Epitope analysis of a sperm acrosomal antigen defined by HSA-5 monoclonal antibody

E Ls Ev I E R

Journal of Reproductive Immunology 29 (1995) 223-238

Epitope analysis of a sperm acrosomal antigen defined by HSA-5 monoclonal antibody Chi-Yu Gregory Lee*a, Tatsuhiro Yoshiki”, Leo Chuia, Patricia McChesneya, John C. Herrb, Eung-Soo Hwangc, Eng-Shang HuangC aAndrology Laboratory. Department of Obstetrics and Gynaecology, The University of British Cohunbia, 2211 Wesbrook Mall, Vancouver, BC V6T 2B5, Canada bDepartment of Anatomy and Cell Biology, University of Virginia, Charlottesville, VA, USA ‘Lineberger Cancer Center, University of North Carolina, Chapel Hill, NC, USA Received 2 June 1995; revision received 30 August 1995; accepted 7 September 1995

Among the monoclonal antibodies recommended by the WHO Sperm Antigen Workshop for immunocontraceptive vaccine development, HSA-5 showed a high degree of sperm specificity and significantly inhibited in vitro fertilization in both humans and mice. Using a Western blot assay, HSA-5 was found to recognize a sperm antigen designated as HSAg-5 (human) or MSAg-5 (mouse) which ranged in molecular weight from 18 to 100 kDa. This moaocloaal antibody was used as the probe for the immunoscreening of mouse testis cDNA libraries constructed in the lambda gt-1 1 expression vector. One of the positive cDNA clones was shown to have a cDNA insert of approximately 1 kb and to encode a recombinant fusion protein containing 77 amino acid residues in the C-terminal region of MSAg-5. This 1 kb cDNA insert was engineered in a pGEX vector to express a recombinant glutathione Stransferase fusion protein (GST-5). Using an enzyme-linked immuaosorbeat assay (ELISA) and Western blot analysis, both anti-GST-5 sera aad the monoclonal antibody were shown to react with GST-5. The Northern blot of a mouse testis RNA preparation revealed that the isolated cDNA probe hybridized with a 4.0 kb mRNA. Several oligopeptides were synthesized based on the predicted C-terminal hydrophilic regions of the recombinant fusion protein. Using ELBA and a dot blot assay, peptide regions containing the immunogenic epitopes recognized by HSA-5 monoclonal antibody were identified.

* Corresponding author. Tel.: +1 604 822 7023; Fax: +l 604 822 7675. 0165-0378/95/$09.50 0 1995 Elsevier Science Ireland Ltd. All rights reserved SSDI 0165-0378(95)00947-J

224

C. Y.G. Lee et 01. /Journal oj‘ Reproductive Immunology 29 (1995) 223-238

Keywork Spem~ antigen; HSA-5; Monoclonal antibody; cDNA cloning; Immunocontraceptive vaccines

1. Introduction In a previous communication, we reported biochemical and immunological studies of an acrosomal sperm antigen recognized by HSA-5 monoclonal antibody (Yoshiki et al., 1995). This monoclonal antibody was one of several anti-sperm monoclonal antibodies submitted to the second World Health Organization (WHO) Sperm Antigen Workshop for inter-laboratory evaluation (Anderson et al., 1987). Based on the criteria of high sperm specificity and ability to inhibit fertilization (Lee and Yoshiki, in press), this antibody was recommended by the WHO Workshop to be placed on the ‘high priority’ list for immunocontraceptive vaccine development. Following extensive biochemical and immunological characterization, it was found that the cognate antigen recognized by this antibody (designated as HSAg-5 (human) or MSAg-5 (mouse)) was localized mainly to the inner acrosome of human sperm and to the head and/or tail region of mouse sperm. In Western blots using HSA-5 as the primary antibody, HSAg-5 and MSAg-5 in sperm extracts were found to be quite heterogeneous, and to range in molecular size from 18 to 100 kDa (Yoshiki et al., 1995) depending on the conditions used in antigen preparation. To obtain further information regarding the structure and function of this sperm antigen, the cDNA cloning of the mouse sperm antigen gene was recently initiated. From isolated cDNA clones expressing recombinant fusion proteins and from the deduced amino acid sequence, it is possible to identify the antigenic epitope(s) that are specifically recognized by the monoclonal antibody. If the immunogenic epitope(s) of this sperm antigen can be unambiguously determined, it has potential use in synthetic vaccines to induce sufficient immune response in humans or animals to affect fertility (Dean and Miller, 1990; Stevens et al., 1990; O’Hern et al., 1995). We believe that this is an important approach towards the development of sperm antigen-based immunocontraceptive vaccines (Lee et al., 1990). 2. Materials and methods 2.1. Chemicals All the chemicals and reagents required for electrophoresis and immunoassay were obtained from Bio-Rad Laboratories (Richmond, CA). Tissue culture supplies and media as well as reagents or chemicals for molecular

