Establishing a cell line from Atlantic cod as a novel tool for in vitro studies

Fish & Shellfish Immunology 34 (2013) 199e208

Contents lists available at SciVerse ScienceDirect

Fish & Shellfish Immunology journal homepage: www.elsevier.com/locate/fsi

Establishing a cell line from Atlantic cod as a novel tool for in vitro studies I. Jensen*, K. Steiro, A.-I. Sommer, S. Mennen, A. Johansen, E.K. Sandaker, M. Seppola** Nofima, Box 6122, N-9291 Tromsø, Norway

a r t i c l e i n f o

a b s t r a c t

Article history: Received 28 August 2012 Received in revised form 12 October 2012 Accepted 14 October 2012 Available online 26 October 2012

The present work describes the generation of a cell line from newly hatched Atlantic cod (Gadus morhua) larvae (ACL cells). Primary cultures were initiated by explant outgrowth from partially minced tissues and subcultured cells were exposed to UV radiation. After a substantial period of growth lag, cells started to proliferate and different growth conditions were tested to establish the cell line. At present, the ACL cell line has been subcultured for more than 100 passages. ACL cells had a polygonal shape and the morphology appeared homogenous with epithelial-like cells. Cell growth was dependent on the presence of foetal bovine serum and cells proliferated in a wide temperature range with optimal growth at 15
C. By exposure to a viral dsRNA mimic (poly I:C) the cells expressed high levels of a repertoire of genes comprising both inflammatory mediators and interferon stimulated genes. Infection studies with two different viruses showed that infectious pancreatic necrosis virus (IPNV) propagated efficiently, and induced low level expression of genes of both pathways before the cells rapidly died. No productive infection was obtained with nervous necrosis virus (NNV), but a transient increase in the viral RNA level, followed by a high increase in expression of selected ISGs, suggests that the virus enters the cells but is unable to complete its replication cycle. To our knowledge, ACL cells are at the moment the only existing cell line from Atlantic cod. Our results demonstrate that ACL cells can be a useful research tool for further exploration of hostepathogen interactions and it is believed that this cell line will serve as a valuable tool also for studies within other research areas. Ó 2012 Elsevier Ltd. All rights reserved.

Keywords: Atlantic cod Cell line Immune genes Infectious pancreatic necrosis virus Nervous necrosis virus

1. Introduction Several initiatives have been made to develop Atlantic cod (Gadus morhua) as an aquaculture species [1], but this industry has faced many challenges impeding expansion into large scale. Both viral and bacterial pathogens have caused diseases and economical losses [2e5], problems that are expected to increase with future growth of cod aquaculture. Efficient disease prophylaxis in aquaculture requires, amongst other things, development of species-specific biological research tools such as cell lines. To our knowledge no cell lines from cod are currently available [6], although one was reported previously [7], this cell line has not been

Abbreviations: ACL, Atlantic cod larvae; IPNV, infectious pancreatic necrosis virus; NNV, nervous necrosis virus; VNN, viral nervous necrosis; IL, interleukin; IFN, interferon; ISG, interferon stimulated gene; poly I:C, polyinosinic polycytidylic acid; pi., post infection; moi., multiplicity of infection. * Corresponding author. Present address: Norwegian College of Fisheries Science, University of Tromsø, N-9037 Tromsø, Norway. Tel.: þ47 77 64 68 64; fax: þ47 77 64 60 20. ** Corresponding author. Tel.: þ47 77 62 90 00; fax: þ47 77 62 91 00. E-mail addresses: [email protected] (I. Jensen), marit.seppola@nofima.no (M. Seppola). 1050-4648/$ e see front matter Ó 2012 Elsevier Ltd. All rights reserved. http://dx.doi.org/10.1016/j.fsi.2012.10.022

preserved (Pers.comm. Christensen K.). Cell lines offer the possibility of performing experiments in a controlled environment, independent of the complexity and variability of experiments in vivo. For studies of hostepathogen interactions fish cell lines have become increasingly important, contributing to elucidation of constituents of innate immunity and of bacterial and viral virulence mechanism [8]. The innate immune system provides the first line of protection against infection where both inflammatory and interferon stimulated genes (ISGs) are essential components. In cod, innate immunity has been characterised mainly at the gene level and our previous results indicate a pro-inflammatory role for the interleukins IL-1b, IL-8 and IL-6, while IL-10 seems to have an antiinflammatory function [9,10]. Cod ISGs, such as ISG15 and LGP2, have been proposed to have a role in antiviral defence by its inducible nature to the dsRNA mimic, poly I:C and by viral infection [11e13]. The pleiotropic cytokine IL-12 has important functions in differentiation of T cells in mammals, providing an important link between innate and adaptive immunity. In fish its function is less well known, although gene expression analyses have shown that the IL-12 sub-unit, p40, is expressed and inducible in cod, as well as in other fish species [9,14]. Recently, sequencing of the cod genome

