance. α-synuclein, encoded by Snca, generally binds synaptic vesicle membranes and potentially assists vesicle trafficking and the formation of soluble NSF (N-ethylmaleimide sensitive fusion protein) attachment protein receptor complex, thus contributing to the maintenance of normal synaptic function (Norris et al., 2004; Rizo and Sudhof, 2012). Meanwhile, increase of α-synuclein is substantially associated with the central neuroinflammation and neurodegeneration in the substantia nigra in the rodent model of PD (Lee et al., 2014). It was previously reported that repeated exposure to METH increased the expression of α-synuclein in the dopaminergic neurons in the substantia nigra in the rodent (Fornai et al., 2005; Mauceli et al., 2006), while the mechanism remained unclear. Currently, emerging evidences implied critical involvement of epigenetic modification of the expression of specific genes, including Snca, in the pathogenesis and development of several neurodegenerative diseases (Desplats et al., 2011; Tan

244

W. Jiang et al. / European Journal of Pharmacology 745 (2014) 243–248

et al., 2014). Hence, in order to elucidate the mechanism underlying the long-lasting increased incidence of PD in the individuals with previous use of METH, the present study aimed to investigate the epigenetic mechanism underlying the alteration of α-synuclein in the substantia nigra in the rodents previously exposed to METH.

2. Materials and methods 2.1. Animals and drug administration Adult male Wistar rats (200–220 g) were obtained from the Institutional Center of Experiment Animals, and were housed in the standard lab conditions (2272 1C and 12:12 h light cycle) with free access to food and water. All animal protocols were approved by the Institutional Animal Care and Use Committee, and were performed following the guidelines of National Institution of Health. (þ)-Methamphetamine (METH, Sigma-Aldrich) hydrochloride was dissolved in 0.9% saline. (þ)–METH (20 mg/kg for 5 days) was injected intraperitoneally, and saline in the same volume was injected in the rats in control group (Ares-Santos et al., 2013). Behavioral tests were performed at 6, 10 and 14 days after the initial injection of METH to evaluate the motor function in the animals. 2.2. Motor performance testing Motor performance was evaluated using a rotarod apparatus as previously described (Marques et al., 2014). The animals were placed in a rotarod with 60 mm diameter textured rod, 75 mm in length, rotating at a speed of 25 rpm. Each animal was tested 5 times with a 5 min interval between each trial and the maximum duration of the test was 5 min. The time spent by the animal on the rotarod was recorded as the falling latency.

DNA methyltransferases 1 (DNMT1) (1:100, Millipore, MA) were used to pull down the DNA fragments. Immunocomplexes were collected with the salmon sperm DNA/protein A agarose beads. After extensive wash with the buffers provided by the manufacturer, the cross-linking between histone and DNA was reversed. DNA fragments were purified, and real-time PCR was performed with the primers designed to amplify about 200- bp fragments in the promoter region of the target genes as following: for Snca: 50 GGCTGTGTGAACAAAAGCAA-30 and 50 -TGAACTTGAGCTGGCCTCTT30 ; for Gapdh: 50 -AGACAGCCGCATCTTCTTGT-30 and 50 -CGTCCTCTACCATCCTCTGC-30 . The ChIP/input ratio (ChIP %) was calculated and compared among the groups. 2.6. Methylated DNA immunoprecipitation (MeDIP) assay The MeDIP assay was carried out as previously described with minor modification (Provencal et al., 2013). Briefly, substantia nigra tissue was homogenized in the lysis buffer and genomic DNA was sonicated on ice 8  10 s. Sonicated samples were centrifuged at 14,000g for 10 min, and the supernatants were collected. The polyclonal antibody against 5-methylcytosine (1:100, Millipore) was added to each sample and incubated overnight at 4 1C with gentle mixing. The DNA–antibody complex was enriched with protein A agarose beads. DNA fragments in the input and pulled-down fractions were then purified with phenol–chloroform extraction followed by acid ethanol precipitation. Real-time PCR was performed to amplify about 250- bp segments corresponding to CpG sites within Snca promoter region. Primer sets were used as following: Snca: 50 GGCTGTGTGAACAAAAGCAA-30 and 50 -TGAACTTGAGCTGGCCTCTT-30 ; for Gapdh: 50 -AGACAGCCGCATCTTCTTGT -30 and 50 -CGTCCTCTACCATCCTCTGC-30 . Amplifications were run in triplicate, and the PCR data were analyzed as above. 2.7. Bisulfite sequencing PCR