C. Y.G. Lee et al. /Journal of Reproductive Immunology 29 (1995) 223-238

225

biology were obtained from Gibco/BRL (Burlington, ON). Complete and incomplete Freund’s adjuvants, bovine serum albumin (BSA) and p-nitrophenyl phosphate were obtained from Sigma Chemical Co. (St. Louis, MO). 2.2. Animals New Zealand white rabbits and BALB/c mice were obtained from Charles River, Canada (St. Constant, PQ). They were housed in the Animal Care Center of the University of British Columbia in accordance with the guidelines of the Canadian Council of Animal Care. 2.3. Production of antibodies and synthetic peptides The monoclonal antibody, HSA-5, was initially generated against ionophore-induced acrosome-reacted human sperm (designated S71 by the Second WHO Sperm Antigen Workshop) (Anderson et al., 1987). This antibody was shown to be an IgM class antibody and was produced in BALB/c mice as ascites fluid (Yoshiki et al., submitted for publication). The antibody was purified by S-300 gel filtration chromatography and ammonium sulfate precipitation, as described previously (Cormont et al., 1986). Rabbit antisera against a recombinant fusion protein were raised by typical immunization procedures (Liu et al., 1989, 1990). Synthetic peptides consisting of 13 to 17 amino acid residues were prepared by a Millipore 9050 Plus Automated Peptide Synthesizer. The purity of the synthetic peptides was examined by high pressure liquid chromatography. To study binding specificity between the synthetic peptides and the antibodies, an enzyme-linked immunosorbent assay (ELISA) was performed using peptide-coated microwells (Lee et al., 1993). The synthetic peptides were coated to microtiter wells either by drying or by pre-treatment of wells with 0.1% glutaraldehyde prior to the antigen coating. 2.4. Construction and immunoscreening of mouse testis cDNA libraries Poly(A)+RNA was purified from the testes of three-month old BALB/c mice. cDNA libraries were constructed by Dr. Chris Lau of the University of California, San Fransisco with lambda gt-1 1 as the expression vector according to a modified protocol (Wu et al., 1987). HSA-5 monoclonal antibody was used as the probe in an immunoscreening kit (Clonetech Inc., Palo Alto, CA) to identify the corresponding cDNA clones in the lambda gt-1 1 expression vector. Briefly, recombinant lambda bacteriophage was plated in E. coli host, 1090. The expressed hybrid proteins were transferred to nitrocellulose filters and reacted with the primary antibody which in turn was detected by a second biotinylated antibody. Specific antibody binding was subsequently visualized by a calorimetric reaction in the presence of avidin-biotin-conjugated horseradish peroxidase. The identity of the cDNA

226

C. Y.G. Lee et al. /Journal

of Reproductive hmunology 29 (1995) 223-238

clones was verified by digestion with Eco RI restriction enzyme, PCR analysis (Hamaguchi et al., in press) and DNA sequencing (Liu et al., 1992). 2.5. Construction of pGEX expression vector and expression of recombinant jiusion protein

pGEX- 1n, pGEX-2T and pGEX-3x plasmids (Amrad, Victoria, Australia) were used as expression vectors for the production of the fusion protein glutathione S-transferase (GST). The cloned cDNA insert of mouse sperm antigen gene in lambda gt- 11 was excised with Eco RI restriction enzyme and religated to the Eco RI site of pGEX plasmids. The constructed pGEX plasmids were transformed into E. coli BL21. The colonies which grew on Luria Bertani’s (LB) broth agar plates containing ampicillin (50 pg/ml) were selected and grown to the mid-log phase. The cells were then induced with 0.1 mM &isopropylthiogalactopyranoside (IPTG) for 4 h at 37°C. GSTfusion proteins were purified using a glutathione Sepharose affinity column (Pharmacia, Piscataway, NJ) according to the manufacturers’ instructions. 2.6. Western blot analysis The cell extract or the purified proteins were mixed with the sample buffer for sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDSPAGE). Proteins were separated by SDS-PAGE (10% polyacrylamide) under reducing conditions. Following electrophoresis, proteins separated on SDS gel were transferred onto a polyvinylidene difluoride (PVDF) membrane (Millipore, Bedford, MA). Following blocking with 2%-5% skim milk solution, HSA-5 monoclonal antibody and horseradish peroxidase or alkaline phosphatase-conjugated antibody were used as the primary and the secondary antibodies, respectively. Incubation time with each antibody was 1 h at room temperature. The calorimetric enzymatic reaction was initiated by the addition of appropriate substrate solution as previously described (Lee et al., 1993; Towbin et al., 1979). An unrelated IgM monoclonal antibody against hepatitis B surface antigen, HBS-9, was used as the negative control in all Western blot assays. 2.7. Northern blot analysis and DNA sequencing For Northern blot analysis, poly(A)+RNAs from mouse testis were isolated and size-fractionated in 1.2% agarose gel by electrophoresis. The RNAs were transferred to nylon filters and hybridized with [32P]cDNA probes as previously described (Liu et al., 1990). As a negative control, RNA preparation from BeWo cells (human placental origin, ATCC:CCL98) were also used for Northern blot analysis with the same DNA probe. Sequencing analysis of cDNA inserts was performed in a Core facility operated by the Canadian Genetic Diseases Network (Sambrook et al.,