200

I. Jensen et al. / Fish & Shellfish Immunology 34 (2013) 199e208

showed that the cod immune system has a unique organisation, with the apparent absence of major histocompatibility complex (MHC) II, as well as other important immune genes [15]. The functional implications of this related to disease prophylaxis and vaccine development is however not known. Both nervous necrosis virus (NNV) and infectious pancreatic necrosis virus (IPNV) are viral pathogens of relevance to cod. NNV, a ssRNA virus and member of the Nodaviridae family, causes the disease viral nervous necrosis (VNN) in a wide range of fish species, and outbreaks have also been reported in farmed cod [2,3,16,17]. IPNV is a dsRNA virus and aquatic member of the Birnaviridae. It causes widespread disease in salmonids and also in marine fish such as Atlantic halibut (Hippoglossus hippoglossus) [18,19], while in adult cod IPNV causes a persistent infection [11,20e23]. One IPN disease outbreak has however been reported in cod fry [24]. Both viruses are inhibited by the antiviral effects of the type I interferon (IFN) system [25e27] and accordingly, have mechanisms to antagonise host immune defence [28,29]. These studies have been performed using cell lines from salmonid and warmwater fish species. For IPNV and NNV isolates representing a threat to cod, it would be more relevant to use cell lines originating from coldwater marine fish in studies of hostepathogen interactions. This work describes the establishment of a cell line with epithelial-like morphology developed from Atlantic cod larvae (ACL cells). To develop the cell line different growth conditions were tested for effect on cell proliferation and now the cells have been subcultured for more than 100 passages. The applicability of ACL cells for studies of innate immunity and hostepathogen interactions was evaluated. This was done by exposing the cells to poly I:C, IPNV and NNV and analysing for susceptibility to viral infection and expression of genes comprising cod innate immunity. 2. Materials and methods 2.1. Reagents Minimum Essential Medium (MEM) and Leibovitz (L)-15 were obtained from both Invitrogen and PAA Laboratories. Foetal bovine serum (FBS) was obtained from several suppliers (Bio Whittacker, PAA Laboratories, BioCrome and HyClone). Media supplements; Lglutamine, penicillin, streptomycin and non-essential amino acids (NEAA) were from PAA Laboratories, while gentamicin was from Sigma Aldrich. Antibiotics were used at the following concentrations when other information is not given; penicillin (pen) 100 U/ ml, streptomycin (strep) 100 mg/ml and gentamicin 10 mg/ml. Inosine and adenosine triphosphate (ATP) were obtained from Sigma Aldrich, and basic fibroblast growth factor (bFGF) from Invitrogen. Polyinosinic polycytidylic acid (poly I:C) was from GE Healthcare. Primaria cell culture flasks were obtained from BD Biosciences, while all other cell culture plastic was from Nunc. All reagents for RNA isolation, cDNA synthesis and real time PCR were obtained from Applied Biosystems. 2.2. Establishment of tissue explants for outgrowth of cells Fertilised cod eggs were collected from Tromsø Aquaculture Research Station at 72e82 degree-days. The eggs were surface disinfected under dim light in a solution of 0.3% glutaraldehyde in sterile sea water for 10 min, followed by extensive rinsing in sterile sea water with 50 mg/ml gentamicin. The eggs were further incubated at 12
C in sterile sea water with gentamicin with aeration. One litre of sterile sea water with pen/strep was added the next day and the eggs were incubated until hatching. Cod larvae were collected 0e4 days post hatching, sedated with 0.005% benzocain in L-15 medium (380 mOsm) and rinsed in L-15 supplemented with

gentamicin. The larvae were aseptically cut in small pieces and placed in 25 cm2 Primaria cell culture flasks in 1 ml of MEM (380 mOsm) with pen/strep and gentamicin and incubated in 3% CO2 at 5, 10 and 12
C. Within 48 h, 5 ml of MEM (380 mOsm) with 1% NEAA, 200 mM L-glutamine, 20% FBS (Bio Whittacker) and 2 ng/ ml bFGF was carefully added. After a period of 2 months with incubation at the three mentioned temperatures the tissue explants were only incubated at 10
C. 2.3. Development of the cell line Outgrown cells were transferred from the primary explant cultures by conventional subcultivation methods to 25 cm2 Primaria culture flasks. Culture conditions were MEM with 20% FBS (Bio Whittacker), 1% NEAA, 200 mM L-glutamine and pen/strep in 3% CO2 at 10
C. After two days, cells were subjected to UV radiation using a UV-transilluminator (Hoefer, wavelength 300 nm) for 15 and 30 s. UV-exposed cells were given a mixture of 50% MEM supplemented as described above and 50% conditioned media from the tissue explants every week for 5 months. Confluent cells were removed by trypsination and transferred to a new culture flask and incubated as described above. At this stage the cells were subcultured with a split ratio of 1:2 every 2e3 weeks. The culture medium was changed every week and always the day before subculturing. From passage 6 several approaches were made to maintain cell survival and proliferation. Parallel cultures were incubated at 10, 12 and 13.5
C and different supplements were added to the culture medium; 10 mg/ml cod embryo extract, 2 ng/ml bFGF, 10 mg/ml inosine and 1 mM ATP. The cod embryo extract was prepared by homogenisation of thawed fertilised cod eggs. The homogenate was cleared by centrifugation, sterile filtered and stored in aliquots at 80
C. Protein concentration was measured to 50 mg/ml (OD280). Simultaneously, from passage 6, different bovine sera concentrations, types and batches from several suppliers were tested for effect on cell proliferation. From passage 15 and onwards, the cells were gradually adapted to being cultured in MEM without adjusted osmolarity and conditioned medium. From passage 20, cells were split at a ratio of 1:3 and adapted to different temperatures (12, 15 and 20
C). After this, the cells could routinely be subcultured at a split ratio of 1:4 every 1e2 weeks. The optimal culture conditions were MEM (Osm. 320) supplemented with pen/strep, 1% NEAA, 200 mM L-glutamine and 10% FBS Gold (PAA Laboratories) in 4% CO2 at 15
C. The cell line has been given the name Atlantic cod larvae cells (ACL cells). 2.4. Microscopy ACL cells were visually inspected and photographed using NIKON Eclipse TE 2000-S or Zeiss AxioVert 200 M. For transmission electron microscopy, cells were seeded in SlideFlask (Nunc) and incubated for 16 h followed by rinsing in MEM and fixation in 2% glutaraldehyde in 0.1 M calcodylate buffer (pH 7.4) overnight. Cells were subsequently processed for transmission electron microscopy as described previously for cod macrophages [9]. Micrographs were taken using a Jeol 1010 JSM with a Morada 11 Mpixels digital camera (Olympus). 2.5. Cryo preservation ACL cells were cryopreserved at different passage levels. This was achieved by resuspending cells in 10% dimethyl sulfoxide (DMSO) in MEM with 15% FBS and subsequent freezing in liquid nitrogen.