2.3. Locomotor activity Locomotor experiments were conducted as previously described (Arndt et al., 2014). The locomotor chambers were 40  40  40 cm3 (Coulbourn Instruments) and had clear Plexiglas walls with a stainless steel floor covered with a thin layer of pinechip bedding. Photobeams were arranged in a 16 (x-axis) photocell array, spaced 2.54 cm apart. During each locomotor test session (60 min), a 70-db white noise was generated to mask any possible background noise. Locomotor activity was measured by recording the moving distance in centimeters. 2.4. Enzyme-linked immunosorbent assay (ELISA) ELISA study was performed with commercial ELISA kits to detect the content of α-synuclein (Millipore), IL-1β and TNF-α (R & D Systems) in the substantia nigra as previously reported (Ma et al., 2013). The substantia nigra tissues from the rats in all groups were collected, and processed with commercial ELISA kits following the instructions provided by the manufacturer. 2.5. Chromatin Immunoprecipitation (ChIP) and real-time PCR The ChIP assay was carried out as described previously with minor modifications (Wang et al., 2007). The substantia nigra tissues from the rats were collected and cross-linked with 1% paraformaldehyde for 2 min. The tissue was kept in RIPA buffer (140 mM NaCl, 1 mM ethylenediaminetetraacetic acid, 10 mM Tris–HCl, 1% Triton X-100, 0.1% Sodium dodecyl sulfate, 0.1% sodium deoxycolate) and sonicated 8  10 s on ice to produce DNA fragments with the size of 400–500 bp. The polyclonal antibodies against methyl CpG binding protein 2 (MeCP2) or

DNA samples were prepared from the substantia nigra, purified, processed for the bisulfite modification with the EZ DNA Methylation-Gold™ kit (Zymo Research) (Liu et al., 2014). A fragment (about 250 bp) in the promoter region of Snca was amplified by the primers as following: (5Q.AGGTGAAATTTAGGTTATTTTTTTT-3GTGAAACTCTAACTCCCTAACTCCTTCAC-3CT. The PCR product was then purified using a gel extraction kit (Qiagen) and sequenced using the reverse primer at the institutional core facility. The percentage methylation of each CpG site within the region amplified was determined by the ratio between peaks values of guanine (G) and adenine (A) (G/[GþA]), and these levels on the electropherogram were determined using Chromas software. 2.8. Retroscribed real-time PCR Substantia nigra tissues were sampled from the rats in all group. Total RNA was prepared with Trizol reagent (Invitrogen), and reverse transcribed by using a SYBR Green reverse transcription (RT)–PCR Reagents kit (Applied Biosystems, Foster City, CA). The primers were designed to amplify about 200bP fragments within the cDNA sequence of the target genes as following: for α-synuclein: 50 AGAAAACCAAGCAGGGTGTG-30 and 50 -GCTCCCTCCACTGTCTTCTG-30 ; and for GAPDH: 50 - AGACAGCCGCATCTTCTTGT -30 and 50 -CTTGCCGTGGGTAGAGTCAT-30 . The threshold cycle (Ct) values for each sample were determined with the amplification plots within the logarithmic phase. Data were analyzed by using the 2-ΔΔCt method. 2.9. Statistical analysis All chemicals and reagents were purchased from Sigma-Aldrich (St. Louis, MO) or other commercial sources. All data were

W. Jiang et al. / European Journal of Pharmacology 745 (2014) 243–248

presented as means 7S.E.M., and statistically analyzed with student t test and one- or two-way ANOVA with post hoc analysis. The criterion for statistical significance was Po 0.05.