C, Y.G. Lee et al. /Journal of Reproductive Immunology 29 (1995) 223-238

221

1989). The resulting DNA sequences were analyzed for homology with other known nucleotide sequences in the gene data bank, using the PC GENE computer program (Intelligenetics, Mountain View, CA). 3. Results 3.1. Immunoscreening of mouse testis cDNA libraries To isolate mouse cDNA clones that express recombinant fusion proteins recognized by HSA-5 monoclonal antibody, immunoscreening of mouse testis cDNA libraries constructed in the lambda gt-1 1 expression vector were performed. Following extensive screening using HSA-5 as the immunoprobe, six positive cDNA clones were isolated. cDNA inserts of these clones were initially identified by digestion of the isolated recombinant phage DNA with Eco RI restriction enzyme, followed by agarose gel electrophoresis. The size of the cDNA inserts was further verified by PCR analysis using the forward and reverse sequencing primers of lambda gt-1 1 cDNA clones (data not shown). 3.2. Characterization and analysis of isolated cDNA fragments Among the isolated cDNA inserts, clone #5 contained the longest cDNA insert which was approximately 1 kb. Nucleotide sequencing was performed to obtain the sequence of this cDNA insert. Based on the determined nucleotide sequence, the coding regions and the corresponding amino acid residues were deduced. The entire cDNA insert was found to encode a polypeptide of 77 amino acid residues. The remaining 75% of the nucleotide sequence was found to be in the 3 ‘-untranslated region including mRNA degradation and poly(A) signals. A detailed description of the nucleotide sequence and the deduced amino acid sequence is presented in Fig. 1. Using Computer Genebank analysis, the nucleotide sequence determined for the 1 kb cDNA insert was found to have no homology with any known nucleotide sequence documented in the data bank. By hydropathy analysis, the hydrophilic regions of the encoded 77 amino acid residues of MSAg-5 were identified. According to this analysis, two major hydrophilic regions were established (residues 31 to 45 and 46 to 61). These regions are presented diagramatically in Fig. 2. 3.3. Northern blot analysis

A 32P-labeled probe composed of the 1 kb cDNA fragment was prepared by a random priming method (Sambrook et al., 1989) and was used in the Northern blot analysis of a mouse testis mRNA preparation. The results of this analysis clearly demonstrated that the cDNA probe hybridized to an mRNA of approximately 4.0 kb in mouse testis. The results of this study are

228

C. Y.G. Lee et al. /Journal of Reproductive Immunology 29 (1995) 223-238 Hydrophilicity

10

Window

20

Size = 7

30

Scale = Kyte-Doolittle

40

50

60

IO

Fig. 2. Hydrophilicity plot of the deduced partial amino acid sequence (residues 1 to 77) of the mouse sperm antigen gene (MSAg-5).

shown in Fig. 3. As a negative control, RNA preparation from BeWo cells of human placental origin revealed no hybridization signal. No attempts were made to carry out further analysis regarding the tissue specificity of the isolated cDNA probe.

Fig. 3. Northern blot analysis of a mouse testis RNA preparation revealed a 4.0 kb mRNA which hybridized to the 1 kb cDNA probe obtained from a positive cDNA clone #5 immunoscreened with HSAJ monoclonal antibody (left half of the blot). As a negative control, RNA preparation from ReWo cells of human placental origin revealed no hybridization signal on the right half of the blot.