I. Jensen et al. / Fish & Shellfish Immunology 34 (2013) 199e208

2.6. Cell proliferation assay For measurement of cell proliferation the CyQUANT cell proliferation kit (Invitrogen) was used. The method determines cell density based on fluorescent measurement of DNA content. Initially, a sample of ACL cells with known cell quantity was generated based on haemocytometer counting. A dilution series of this sample was analysed in every experiment. This was to generate a standard curve, to convert fluorescence values to cell numbers, and to evaluate the reproducibility of the method. To determine cell proliferation at different temperatures ACL cells were seeded at 3  103 cells per well in 96 well plates in MEM with 10% FBS. Cells were incubated at 15
C overnight for cell attachment, and subsequently transferred to 5, 12, 15, 20 and 25
C. Four parallels of each sample were assayed at each temperature. Cells were harvested after 5, 10, 15 and 20 days by removing the culture medium and freezing the cells at 80
. For fluorescent measurement of cell numbers, cells were thawed and transferred to Optilux 96 well plates (BD Biosciences) and processed according to the instructions provided by the supplier. The fluorescence of each sample was measured in a fluorescence microplate reader (SpectraMax Gemini EM, Molecular Devices) with 480 nm excitation and 520 nm emission filters. Assaying cell proliferation with different serum concentrations was performed similarly. The day after seeding of cells, the culture medium was removed and cells were washed once in MEM without serum. MEM with 0, 2, 5, 10 and 15% serum was subsequently added. Further incubation was at 15
C and cells were harvested 1, 3, 7, 11 and 15 days later. Fluorescence measurements of cell numbers were performed as described above. 2.7. Poly I:C stimulation An initial experiment was performed to determine the optimal poly I:C concentration for stimulation. Cells were seeded 1.5  105 cells per well in 24-well cell culture plates. Two days later (90% confluency) cells were stimulated with 0.1, 1 or 10 mg/ml poly I:C in MEM with 2% FBS and incubated at 15
C. Unstimulated cells received only cell culture medium with 2% FBS. Cells were harvested after 24 h for RNA isolation in 1 Nucleic Acid Purification Lysis buffer. Parallel cultures were observed by microscopy to monitor possible toxic effects for 72 h. In subsequent experiments ACL cells were seeded as described above, incubated at 20
C and stimulated with 10 mg/ml poly I:C. Cells were harvested for RNA isolation 3, 6, 12, 24, 48, 72 and 96 h post stimulation. In all experiments three parallel samples were harvested at each time point. 2.8. Interferon containing supernatant (ICS) The ability of ACL cells to produce interferon-like activity was studied by pulse stimulating ACL cells with poly I:C. ACL cells were stimulated, as described above, for 7 h with 10 mg/ml poly I:C followed by thoroughly rinsing and subsequent feeding with MEM without FBS. Control cells were treated similarly without receiving poly I:C. After 24 h incubation at 20
C culture media were collected, aliquoted and stored at 80
C. Medium from the cells given poly I:C was named interferon containing supernatant (ICS) while the control supernatant was named ICS-Ctr. ICS and ICS-Ctr were diluted 1/15 and used to stimulate ACL cells as described above. After 12 h RNA was harvested by adding 1 Nucleic Acid Purification Lysis buffer. 2.9. Viral infections IPNV and NNV were used for infection experiments with ACL cells. The viral strains used were originally isolated from Atlantic