3. Results 3.1. Behavioral impairments and increased cytokine synthesis in substantia nigra in the rats injected with METH As shown in Fig. 1A, injection with METH (20 mg/kg for 5 days) significantly decreased the time spent on the rod at day 6 through day 14 in the rats, which indicates an impaired motor balance. The rats injected with METH also exhibited significant less moving distance in the open field test at day 6 through day 14 (Fig. 1B). Further ELISA study also revealed significantly increased synthesis of cytokines (IL-1β and TNF-α) in the substantia nigra at day 6 through day 14 in the rats injected with the METH (Fig. 1C). Note that injection with METH (20 mg/kg for 3 days, i.e., at day 4 after initial treatment) did not sufficiently induce significant change in the behavioral tests and cytokines synthesis, while consistent trend existed (Fig. 1). Collectively, these results indicated that injection with METH (20 mg/kg for 5 days) induced significant nigral neuroinflammation and motor dysfunction in the rats. 3.2. Increased α-synuclein protein and mRNA in the substantia nigra in the rats injected with METH Previous evidences demonstrated that upregulation of αsynuclein induced central neuroinflammation and contributed to the behavioral impairments in the rodent model of PD (Lee et al., 2014). Here, ELISA study was performed to detect the expression

245

of α-synuclein in the rats at 14 days after initial injection with METH. As shown in Fig. 2A, significantly increased expression of αsynuclein was observed in the substantia nigra of the rats injected with METH. Consistently, as shown in Fig. 2B, an increased level of mRNA of α-synuclein was further observed in the substantia nigra of the modeled rats. These results implied the upregulation of αsynuclein might contribute to the neuroinflammation and motor dysfunction in the rats injected with METH. 3.3. Decreased 50 -mc in the Snca promoter region in the rats injected with METH The ChIP studies with polyclonal antibody against 50 -methylcytosine was performed to detect the DNA methylation in the Snca promoter region in substantia nigra in the rats at 14 days after initial injection with METH. As shown in Fig. 3A, significant reduction of the cytosine methylation was observed in the Snca, but not Gapdh, promoter region in the substantia nigra in the rats injected with METH. Further bisulfite PCR sequencing studies, as shown in Fig. 3B, illustrated the change of methylation of CpG sites in a fragment in Snca promoter region in the rats injected with METH. These results demonstrated a significant reduction of DNA methylation in Snca promoter region, which potentially underlay the increased nigral expression of α-synuclein induced by METH. 3.4. Decreased MeCP2 and DNMT1 occupancy in the Snca promoter region in the rats injected with METH Transcriptional factor MeCP2 usually binds to the methylated CpG sites in the promoter region, and recruits several other transcriptional factors to modify the histone acetylation and gene

Fig. 1. Injection with METH (20 mg/kg for 5 days) induced significant motor dysfunction and cytokine synthesis in the rats. A: Significantly decreased time spent on the rod was observed in the rats injected with METH in the rotarod test (from day 6 through day 14, n¼ 10–12 rats in each group). B: Significant less moving distance was observed in the modeled rats in the open field test (from day 6 through day 14, n¼ 10–12 rats in each group). C: Cytokines (IL-1β and TNF-α) were significantly increased at day 6, 10 and 14 in the substantia nigra in the rats injected with the METH (n ¼ 6 rats in each group). n, P o0.05, nn, Po 0.01.

246

W. Jiang et al. / European Journal of Pharmacology 745 (2014) 243–248

Fig. 2. Increased α-synuclein in the substantia nigra in rats injected with METH. (A) ELISA assay demonstrated an increased expression of α-synuclein in the substantia nigra in the rats injected with METH (at day14) when compared with that in the vehicle-injected rats. (B) Increased mRNA level of α-synuclein was also observed in the substantia nigra in the rats injected with METH (at day 14). N ¼7–8 rats in each group. nP o0.05, nnPo 0.01.

transcription (Guy et al., 2011). MeCP2 may also partner with the DNMT1 to form a transcriptional repressor complex, which maintaining the 50 -cytosine methylation in the promoter region of target genes (Dong et al., 2007; Kimura and Shiota, 2003). Then ChIP studies with polyclonal antibody against MeCP2 or DNMT1 were performed to detect the occupancy of MeCP2 and DNMT1 in the Snca promoter region in the substantia nigra in the rats at 14 days after initial injection with METH. The results demonstrated significantly decreased occupancy of MeCP2 (Fig. 4A) and DNMT1 (Fig. 4B) in the Snca, but not Gapdh, promoter region in the substantia nigra of the rats injected with METH, which potentially contributed to the decreased methylation of Snca promoter in the substantia nigra in the modeled rats.