229

C. Y. G. Lee et al. /Journal of Reproductive Immunology 29 (I 995) 223-238 GCAAllCffiCAATTa:CGAA~CCT~lGTACAATAAAG~rJ\TCACAATTATAAAAATGTGGTG~GGGT~CACTA~AAC Glu Phe Aq

Asn Ser Giy lie

Pro PheCys Thr

Se Lys Phe AM

HI6 Asn Tyr

65

Lys Asn Val Val

Leu Gly Phe Thr

lie Asn

ATTATGTACMlCCACCCCAACAAGMGU;CCTGCCCCCCACCATCCTGGC:CCACTGA~CAGAGCCCTGAGACACCAGGG le

Mel Tyr Asn

Pro Ah

Gh Gin Glu Gly Pro Ah

Pro HI6 Hb

Flu

Gly Pro

Leu SW

Gh

SW

Pro Glu

166

Thr

Pm Giy

Glu Gly

Asp

Pro Gin Glq Leu

Ala Giy

Th

Asp Glu Ala Gty

PM

Gin Ala Gin

Ser

55

236

TGGGAGGGTGACCCACAGGGTCTGCCAGGAACAGATGAGCCAajGnCCAGGCACAGAGTTCCCAGGACTAG Trp

26

SW Gin Asp TER

79

C(;C,CCAAAGGCCCCCCCAGGGGGAGMCATU;CCACTGCCCCAGAGACCCCTAAACTGGGGCGGGGTGCACATAGGGCAG

316

AAGCC.GAAGT CCCCATTAA CATGAAGCAA A‘XiGCTAtGCAGCCCCCAAGAATAGCATCTATACAGGCTGGTACCCCAGGTT

396

lCCACACCAAACAGCTCCTGGCAGCTACAAMCATTTA”CAGC~CTTCnCGCAAAGAAAMMMnAAGAGGGTGm

470

GffiCATffiG(;CATAacGGAGGCACCAGATGCCTCAlUUlACTGAU;CTCCCTTGnGGCCTCAGTGCTCCCTATCCCACG

550

1GAAGGTGGGGGCAGTGGGCCCTGCTGAGCCCAATAAGGCTGGGGTGCTGGGAGCTTAGGGCACCAAGGGGGAATAAA’“lAG

636

GGGTWGGGC ACCGGTCCTG CCCCACCTCA GTTCWXXAG

AGTCGGMCT

TGTAGTCGTAGGTGATCTCC

CTCGGAATTC CAGCTaGCG

WACGGCAA CTTTCAGTGCCGCACAGACACGGAATC~G~GTCTKT

TCATCCACGCCGATGGGCTGCTTCGAGTAGATGACAATCT

CCGGTCGCTA CCATTACCAG TTGGTCTGGT

TC

mXTGAGA

72E

809

660

Fig. 1. The nucleotide sequence and the deduced amino acid sequence of the cDNA clone #5 encoding a recombinant fusion protein which was recognized by HSA-5 monoclonal antibody. The predicted corresponding amino acid sequence is listed below that of the nucleotide. The numbering on the right indicates the position of the last nucleotides and amino acids, respectively. A poly(A) addition signal is underlined with the symbol l**. An mRNA consensus degradation sequence is underlined with the symbol **. Antigenic epitope(s) recognized by HSA-5 monoclonal antibody were located between residues 31 and 61 (see text).

3.4. Production and analysis of the glutathione S-transferase recombinant fusion protein The 1 kb cDNA insert from the isolated lambda gt-1 1 phage clone was

engineered in a pGEX expression vector. Positive clones expressing the GST recombinant fusion protein designated as GST-5 were immunoscreened using HSA-5 as the probe. Following the isolation of positive clones, the ex-

C. Y.G. Lee et al. /Journal of Reproductive Immunology 29 (1995) 223-238

230

123456

7

8

9

7

8

910

IO 11

A MW

97.4 69.0 46.0 30.0 21.5 14.3

12

8 MW

345

6

11

97.4 69.0 46.0

--4

-

30:o 21.5 14.3

L’ ’

Fig. 4. Western blot analysis of the purified fusion proteins. Proteins were subjected to analysis by SDS-PAGE (10% acrylamide gel). The separated proteins were transferred onto PVDF membrane. (A) Results of Coomassie brilliant blue staining. (B) Results of Western blot analysis with HSA-5 as the primary antibody. Lane 1, protein molecular markers: lanes 2 and 7, cell lysate transformed with pGEX-2T constructed with partial cDNA insert of MSAg-5 gene; lanes 3 and 8, the sample after adsorption to glutathione S-transferase-linked Sepharose 4B; lanes 4 and 9, washing solution; lanes 5 and 10, the first fraction eluted with reduced glutathione; and lanes 6 and I I, the second fraction eluted with reduced glutathione. The 37 kDa protein band was detected specifically with HSAS as the primary antibody. A negative control using HBS-9 monoclonal antibody revealed no positive binding in the Western blot.