201

halibut with IPN or VNN, and were re-isolated from experimentally infected cod [30,31]. The Chinook salmon embryo, CHSE-214 cell line [32] and the E11 cell line, a clone derived from the striped snakehead cell line (SNN-1) [33] were used for propagation and titration of IPNV and NNV, respectively. This has been described previously [11,31]. For IPNV infection, ACL cells and CHSE-214 cells were seeded in 25 cm2 culture flasks and infected with IPNV at a multiplicity of infection (moi.) of 0.1 in serum free MEM. After absorption of virus for 3 h at 15
C the virus was removed, the cells were washed once and MEM with 2% FBS was added. For both cell lines, half of the cell culture flasks were subsequently incubated at 15 and 20
C. Development of cytopathogenic effect (CPE) was followed closely and cells were harvested 1 and 3 days post infection (pi.) by freezing at 80
C. Virus yield was obtained by titration of the harvested cell suspensions with eight wells per dilution on CHSE-214 cells. 50% tissue culture infective dose (TCID50) was calculated [34]. A similar infection experiment was performed with NNV; however, CHSE-214 cells were not included. ACL cells were infected with NNV moi. 1 or 0.1 using the same procedure as described above for IPNV. The cells were incubated for 21 days at 15
C and RNA was harvested 0, 7, 14 and 21 days pi. in 1 Nucleic Acid Purification Lysis buffer. To analyse virus induced gene expression, ACL cells were seeded in 24 well culture plates and infected with moi. 0.01 of IPNV or moi. 1 of NNV using a similar procedure as described above. Cells were incubated at 20
C and harvested in 1 Nucleic Acid Purification Lysis buffer at sequential time points (12, 24, 48, 72, 96, 120, 144 and 168 h) for gene expression analysis. For titration of NNV, cells were harvested by freezing at 80
C and titrated on E11 cells by subsequent calculation of TCID50. 2.10. Gene expression analysis Cells were harvested in 1 Nucleic Acid Purification Lysis buffer as described above. RNA was purified using an ABI Prism 6100 Nucleic Acid Prep Station (Applied Biosystems) with the recommended on-column DNAse treatment. cDNA synthesis was performed using the High capacity RNA to cDNA master mix with the addition of 2.5 mM poly dT primer, with the following reaction conditions: 5 min 25
C, 60 min 42
C, 5 min 85
C. The cDNA was diluted 1:30 in nuclease free water (Ambion) for further use in quantitative real time PCR. The absence of genomic DNA in the RNA (Non-template control; NTC) was verified by a selection of samples being subjected to real time PCR without prior cDNA synthesis. Real time PCR was performed in duplicates in 384 well plates using the 7900HT Fast real-time PCR system and Power SYBR green PCR master mix according to the manufacturers description (Applied Biosystems). Real time primers for target genes ISG15, IL1b, Elongation factor-1a (eF1a), LGP2, IL-6, IL-8, IL-12p40, IPNV and NNV have previously been reported [10,11,35e37] while primers for Vig-1, IRF-1 and mda5 are reported in this study (Table 1). Gene expression data were analysed with the SDS 2.3 software and exported to Microsoft Excel for further analysis. The efficiency of the PCRs was determined by analysis of 2-fold dilutions of cDNA and the 2DDCT method [38] was used for calculation of relative gene expression levels. The expression of target genes was normalised to eF1a and calibrated to non-stimulated or uninfected control cells at the same sampling time. The amounts of virus were calibrated against a fixed value (CT ¼ 35), while adjusting for differences in RNA input using eF1a. From relative quantification values obtained from three parallels of ACL cells, the mean quantity  standard error (SEM) was calculated. Statistical analyses between groups were made with the Student t-test and P < 0.05 was considered significant.

202

I. Jensen et al. / Fish & Shellfish Immunology 34 (2013) 199e208

Table 1 Real time PCR primers used in this study. Name

Primer name

Sequence (50 e30 )

PCR efficiency

r2

Interleukin-1b [10]

IL1b-658F IL1b-708R

GGAGAACACGGACGACCTGA CGCACCATGTCACTGTCCTT

98.8%

0.998

Interleukin-6 [34]

IL6-80F IL6-172R

TGAAGAAGGAGTACCCCGACAAT GGTGCCTCATCTTTTCCTCAATG

97.1%

0.994

Interleukin-8 [10]

IL8-446F IL8-516R

GGTTTGTTCAATGATGGGCTGTT GACCTTGCCTCCTCATGGTAATACT

96.8%

0.995

Interleukin-12 [34]

IL12p40-1F IL12p40-103R

AGCGAGACTTCATTCTGGAGGA GCCATGGTTGCATTCACCTT

91.0%

0.995

Interferon stimulated gene 15 [12]

ISG15-32F ISG15-108R

TAACCAGACAGCAGTTGGTCATG TGGAGCCACGGTAAGAGGG

99.7%

1.000

Viperin (HM046448.1)

Vig1-367F Vig1-448R

AGAAGATCAACTTCTCTGGCGGA ACTTTGCAGAACTGGACCAACC

98.7%

1.000

Melanoma differentiation-associated gene-5 (HM046433.1)

Mda5-477F Mda5-579R

ACGAGACCAATCAGTTTGTAGCG AGGTTCTTCACGTGGAGACTGG

96.6%

0.998

Laboratory of genetics and physiology 2 [11]

LGP2-435F LGP2-508R

GCTTCTCGGACATCACTCTGCT TCTGGTTGTAAACTCCCTCTTTGTG

96.3%

1.000

Interferon regulatory factor 1 (HM046444)

IRF1-309F IRF1-379R

CCAAAGAAATGGAAAGCCAACTT TTGCCTTTCACTTGTTCAACGTC

93.7%

0.998

Elongation factor 1a [10]

eF1a-148F eF1a-220R

ATGTGAGCGGTGTGGCAATC TCATCATCCTGAACCACCCTG

96.4%

1.000

Infectious pancreatic necrosis virus (NS-region) [11]

NS-1828F NS-1900R

AGGTCCTATCCCACTTCGCAAA TCTCCCTCGAAGGGTATGTCCT

92.2%

1.000

Nervous necrosis virus (NNV) [37]