4. Discussion Increasing evidences demonstrate a significantly increased risk of developing PD in the individuals with previous abuse of METH (Callaghan et al., 2012). A large-scale human imaging study showed that previous exposure to METH induced significant brain structural change, including abnormally bright and enlarged substantia nigra, which was a strong risk factor for developing PD later in life (Todd et al., 2013). A number of preclinical evidences also suggested that exposure to METH induced significant injury and functional deficit of dopaminergic neurons in several brain regions in the rodents. For example, repeated administration of high doses of METH produced long-lasting reduction of dopamine uptake and dopamine content in the rat striatum (Wagner et al., 1980). It was ever reported that significant neuronal loss and depletion of striatal dopamine content were observed in the mice treated with METH (Sonsalla et al., 1996). Single high dose of METH induced remarkable neuronal apoptotic death in the striatum (Zhu et al., 2006) and substantia nigra (Ares-Santos et al., 2013). In the present study, we found that exposure to METH induced significant impairments in the rotarod test and open field test and the upregulation of cytokines (IL-1β and TNF-α) in the substantia nigra. These results confirmed the detrimental effect of METH to induce Parkinson's-like behavior in the rodents. α-synuclein is the major component of Lewy bodies in several neurological disorders including PD (Saracchi et al., 2014), while it has the physiological function to regulate synaptic plasticity and neural differentiation. Actually several mutations of the gene (Snca) encoding α-synuclein were observed in the familial cases with early-onset PD (Polymeropoulos et al., 1997). It was also

found that an accumulation of α-synuclein was substantially associated the aggregation of oligomeric toxic compounds and the generation of the degenerative process of PD (El-Agnaf et al., 2006; Goedert and Spillantini, 1998). A number of evidences demonstrated that aggregation of exogenous α-synuclein exhibited potent neurotoxicity to induce remarkable neuroinflammation and the neuronal apoptotic cell death in the brain (Luk et al., 2012). Previous studies reported that multiple injections with METH significantly increased the expression of α-synuclein in the substantial nigra, which was primarily located in the dopaminergic (tyrosine hydroxylase -immunopositive) neurons in the rodents (Fornai et al., 2005; Jung et al., 2010). Knockdown the expression of α-synuclein substantially recovered the cell viability and reduced the production of reactive oxygen species in the cultured dopaminergic-like neuroblastoma SH-SY5Y cells treated with METH (Chen et al., 2013). In the present study we also found a sustained upregulation of α-synuclein in the substantia nigra in the rats exposed to METH. These findings implied the potential role of α-synuclein in the occurrence of Parkinson's like behavior in the rats previously exposed to METH. The present study also revealed a significantly decreased DNA methylation in Snca promoter region in the substantia nigra in the rats previously exposed to METH. While increased methylation of cytosine usually retards the binding of the transcriptional machinery in the promoter region and suppresses the transcription and expression of target genes, series of evidences indicate that decreased cytosine methylation in the promoter region is substantially associated with the facilitated expression of target gene. A significant hypomethylation in the CpG sites in promoter region of Snca was recently reported in the leukocytes (Tan et al., 2014) and postmortem brain samples (Desplats et al., 2011; Matsumoto et al., 2010) in the patients with sporadic PD, while debates remained (Song et al., 2014). Hence, it was postulated that the significantly decreased cytosine methylation in Snca promoter region largely underlay the upregulation of α-synuclein in the substantia nigra in the rats exposed to METH. Notably, we further provided the detail scheme of altered cytosine methylation in the Snca promoter region induced by previously exposed to METH. In principle, Treatment of DNA with bisulfite converts cytosine residues to uracil without any change of 5-methylcytosine residues, thus providing the possibility to illustrate the content of methylation in specific CpG sites with the subsequent sequencing studies. In the present study, significantly decreased content of cytosine methylation was revealed in several CpG sites in a fragment cross the Snca promoter region, which further elucidated the epigenetic upregulation of α-synuclein in the substantia nigra in the rats previously exposed to METH. Cytosine methylation is mediated by DNMTs, which are well characterized and conserved in mammals and plants (Law and Jacobsen, 2010). DNMTs may be classified into twocategories: de novo (DNMT3A and DNMT3B) and maintenance (DNMT1) (Goll and Bestor, 2005). The pattern of methylated cytosine is faithfully maintained during cell divisions through the action of the maintenance DNMT1, which has a preference for hemi-methylated DNA (Wu and Zhang, 2010). It was reported that transcriptional repressor MeCP2 might form a complex with DNMT1 to maintain DNA methylation in the genome, and alteration of the MeCP2 activity modified the function of DNMT1 to maintain the cytosine methylation in the promoter region (Dong et al., 2007; Kimura and Shiota, 2003). Reduction of nuclear Dnmt1 levels, which resulting in DNA hypomethylation in the CpG islands upstream of Snca, was observed in human postmortem brain samples from the patients with PD or dementia with Lewy bodies (Desplats et al., 2011). Inhibition of DNMTs activity by 5-aza-20 -deoxycytidine significantly upregulated the expression of α-synuclein, and induced neuronal apoptosis in the cultured dopaminergic neurons (Wang