C. Y. G. Lee et al. /Journal of Reproductive Immunology 29 (1995) 223-238

231

pressed GST-5 fusion protein was purified using a Glutathione Sepharose affinity column and results were verified by Western blot assay. Details of this analysis are presented in Fig. 4. By comparison, the molecular weight of GST was shown to be 28 kDa whereas that of the GST-5 fusion protein was approximately 37 kDa. The authenticity of GST-5 clone was also verified independently by partial DNA sequencing to contain the original 1 kb cDNA insert. Rabbit anti-GST-5 sera were found to react with proteins in human and mouse sperm extract which were similar in molecular size to those recognized by HSA-5 monoclonal antibody. As shown by Western blot in Fig. 5, two major protein bands from human sperm with molecular weights of 22 and 100 kDa, respectively, were detected by using either monoclonal or polyclonal antibodies as probes. In the case of mouse sperm extract, a high molecular weight protein band of 90-100 kDa was commonly recognized by HSA-5 monoclonal antibody and by rabbit anti-GST-5 sera. In contrast, antibodies used in the negative control (HBS-@ monoclonal antibody and preimmune rabbit serum) showed no positive binding in the Western blot. Using ELISA, it was further demonstrated that both HSA-5 monoclonal antibody and rabbit anti-GST-5 sera reacted specifically with the GST-5

kDa

1

2

Fig. 5. Western blot assay to demonstrate that rabbit anti-GST-5 sera and HSA5 monoclonal antibody reacted with the same protein bands in human sperm extract. In lane 1 two protein bands with molecular weights of 22 and 100 kDa, respectively, were detected by the HSA-5 monoclonal antibody. In lane 2, two protein bands of similar molecular size were also detected in human sperm extract when rabbit anti-GST-5 was used as the primary antibodies. A negnative control using HBS-9 monoclonal antibody and rabbit preimmune serum revealed no positive binding of the sperm extract by Western blot (data not shown).

232

C. Y.G. Lee et

al.

/Journal

of

Reproductive

Immunology

29

( 1995)

223-238

fusion protein coated on microwells, in a dose-dependent manner. The results of this analysis are presented in Fig. 6. Similarly to Western blot assay, the negative control using HBS-9 monoclonal antibody and preimmune rabbit serum showed no positive binding by ELISA. 3.5, Identification of the immunogenic epitope specljic to the HSA-5 monoclonal antibody and the rabbit anti-GST-5 fusion protein

From a hydropathy analysis of the recombinant fusion protein expressed by the lambda gt-1 1 cDNA clone with the 1 kb cDNA insert, a hydrophilic peptide region corresponding to the amino acid residues 31 to 61 was identified. Three distinct and overlapping synthetic peptides were prepared in an attempt to identify immunogenic epitopes specifically recognized by the monoclonal or polyclonal antibodies. These peptides were designated P3 145

2.0”

s

1.6-

In 0 -3

8

1.2-

I=c z Lo

0.8

-

2

0.4.

e 200

400

DILUTION

m 800

FACTOR(Loq

m 1600

m 3200

scale)

Fig. 6. Enzyme-linked immunosorbent assay (ELISA) to demonstrate specific binding between rabbit anti-GST-5 sera and GST-5 fusion protein coated onto microwells (0) or between HSA-5 monoclonal antibody and coated GST-5 (0); Cl and m are the corresponding negative controls, using rabbit pre-immune sera and unrelated HBS-9 monoclonal antibody as primary antibodies, respectively. Absorbance at 405 nm (with p-nitrophenyl phosphate as the substrate) was plotted against different dilutions of the relevant antibodies (initial concentration of primary antibodies is about I mg/ml).

233

C. Y.G. Lee et al. /Journal of Reproductive Immunology 29 (1995) 223-238

(amino acid residues 3 1 to 45), P4561 (residues 45 to 61) and P3849 (residues 38 to 49). These peptides were coated individually onto microwells, and ELlSAs were performed to determine binding specificity or affinity with HSA-5 monoclonal antibody or rabbit anti-GST-5. The results of the analyses by ELISA are presented graphically in Figs. 7 and 8. In summary, HSA-5 monoclonal antibody showed significantly higher binding to P4561 when compared with that to the other two peptides. Conversely, rabbit antisera raised against the recombinant GST fusion protein, anti-GST-5, revealed good binding to P3145, but no significant binding to either P3849 or P4561. The immunospecificity of the binding between HSA-5 monoclonal antibody and the P3145 peptide was also demonstrated by a dot blot assay performed with the synthetic peptide immobilized on the PVDF membrane (data not shown).