P1 P2

GGTATGTCGAGAATCGCCC TAACCACCGCCCGTGTT

94.5%

0.998

3. Results 3.1. Tissue explants e a source of cells and conditioned medium Tissue explants from the newly hatched cod larvae adhered quickly to cell culture flasks and extensive proliferation and migration of cells could be observed after 24 h (Fig. 1a). Fastest outgrowth took place at 10
C, but outgrowth and proliferation were also observed at 5
C. Confluent cell layers were obtained within 4 weeks and the cells growing around the tissue explants were transferred to new cell culture flasks and used to initiate the cell line. The tissue explants were still intact after trypsination and cells continued to grow out from the explants for over 2 years. The tissue explant cultures were an important source of cells and conditioned medium, used as a supplement for establishment of the cell line. 3.2. Development of the ACL cell line Subcultured cells from the explant cultures were exposed to UV radiation after which most of the cells died. However, following a 4 month period of poor growth the cells showed signs of proliferation. After 5 months the cultures had grown to confluency. From this stage the cells were subcultured at a split ratio of 1:2 every 2e3 weeks. From passage 6 and over a period of several months there were problems with poor growth and extensive cell detachment. Several initiatives were accordingly made to improve culture conditions. An increase in incubation temperature from 10 to 13.5
C had a positive effect, while no effect was seen by addition of cod embryo extract, bFGF and inosine to culture media. A transient positive effect of adding 1 mM ATP to the culture medium was observed for 2e3 passages. At this stage bovine sera from several suppliers were also tested, and FBS Gold (PAA Laboratories) significantly improved cell proliferation and survival. After this critical

period, cell growth was good and the cells were routinely passaged at a split ratio of 1:4 every 1e2 weeks. The cells have now been passaged 116 times and have been given the name Atlantic cod larvae cells (ACL cells). Cells from different passages were frozen and stored in liquid nitrogen. Thawing and seeding of these cells were performed successfully several times. A substantial period of slow growth was observed after seeding before the cells could be routinely subcultured. The thawed ACL cells showed the same signs of survival and proliferation as cells not subjected to storage. 3.3. Morphology At early passage numbers the cell culture was a mix of at least two cell types, fibroblast- and epithelial-like cells. However, at later passages the cell culture appeared quite homogenous and became dominated by epithelial-like cells (Fig. 1b). This morphology remained predominant in subsequent passages (Fig. 1d and e). At low and medium cell density the cells were multipolar and some cells seemed to attach to each other by forming slender cytoplasmic projections (Fig. 1c and d). Proliferating cells clustered together in discrete patches and at confluency the cells were polygonal and formed a tight and flat cell layer with a pavement-like appearance (Fig. 1b and e). The flat structure of ACL cells was clearly seen by transmission electron microscopy showing stretched cells tightly attached to the surface (Fig. 1f). 3.4. Growth characteristics The proliferation of ACL cells at different temperatures and serum concentrations was measured using the CyQuant cell proliferation assay. The results showed that cell proliferation was serum dependent and when absent, cell numbers were maintained, but did not increase over the experimental period of 15 days (Fig. 2a). FBS

I. Jensen et al. / Fish & Shellfish Immunology 34 (2013) 199e208

203

Fig. 1. Morphology of ACL cells. A) Phase contrast microscopy of primary explant culture from cod larval tissue with outgrowing cells. BeE Morphology of ACL cells viewed by phase contrast microscopy. B) Confluent ACL cells in passage 35. C) ACL cells attached to each other by slender cytoplasmic projections. D) Semi-confluent cells in passage 77. E) Confluent cells in passage 72 showing the homogenous appearance of ACL cells. F) Transmission electron microscopy showing the flat structure of ACL cells.

concentrations ranging from 2 to 15% were needed for the cells to proliferate. Highest cell numbers were obtained with 10 and 15% FBS, intermediate cell numbers with 5% FBS and lowest cell numbers with 2% FBS. Temperature also affected ACL cell proliferation (Fig. 2b). Highest cell proliferation occurred at 15
C, while intermediate levels were observed at 12 and 20
C. At 25
C a small increase in cell number was detected, while at 5
C cells initially remained intact, but eventually started to disintegrate and cell numbers decreased. 3.5. Expression of immune genes To investigate if the cell line could recognise a synthetic form of dsRNA, ACL cells were stimulated with poly I:C. Initially, an experiment was performed to determine the optimal concentration of poly I:C to be used for stimulation of gene expression. This was based on previous observations that primary cod cells did not tolerate poly I:C concentrations commonly used for stimulation of salmonid cell lines. ACL cells were treated with 0.1, 1 and 10 mg/ml poly I:C and cells were harvested 24 h later for subsequent gene expression analysis by real time PCR. ISG15 expression was dose dependent and increased from 3067-fold with 0.1 mg/ml poly I:C to

4995-fold increase with 10 mg/ml poly I:C (results not shown). No toxic effects were evident by any of the poly I:C concentrations tested, as observed by microscopy up to 72 h after stimulation. A time course study was subsequently performed where ACL cells were stimulated with 10 mg/ml poly I:C. ACL cells responded rapidly by inducing expression of immune related genes (Fig. 3). Gene expression of IL-1b and IL-8 was induced to significant levels after 3 h with peak expression at 12e24 h. IL-6 was also inducible by poly I:C, but to a much lower level, although also significantly different from controls. Expression analyses of IL-10 revealed that this gene was neither expressed constitutively nor induced by poly I:C in ACL cells (not shown). The genes known as interferon inducible genes (ISGs) (ISG15, Vig-1, IRF1, LGP2 and mda5) showed that they were highly inducible at a significant level by poly I:C, and uppermost expression was seen for ISG15 and Vig-1 (3700-fold). In contrast to poly I:C-induced interleukin expression, which was temporary, poly I:C-induced ISG expression remained elevated at high levels throughout the experimental period of 96 h. The ability of ACL cells to produce and secrete interferon-like activity was tested by harvesting culture medium from cells pulse stimulated with poly I:C (ICS). This culture medium was used to re-stimulate ACL cells, which subsequently were analysed for