W. Jiang et al. / European Journal of Pharmacology 745 (2014) 243–248

247

Fig. 3. Decreased methylated cytosine in the Snca promoter region in the rats injected with METH. (A) The ChIP studies with polyclonal antibody against 50 -methylcytosine revealed a decreased cytosine methylation in the Snca, but not Gapdh, promoter region in the substantia nigra in the rats injected with METH (n ¼7–8 rats in each group). (B) Illustration of methylation in the CpG sites in Snca promoter region in the rats injected with METH (n ¼ 7–8 rats in each group). nP o0.05, nnPo 0.01.

methylation in Snca promoter region and the increased expression of α-synuclein in substantia nigra induced by METH. Collectively, the present study demonstrated that exposure to METH induced significant upregulation of α-synuclein, which resulting from the decreased cytosine methylation in Snca promoter region, in the substantia nigra. The epigenetic upregulation of α-synuclein potentially contributed to the Parkinson's-like behavior in the rodents with previous use of METH.

Fig. 4. Decreased occupancy of MeCP2 (A) and DNMT1 (B) in the Snca, but not Gapdh, promoter region in the substantia nigra in the rats injected with METH. The ChIP studies were performed with the polyclonal antibodies against MeCP2 or DNMT1. N¼ 7–8 rats in each group. nPo 0.05, nnP o0.01.

et al., 2013). The present study demonstrated the significantly decreased occupancy of MeCP2 and DNMT1 in the Snca promoter region, which potentially contributing to the decreased cytosine

References Ares-Santos, S., Granado, N., Espadas, I., Martinez-Murillo, R., Moratalla, R., 2013. Methamphetamine causes degeneration of dopamine cell bodies and terminals of the nigrostriatal pathway evidenced by silver staining. Neuropsychopharmacology 39, 1066–1080. Arndt, D.L., Arnold, J.C., Cain, M.E., 2014. The effects of mGluR2/3 activation on acute and repeated amphetamine-induced locomotor activity in differentially reared male rats. Exp. Clin. Psychopharmacol. 22, 257–265.