0’

200

400

DILUTION

800

3200

1600

FACTOR(Log

6400

scale)

Fig. 7. ELISA using microwells coated with P3145 synthetic peptide to demonstrate specific binding between the well-bound peptide and rabbit anti-GST-S sera (A) or between HSA-5 monoclonal antibody and the peptide (A). 0 and 0 are the corresponding negative controls, using rabbit pre-immune sera and unrelated IgM monoclonal antibody, respectively, as the primary antibodies.

234

C. Y.G. Lee et al. /Journal oj’ Reproductive Immunology 29 (1995) 223-238

(1 I LIITIOPI

FACTO,1

, I.“y

+ca!

e)

~IIUTIO?

F.4CTC9

cm3

*ca:e,

Fig. 8. ELISA using microwells coated with P4561 and P3849 synthetic peptides, respectively, to demonstrate specific binding between the bound peptides and relevant monoclonal/polyclonal antibodies. (A) 0 is the binding between the well-bound P456l and HSA-5, whereas 0 is the corresponding negative control using unrelated IgM class monoclonal antibodies. 0 and A represent the corresponding binding of rabbit anti-GST-5 and pre-immune sera, respectively, to the wells coated with P4561 peptide. (B) 0 and 0 represent binding of HSA-5 and unrelated monoclonal antibody to the wells coated with P3849, respectively. 8and 0 represent the corresponding binding of rabbit anti-GST-5 and preimmune rabbit sera to the wells coated with P3849.

4. Discussion

Among the anti-human sperm monoclonal antibodies submitted by our research laboratory, HSA-5 monoclonal antibody (S71 by WHO) was recommended by the WHO Sperm Antigen Workshop on the high priority list for sperm antigen-based immunocontraceptive vaccine development (Anderson et al., 1987). Therefore, biochemical and immunological characterizations of this monoclonal antibody and its cognate mouse/human sperm antigen were undertaken in our laboratory (Yoshiki et al., 1995). Attempts were made to isolate cDNA clones expressing recombinant fusion proteins which could be recognized by HSA-5 monoclonal antibody and reported in this communi, cation. Consistent with the molecular size of the affinity purified sperm antigen, HSAg-5 (I 100 kDa), mRNA of this sperm antigen from mouse testis was found to be about 4 kb. From the isolated cDNA fragment (1 kb) and the deduced amino acid sequence in the coding region, it is possible to identify immunogenic epitope which is recognized specifically by HSA-5 monoclonal antibody. The corresponding oligopeptide(s) can then be synthesized, mass-produced and used as contraceptive vaccines (O’Hern et al., 1995).

C. Y.G. Lee et al. /Journal of Reproductive immunology 29 (1995) 223-238

235

Several sperm antigen genes have been cloned, initially using monoclonal or polyclonal antibodies against sperm antigens as the immunoprobes for antigen characterization, purification and cDNA clonings. Among these are MSA-63 from mouse (Liu et al., 1992), SP-10 from human (Herr et al., 1990), SP-17 from rabbit (Richardson et al., 1994) and pH-20 and pH-30 from guinea pig (Myles and Primakoff, 1984). MSA-63 is an intra-acrosomal sperm specific antigen of 27.9 kDa from mouse (Liu et al., 1992), initially identified by an anti-human sperm monoclonal antibody, HS-63 (Liu et al., 1989). The amino acid sequence of this protein was deduced from an isolated full length cDNA insert of 1.2 kb (Liu et al., 1992). Sp-10 is also an intraacrosomal antigen from human sperm (Herr et al., 1990). The cDNA clones expressing this sperm protein were isolated initially from the immunoscreening of human testis cDNA library by using an anti-human sperm monoclonal antibody, MHS-10 (Herr et al., 1990). In view of the high degree of sequence homology, it was later found that MSA-63 is a mouse homolog of human SP10 protein (Liu et al., 1992). SP-17 is a mammalian testis and sperm specific protein which has been isolated, sequenced and characterized from rabbit and mouse spermatozoa (Richardson et al., 1994). SP-17 is a member of the RSA family (17 kDa) of sperm specific autoantigen which bind rabbit zona pellucida as well as sulfated carbohydrates (O’Rand et al., 1988). PH-20 and PH-30 are two distinct glycoproteins localized on the post-acrosome identified by specific monoclonal antibodies (Myles and Primakoff, 1984). The cDNA clones for PH-20 and PH-30 genes have been isolated and structurally determined at nucleotide/amino acid levels (Lathrop et al., 1990; Blobel et al., 1992). The potential application of these sperm antigens for immunocontraceptive developments is being actively pursued. The sperm antigen recognized by HSA-5 monoclonal antibody in this study could be another potential candiate for immunocontraceptive vaccine development. Therefore, the main objective of this study is to demonstrate that the synthetic peptides or fusion proteins derived from the isolated cDNA clones are immunologically recognized by HSA-5 monoclonal antibody which was utilized as the immunoprobe for cDNA clonings. From the preliminary molecular cloning study presented in this communication, it was concluded that most of the positive cDNA clones contain partial length cDNA inserts in the 3 ‘-untranslated regions. Since the recombinant fusion proteins expressed by these cDNA clones were recognized by HSA-5 monoclonal antibody, it became apparent that the immunogenic epitopes recognized by this monoclonal antibody were localized to the Cterminal region of this sperm protein. Therefore, in this study one of the longest cDNA inserts was sequenced and 77 amino acid residues in the open reading frame (protein coding region) were deduced. A recombinant fusion protein, GST-5 containing 77 amino acid residues in the coding region of the