204

I. Jensen et al. / Fish & Shellfish Immunology 34 (2013) 199e208

after 3 days the infection had proceeded to full cell lysis and detachment. In comparison, CPE developed slower in infected CHSE-214 cells, where no signs of infection were visible the first day pi. However, full cell lysis appeared also here 2e3 days pi. Titration showed that ACL cells produced viral particles at the same level as CHSE-214 cells, with titres from 107 to 108 TCID50/ml. The two different incubation temperatures did not cause any major differences in virus production (Fig. 5). In a subsequent infection experiment with IPNV, a lower infectious dose was used to avoid the very rapid development of CPE. Accordingly, the first signs of viral infection appeared 3 days pi., while from day 4 and onwards increasing signs of CPE was evident. Concurrently the relative amounts of IPNV RNA increased massively (48 000-fold) until day 3 and beginning cell lysis, and thereafter declined gradually (Fig. 6a). Full CPE occurred at day 6e7 and these time points were thus omitted from gene expression analysis. In initial experiments with NNV, ACL cells were infected and incubated at 15
C for 21 days. No changes in appearance of the cells were evident when compared to uninfected controls during this period. Concurrently, no increase in the amount of viral RNA was found in infected cells 7, 14 and 21 days pi. (results not shown). In a subsequent infection experiment, ACL cells were incubated at 20
C and real time PCR analysis showed that the level of NNV RNA increased slightly at early time points, from 12 h to 48 h pi., followed by a gradual decline of detectable RNA during the experimental period of 7 days (Fig. 6a). However, visual inspection of ACL cells showed no changes in cell appearance and no infectious particles were detected by titration (results not shown) indicating that complete virus assembly was not accomplished. Both IPNV and NNV induced expression of immune genes in ACL cells, although to varying levels and at different time points. As mentioned above, IPNV replicated intensively in these cells and caused beginning CPE by 4 days pi. Before complete cell lysis occurred, IPNV induced significant expression of ISGs, such as ISG15 (23-fold), Vig-1 (18-fold), IRF-1 (5-fold) and LGP2 (7-fold), while no induction of mda5 was detected. In comparison, NNV caused a delayed, but stronger induction of the ISGs; ISG15 (266-fold), Vig1 (55-fold), LGP2 (62-fold) and even mda5 (4-fold) (Fig. 6b,c,e,f). IRF-1 was, however only weakly but significantly induced by both viruses (Fig. 6d). The inflammatory responsive genes IL-1b and IL-8, showed only minor changes in gene expression caused by viral infections (Fig. 6g,i). Interestingly, the IL-6 gene showed significantly increased transcription due to IPNV, but not NNV, at the first signs of viral infection (72 h) and expression increased until full cell lysis (Fig. 6h). IL-12p40 was the only gene that was significantly induced already 24 h pi. (42 and 70-fold) and this was evident for

100000

A

Cellnumber

80000

0

2

5

10

15

60000 40000 20000 0 0

5

10

15

Days

Cellnumber

40000

5°C 20°C

B

12°C 25°C

15°C

10

15

30000 20000 10000 0 0

5

20

Days Fig. 2. Effect of temperature and serum concentration on proliferation of ACL cells. Cell numbers were measured using the CyQuant fluorimetric assay. A) ACL cells were incubated at 5, 12, 15, 20 and 25
C. B) ACL cells were incubated with 0, 2, 5, 10 and 15% FBS and incubated at 15
C. Results are presented as mean of quadruplicates and the graphs represent one of two similar experiments.

expression of immune genes. ICS significantly induced expression of the ISGs (ISG15, Vig-1, IRF-1, LGP2 and mda5) to levels equivalent to the induction obtained after stimulation with poly I:C (Fig. 4). Expression of the IL-1b gene was induced by poly I:C but not by ICS. 3.6. Susceptibility to viral infections ACL cells were tested for susceptibility to both IPNV and NNV. In initial experiments with IPNV, ACL cells were infected in parallel with CHSE-214 cells, a cell line well known to be IPNV-susceptible. Both cell lines were incubated at 15 and 20
C during the experiment. CPE developed rapidly in IPNV-infected ACL cells. Typical cellular changes due to infection were visible already 1 day pi. and

3h 6h 12 h 24 h 48 h 72 h 96 h

Fold increase

10000 1000 100 10 1 Ctr

Poly I:C

IL-1β

Ctr

Poly I:C

Ctr

IL-6

Inflammatory genes

Poly I:C

IL-8

Ctr

Poly I:C

ISG15

Ctr Poly I:C Ctr Poly I:C Ctr Poly I:C Ctr Poly I:C Vig1

IRF1

LGP2

Mda-5

Interferon stimulated genes (ISGs)

Fig. 3. Expression of innate immune genes following poly I:C stimulation of ACL cells. ACL cells were stimulated with poly I:C (10 mg/ml) or left untreated (Ctr) and analysed for expression of immune genes after 3e96 h by real time PCR analysis. The expression of target genes was normalised to eF1a and calibrated to non-stimulated control. Relative quantification values were obtained from three samples and the mean quantity  standard error of the mean (SEM) was calculated.