248

W. Jiang et al. / European Journal of Pharmacology 745 (2014) 243–248

Bagetta, V., Ghiglieri, V., Sgobio, C., Calabresi, P., Picconi, B., 2010. Synaptic dysfunction in Parkinson's disease. Biochem. Soc. Trans. 38, 493–497. Callaghan, R.C., Cunningham, J.K., Sykes, J., Kish, S.J., 2012. Increased risk of Parkinson's disease in individuals hospitalized with conditions related to the use of methamphetamine or other amphetamine-type drugs. Drug Alcohol Depend. 120, 35–40. Chen, L., Huang, E., Wang, H., Qiu, P., Liu, C., 2013. RNA interference targeting alphasynuclein attenuates methamphetamine-induced neurotoxicity in SH-SY5Y cells. Brain Res. 1521, 59–67. Dauer, W., Przedborski, S., 2003. Parkinson's disease: mechanisms and models. Neuron 39, 889–909. Desplats, P., Spencer, B., Coffee, E., Patel, P., Michael, S., Patrick, C., Adame, A., Rockenstein, E., Masliah, E., 2011. Alpha-synuclein sequesters Dnmt1 from the nucleus: a novel mechanism for epigenetic alterations in Lewy body diseases. J. Biol. Chem. 286, 9031–9037. Dong, E., Guidotti, A., Grayson, D.R., Costa, E., 2007. Histone hyperacetylation induces demethylation of reelin and 67-kDa glutamic acid decarboxylase promoters. Proc. Natl. Acad. Sci. USA 104, 4676–4681. El-Agnaf, O.M., Salem, S.A., Paleologou, K.E., Curran, M.D., Gibson, M.J., Court, J.A., Schlossmacher, M.G., Allsop, D., 2006. Detection of oligomeric forms of alphasynuclein protein in human plasma as a potential biomarker for Parkinson's disease. FASEB J. 20, 419–425. Fornai, F., Lenzi, P., Ferrucci, M., Lazzeri, G., di Poggio, A.B., Natale, G., Busceti, C.L., Biagioni, F., Giusiani, M., Ruggieri, S., Paparelli, A., 2005. Occurrence of neuronal inclusions combined with increased nigral expression of alpha-synuclein within dopaminergic neurons following treatment with amphetamine derivatives in mice. Brain Res. Bull. 65, 405–413. Goedert, M., 2001. Alpha-synuclein and neurodegenerative diseases. Nat. Rev. Neurosci. 2, 492–501. Goedert, M., Spillantini, M.G., 1998. Lewy body diseases and multiple system atrophy as alpha-synucleinopathies. Mol. Psychiatry 3, 462–465. Goll, M.G., Bestor, T.H., 2005. Eukaryotic cytosine methyltransferases. Annu. Rev. Biochem. 74, 481–514. Guy, J., Cheval, H., Selfridge, J., Bird, A., 2011. The role of MeCP2 in the brain. Annu. Rev. Cell Dev. Biol. 27, 631–652. Jung, B.D., Shin, E.J., Nguyen, X.K., Jin, C.H., Bach, J.H., Park, S.J., Nah, S.Y., Wie, M.B., Bing, G., Kim, H.C., 2010. Potentiation of methamphetamine neurotoxicity by intrastriatal lipopolysaccharide administration. Neurochem. Int. 56, 229–244. Kimura, H., Shiota, K., 2003. Methyl-CpG-binding protein, MeCP2, is a target molecule for maintenance DNA methyltransferase, Dnmt1. J. Biol. Chem. 278, 4806–4812. Law, J.A., Jacobsen, S.E., 2010. Establishing, maintaining and modifying DNA methylation patterns in plants and animals. Nat. Rev. Genet. 11, 204–220. Lee, H.J., Bae, E.J., Lee, S.J., 2014. Extracellular alpha-synuclein-a novel and crucial factor in Lewy body diseases. Nat. Rev. Neurol. 10, 92–98. Liu, Y., Dong, Q.Z., Wang, S., Xu, H.T., Miao, Y., Wang, L., Wang, E.H., 2014. Kaiso interacts with p120-catenin to regulate beta-catenin expression at the transcriptional level. PloS One 9, e87537. Luk, K.C., Kehm, V., Carroll, J., Zhang, B., O'Brien, P., Trojanowski, J.Q., Lee, V.M., 2012. Pathological alpha-synuclein transmission initiates Parkinson-like neurodegeneration in nontransgenic mice. Science 338, 949–953. Ma, G.F., Chen, S., Yin, L., Gao, X.D., Yao, W.B., 2013. Exendin-4 ameliorates oxidizedLDL-induced inhibition of macrophage migration in vitro via the NF-kappaB pathway. Acta Pharmacol. Sin. 35, 195–202. Marques, M.R., Stigger, F., Segabinazi, E., Augustin, O.A., Barbosa, S., Piazza, F.V., Achaval, M., Marcuzzo, S., 2014. Beneficial effects of early environmental