236

C. Y.G. Lee et al. /Journal of Reproductive Immunology 29 (1995) 223-238

clone #5 cDNA insert was also expressed in a pGEX vector and massproduced in E. coli for rabbit antibody production. By Western blot assay, it was also clearly demonstrated that both HSA-5 and rabbit anti-GST-5 recognized identical sperm protein bands from both human or mouse sperm extract (Fig. 6). Through detailed hydropathy analysis of this recombinant fusion protein, we have been able to identify a peptide, rich in proline amino acid residues from 31 to 61 in the hydrophilic region, as the possible antigenic site(s) recognized specifically by HSA-5 monoclonal antibody. As shown in Figs. 7 and 8 by ELISA, this monoclonal antibody showed significant binding to three synthetic peptides designated as P3 145, P3849 and P4561, respectively. Only P3145, however, was recognized specifically by rabbit anti-GST-5 under the same assay conditions. This observation may suggest that HSA-5 recognizes different antigenic epitope(s) from those recognized by rabbit anti-GST-5. This interesting observation may explain why rabbit anti-GST5, in contrast to HSA-5 monoclonal antibody, failed to react with either mouse or human sperm when examined by indirect immunofluorescent assay (data not shown). More recently, we were able to show that p4561 peptide could inhibit HSA-5 binding to human sperm by indirect immunofluorescent assay (unpublished observation). The results of this analysis suggest that amino acid residues containing the sequence Pro-X-Pro or Pro-X-X-Pro might be involved in the binding of this protein to HSA-5 monoclonal antibody. On the contrary, rabbit anti-GST-5 appears to recognize a relatively restricted epitope localized within the amino acid residues of P3145. Nevertheless, both monoclonal HSA-5 and rabbit anti-GST-5 were shown to react with identical sperm proteins from both mouse and human sperm extract, using the Western blot method. The failure of rabbit anti-GST-5 to recognize the native antigen on sperm could reflect intrinsic structural differences between the native and denatured states of this sperm protein. Since all the available experimental evidence presented in this study is indirect, we still cannot rule out the possibility that the isolated cDNA clones express another sperm protein which cross-reacts with HSA-5 monoclonal antibody due to some sequence homology. In order to elucidate the structure and function of this novel sperm antigen, we are currently in the process of isolating a full length cDNA and completing the entire nucleotide sequence. Additional information should unfold as the primary structure of this new sperm antigen is elucidated. Acknowledgments

This work was supported in part by the Canadian Genetic Diseases Network (Network of Center of Excellence #5-90490).