I. Jensen et al. / Fish & Shellfish Immunology 34 (2013) 199e208

205

Control

10000

Poly I:C ICS ICS-Ctr

Fold increase

1000

100

10

1

ISG15

Vig-1

IRF1

LGP2

Mda5

IL-1β

Fig. 4. Stimulatory activity in an interferon containing supernatant generated from ACL cells. ACL cells were cultured in medium containing 10 mg/ml poly I:C for 7 h, followed by thoroughly rinsing and subsequent feeding with fresh medium (ICS). Control cells were treated similarly without receiving poly I:C (ICS-Ctr). After 24 h incubation culture supernatants were collected and used to restimulate ACL cells for 12 h and subsequent real time PCR analysis. As a positive control direct stimulation with poly I:C was included. The expression of target genes was normalised to eF1a and calibrated to non-stimulated control. Relative quantification values were obtained from three samples and the mean quantity  standard error of the mean (SEM) was calculated.

both viruses, although at higher intensities and more longer lasting for NNV (Fig. 6j). 4. Discussion In this study a cell line with epithelial-like morphology was established from Atlantic cod larvae. There are not many cell lines available from coldwater marine fish species and to our knowledge, ACL cell is at the moment the only existing cell line from Atlantic cod [6]. Cell lines are important in vitro model systems for studies in a range of disciplines and this work was initiated to develop a cell line useful for studies of hostepathogen interactions and innate immune responses in cod. 4.1. Establishment of the cell line The ACL cell line was established from cells growing out from primary explants of cod larvae. These tissue explants had a remarkable capacity for cell proliferation and was repeatedly used as a source of cells for up to 2 years. In spite of this, subculturing these cells for more than a few passages recurrently failed due to cell degeneration and death. To try to induce continuous cell proliferation the cultures that served as the starting point for the

109

108

TCID50/ml

107 106 105

Day 0

104

Day 1

103

Day 3

102 10 15°C

20°C ACL

15°C

20°C CHSE

Fig. 5. Production of IPNV in ACL and CHSE-214 cells. ACL and CHSE-214 cells were infected with IPNV and incubated at 15 and 20
C. Cells were harvested at different time points post infection and virus production was titrated on CHSE-214 cells.

ACL cell line were exposed to UV radiation. This had no immediate positive effect; however, after a period of four months the cells showed signs of proliferation and reached confluency within a month. It is possible that one or several mutations had occurred in this period, either spontaneously or caused by the UV-radiation, and hence increased the ability for cell proliferation. The radiated cells could be subcultured for a few passages before the proliferation rate decreased also in these cultures. In this period several actions were taken to enhance cell viability and proliferation. Increasing the incubation temperature from 10 to 13.5
C improved cell proliferation, while ATP had an important transient effect on attachment and growth of ACL cells. Similar effects of ATP supplementation have previously been observed during development of a cell line from haddock (Melanogrammus aeglefinius) [39]. From studies of salmonid cell lines, purine supplementation is proposed to maintain intracellular purine nucleotides at the level necessary for cells to proliferate in response to serum growth factors [40]. The use of bFGF has previously been shown to increase the growth rate of cell lines from Japanese flounder and turbot [41,42], but for ACL cells this had no effect. One of the most important medium supplements for ACL cells is believed to have been FBS. Several types and batches were tested and FBS Gold (PAA Laboratories) proved to be most beneficial and was used in further cell line development. Bovine sera provide important growth factors and are a necessary supplement for the growth of most cell lines. This was also true for ACL cells, as cell proliferation was shown to be completely serum dependent. ACL cells were able to proliferate at FBS concentrations ranging from 2 to 15%, with optimal growth with 10 and 15%. Attempts were also made to generate homologous growth factors that could enhance cell proliferation. Yet, addition of small amounts of cod sera to the growth medium had a toxic effect on cell viability. Addition of cod embryo extract has previously been used as a supplement to cultured cod embryonic stem cells [43], but had no positive effect on ACL cells. However, the use of conditioned medium from the tissue explants is believed to have provided an important source of growth factors essential for generating the cell line. ACL cells were regularly given conditioned media during the first year and then adapted to grow without this supplement. 4.2. Temperature Cod usually inhabits waters with a temperature range of 0e12
C [44], with optimal growth performance in the range of 10e15
C

I. Jensen et al. / Fish & Shellfish Immunology 34 (2013) 199e208

Viral RNA

A 1.E+8

Viraldetection

1.E+6

IPNV NNV

1.E+4

B 500 Fold increase

206

1.E+2

300 200

0 12 h 24 h 48 h 72 h 96 h 120 h 144 h 168 h

12 h 24 h 48 h 72 h 96 h 120 h 144 h 168 h 100

Control IPNV NNV

100

1.E+0

C

ISG15

400

Vig-1

D

80

20

IRF1

15

60 10 40 5

20

0

0

12 h 24 h 48 h 72 h 96 h 120 h 144 h 168 h

12 h 24 h 48 h 72 h 96 h 120 h 144 h 168 h

E

100

LGP2

F

80

20

Mda5

15

60 10 40

5

20 0

0 12 h 24 h 48 h 72 h 96 h 120 h 144 h 168 h

G

20

IL -1β

12 h 24 h 48 h 72 h 96 h 120 h 144 h 168 h

H

20

15

15

10

10

5

5 0

0

12 h 24 h 48 h 72 h 96 h 120 h 144 h 168 h

12 h 24 h 48 h 72 h 96 h 120 h 144 h 168 h

I

20

IL -6

IL-8

J

200

15

150

10

100

5

50

0

IL -12p40

0 12 h 24 h 48 h 72 h 96 h 120 h 144 h 168 h

12 h 24 h 48 h 72 h 96 h 120 h 144 h 168 h

Fig. 6. Detection of viral RNA and expression of immune genes following infection with IPNV and NNV. ACL cells were infected with IPNV or NNV and subjected to gene expression analysis of A) IPNV and NNV, B) ISG15, C) Vig-1, D) IRF-1, E) LGP2, F) Mda5, G) IL-1b, H) IL-6, I) IL-8 and J) IL-12p40. The expression of target genes was normalised to eF1a and calibrated to non-stimulated control. Relative quantification values were obtained from three samples and the mean quantity  standard error of the mean (SEM) was calculated.