enrichment on motor development and spinal cord plasticity in a rat model of cerebral palsy. Behav. Brain Res. 263, 149–157. Matsumoto, L., Takuma, H., Tamaoka, A., Kurisaki, H., Date, H., Tsuji, S., Iwata, A., 2010. CpG demethylation enhances alpha-synuclein expression and affects the pathogenesis of Parkinson's disease. PloS One 5, e15522. Mauceli, G., Busceti, C.I., Pellegrini, A., Soldani, P., Lenzi, P., Paparelli, A., Fornai, F., 2006. Overexpression of alpha-synuclein following methamphetamine: is it good or bad? Ann. N Y Acad. Sci. 1074, 191–197. Norris, E.H., Giasson, B.I., Lee, V.M., 2004. Alpha-synuclein: normal function and role in neurodegenerative diseases. Curr. Top. Dev. Biol. 60, 17–54. Polymeropoulos, M.H., Lavedan, C., Leroy, E., Ide, S.E., Dehejia, A., Dutra, A., Pike, B., Root, H., Rubenstein, J., Boyer, R., Stenroos, E.S., Chandrasekharappa, S., Athanassiadou, A., Papapetropoulos, T., Johnson, W.G., Lazzarini, A.M., Duvoisin, R.C., Di Iorio, G., Golbe, L.I., Nussbaum, R.L., 1997. Mutation in the alphasynuclein gene identified in families with Parkinson's disease. Science 276, 2045–2047. Provencal, N., Suderman, M.J., Caramaschi, D., Wang, D., Hallett, M., Vitaro, F., Tremblay, R.E., Szyf, M., 2013. Differential DNA methylation regions in cytokine and transcription factor genomic loci associate with childhood physical aggression. PloS One 8, e71691. Rizo, J., Sudhof, T.C., 2012. The membrane fusion enigma: SNAREs, Sec1/Munc18 proteins, and their accomplices – guilty as charged? Annu. Rev. Cell Dev. Biol. 28, 279–308. Saracchi, E., Fermi, S., Brighina, L., 2014. Emerging candidate biomarkers for parkinson's disease: a review. Aging Dis. 5, 27–34. Silverstein, P.S., Shah, A., Gupte, R., Liu, X., Piepho, R.W., Kumar, S., Kumar, A., 2011. Methamphetamine toxicity and its implications during HIV-1 infection. J. Neurovirol. 17, 401–415. Song, Y., Ding, H., Yang, J., Lin, Q., Xue, J., Zhang, Y., Chan, P., Cai, Y., 2014. Pyrosequencing analysis of SNCA methylation levels in leukocytes from Parkinson's disease patients. Neurosci. Lett. 569, 85–88. Sonsalla, P.K., Jochnowitz, N.D., Zeevalk, G.D., Oostveen, J.A., Hall, E.D., 1996. Treatment of mice with methamphetamine produces cell loss in the substantia nigra. Brain Res. 738, 172–175. Tan, Y.Y., Wu, L., Zhao, Z.B., Wang, Y., Xiao, Q., Liu, J., Wang, G., Ma, J.F., Chen, S.D., 2014. Methylation of alpha-synuclein and leucine-rich repeat kinase 2 in leukocyte DNA of Parkinson's disease patients. Parkinsonism Relat. Disord. 20, 308–313. Todd, G., Noyes, C., Flavel, S.C., Della Vedova, C.B., Spyropoulos, P., Chatterton, B., Berg, D., White, J.M., 2013. Illicit stimulant use is associated with abnormal substantia nigra morphology in humans. PloS One 8, e56438. Wagner, G.C., Ricaurte, G.A., Seiden, L.S., Schuster, C.R., Miller, R.J., Westley, J., 1980. Long-lasting depletions of striatal dopamine and loss of dopamine uptake sites following repeated administration of methamphetamine. Brain Res. 181, 151–160. Wang, Y., Krishnan, H.R., Ghezzi, A., Yin, J.C., Atkinson, N.S., 2007. Drug-induced epigenetic changes produce drug tolerance. PLoS Biol. 5, e265. Wang, Y., Wang, X., Li, R., Yang, Z.F., Wang, Y.Z., Gong, X.L., Wang, X.M., 2013. A DNA methyltransferase inhibitor, 5-aza-2'-deoxycytidine, exacerbates neurotoxicity and upregulates Parkinson's disease-related genes in dopaminergic neurons. CNS Neurosci. Ther. 19, 183–190. Wu, S.C., Zhang, Y., 2010. Active DNA demethylation: many roads lead to Rome. Nat. Rev. Mol. Cell. Biol. 11, 607–620. Zhu, J.P., Xu, W., Angulo, N., Angulo, J.A., 2006. Methamphetamine-induced striatal apoptosis in the mouse brain: comparison of a binge to an acute bolus drug administration. Neurotoxicology 27, 131–136.