C. Y.G. Lee et al. /Journal of Reproductive Immunology 29 (1995) 223-238

231

References Anderson, D.J., Johnson, P.M., Alexander, N.J., Jones, W.R. and Griffin, D. ( 1987) Monoclonal antibodies to human trophoblast and sperm antigens: report of two WHO-sponsored workshops. J. Reprod. Immunol. 10, 231. Blobel, C.P., Wolfsberg, T.G., Turek, C.W., Myles, D.G., Primakoff, P. and Whites, J.M. (1992) A potential fusion peptide and an integrin ligand domain in a protein active in sperm-egg fusion. Nature 356, 248. Cormont, F., Manouvriez, P., Clerq, L.D. and Bazin, H. (1986) The use of rat monoclonal antibodies to characterize, quantify and purify polyclonal or monoclonal mouse IgM. Methods Enzymol. 121, 621. Dean, J. and Miller, S.E. (1990) Zona Pellucida: Target for a contraceptive vaccine. In: Gamete Interaction: Prospects for Immunocontraception (Alexander, N.J., Griffin, D., Spieler, J.M. and Waites, G.M., eds.), p. 313. Wiley-L&. New York. Hamaguchi, A., Tooyama, I., Voshiki, T. and Kimura, H. (in press) Determination of libroblast growth factor receptor-I in human prostate as revealed by polymerase chain reaction and immunhistochemistry. Prostate. Herr, J.C., Wright, R.M., John, E., Klotz, K., Homyk, M., Foster, J. and Flickinger, J. (1990) Monoclonal antibody MHS-10 and its cognate intra-acrosomal antigen SP-10. In: Gamete Ineration: Prospects for Immunocontraception (Alexander, N.J., Griffin, D., Spieler, J.M. and Waites, G.M.H., eds.), p. 13. Wiley-Liss, New York. Laemmli, U.K. (1970) Cleavage of structural proteins during the assembly of the head of hacteriophage T4. Nature 227, 680. Lathrop, W.F., Carmichael, E.P., Myles, D.G. and Primakoff, P. (1990) cDNA clonings of PH-20 protein from guinea pig. J. Cell Biol. 3, 2939. Lee, C.Y.G., Chow, S., Yang, Y.Y., Hsiao, L., Chao, H.T., Ng, H.T., Wong, E, Sun, A. and Hsu, E. (1993) Studies of a sperm/placenta cross-reacting antigen, STX-10. J. Reprod. Immunol. 25, 249. Lee, C.Y .G., Liu, M.S., Su, M.W. and Zhu, J.B. (1990) Studies of sperm antigens reactive to HS-I I and HS-63 monoclonal antibodies. In: Gamete Interaction (Alexander, N.J., Griffin, D., Spieler, J.M, and Waites, G.M.H., eds.), p. 37. Wiley-Liss, New York. Lee, C.Y.G. and Yoshiki, T. (1995) Molecular biology of sperm antigen and immunocontraception. J. Genet. Mol. Biol. (in press). Liu, M.S., Chan, K., Lan, Y.F. and Lee, C.Y.G. (1990) Molecular cloning of an acrosomal sperm antigen gene and the production of its recombinant protein for immunocontraceptive vaccine. Mol. Reprod. Dev. 25, 302. Liu, M.S., Aebersold, R., Fann, C.H. and Lee, C.Y.G. (1992) Molecular and developmental studies of a sperm acrosome antigen recognized by HS-63 monoclonal antibody. Biol. Reprod. 46, 937. Liu, M.S., Yang, Y., Pan, J., Liu, H.W., Menge, A.C. and Lee, C.Y.G. (1989) Purification of acrosomal antigen recognized by a monoclonal antibody and antifertility effects of isoimmune sera. Int. J. Androl., 12, 451. Myles, D.G. and Primakoff, P. (1984) Localized surface antigens of guinea pig sperm migrate to new regions prior to fertilization. J. Cell. Biol. 99, 1634. O’Hern, P.A., Bambra, C.S., Isahakia, M. and Goldberg, E. (1995) Reversible contraception in female baboons with a synthetic epitope of sperm-specific lactate dehydrogenase. Biol. Reprod. 52, 331. O’Rand, M.G., Widgran, E.E. and Fisher, S.J. (1988) Characterization of rabbit sperm membrane autoantigen, RSA as an lectin-like zone binding proteins. Dev. Biol. 129, 231.

238

C. Y.G. Lee et al. /Journal of Reproductive hnunology

29 (1995) 223-238

Richardson, R.T., Yamasaki, N. and O’Rand, M.G. (1994) Sequence of a rabbit sperm zona pellucida binding protein and localization during the acrosome reaction. Dev. Biol. 165, 688. Sambrook, J., Fritsch, E.F. and Maniatis, T. (1989) In: Molecular Cloning, A Laboratory Manual (2nd Edn.), p. 10. Cold Spring Harbor Laboratory Press, New York. Stevens, V.C., Powell, J.E., Rickey, M., Lee, A.C. and Lewis, D.H. (1990) Studies of various delivery systems for a human chorionic gonadotropin vaccine. In: Gamete Interaction (Alexander, N.J., Griffin, D., Spieler, J.M. and Waites, G.M.H., eds.). p. 549. Wiley-Liss, New York. Towbin, H., Staehelin, T.T. and Cordon, J. (1979) Eelctrophoretic transfer of proteins from polyacrylamide gels to nitrocellulose sheets: procedures and some applications. Proc. Nat). Acad. Sci. USA 76, 4350. Wu, K.C., Chan, K., Lee, C.Y.G. and Lau, Y.F. (1987) Molecular isolation and sequence determination of the cDNA for mouse sperm specific lactate dehydrogenase-X gene. Biochem. Biophys. Res. Commun. 146, 964. Yoshiki, T., Herr, J.C. and Lee, C.Y.G. (1995) Purification and characterization of a sperm antigen recognized by HSA-5 monoclonal antibody. J. Reprod. Immunol. 209-222.