[44,45]. It is common that the temperature range for proliferation of fish cells in culture is wider than the temperature range that the fish will grow [46]. This is in accordance with our growth studies with ACL cells, where the cells proliferated at temperatures from 12 to 25
C. At 5
C the cells appeared viable but cell numbers did not increase. A cell line established from haddock, another member of the Gadidae family, had a quite similar temperature range for proliferation, although it was more heat sensitive [39]. The ACL cells used for temperature studies had been incubated at 15
C for 2 years prior to the experiment and, as the results show,

seem well adapted to this temperature. ACL cells also proliferated at 20
C and 25
C, however long-term adaptation to 20
C was difficult to achieve. When cells were incubated exclusively at 20
C for several months massive cell detachment repeatedly occurred. 4.3. Expression of immune genes ACL cells were explored for their applicability in immunological studies by subjecting cells to poly I:C stimulation and gene expression analysis. ACL cells constitutively expressed the interleukins

I. Jensen et al. / Fish & Shellfish Immunology 34 (2013) 199e208

(IL-1b, IL-6, IL-8 and IL-12p40) and the interferon stimulated genes (ISGs; ISG15, Vig-1, IRF1, LGP2 and mda5). Poly I:C stimulation resulted in increased expression of all genes studied, where a temporary induction pattern was evident for the interleukins, while a protracted induction was observed for the ISGs. Similar results for some of the interleukins and ISGs have previously been shown in cod primary macrophage cultures and in vivo after treatment with poly I:C [10,12]. One deviating observation is that the anti-inflammatory IL-10 was not constitutively expressed nor induced by poly I:C, indicating an absence of traditional regulation of inflammation in ACL cells. Interestingly, the IL-12p40 subunit was expressed in ACL cells. From mammals it is known that the p40 peptide chain forms a heterodimer with either p35 or p19 resulting in IL-12 or IL-23, respectively. Also the p40 homodimer is biologically active as an IL-12 antagonist [47]. In fish the biologically active molecules comprising IL-12 have not been studied, but gene expression studies have shown that IL-12p40 is expressed in cod [9] as well as in other fish species [14]. In mammals these members of the IL-12 family of cytokines participate in mediating T-cell dependent immunity and the main source of IL-12p40 is macrophages and dendritic cells. Expression of IL-12p40 in ACL cells is certainly very interesting and should be explored further by searching for possible interaction partners. The expression ISGs were highly induced by poly I:C, particularly the putative antiviral genes ISG15 and Viperin (Vig1) and IRF-1 was also expressed in ACL cells. Interferon regulatory factors (IRFs) are known as important in transcriptional activation of IFNs and ISGs. Also in fish, IRF-3 and IRF-7 have their main roles as inducers of IFN genes (reviewed in Ref. [48]), but fish IRF-1 is also thought to participate in antiviral defence. Gene expression of IRF-1 has previously been shown to be poly I:C-inducible in cod [49] and has been implicated in induction of an antiviral state in fish [50]. The members of the RIG-I-like receptor (RLR) proteins, Mda5 and LGP2 share an RNA helicase domain, which is able to detect cytoplasmic RNA molecules of viral origin [51]. The toll-like receptors (TLRs) recognising viral or synthetic RNA are normally present only in specialised immune cells, while the RLR proteins are present in most cell types. It is therefore not surprising that these genes of the RLR family are expressed in the cod cell line and are induced by poly I:C. Poly I:C mediated expression of Mda5 and LGP2 is also known from other fish species [52]. The ability of ACL cells to produce and secrete IFN-like activity was measured indirectly by producing supernatants from ACL cells pulse-stimulated with poly I:C (ICS). These supernatants were able to induce expression of all the studied ISGs to levels comparable to those obtained by direct poly I:C stimulation. Although the antiviral effect of the supernatants awaits testing, these results indicate the presence of IFN-like activity in ACL cells. Our preliminary results also show induction of IFNa1 gene expression in ACL cells by poly I:C and virus infection (not shown) further supporting this. In contrast to the expression of ISGs, the expression of IL-1b was not induced by ICS, but only by poly I:C, providing indications for differences in transcriptional regulation by different stimuli. In mammals, it has been shown that type I IFN may selectively limit the production of IL-1b [53]. Whether this is the situation in ACL cells requires supplementary analysis. 4.4. Susceptibility to viral infection Susceptibility of cell lines to viral infection is the basis for isolating and characterising viruses and studies of hostepathogen interactions. In the present study the cod cell line was tested for susceptibility to IPNV and NNV with very different outcomes. IPNV generated a rapid CPE and production of high titres of infectious

207

particles. These results were obtained with an IPNV isolate originating from Atlantic halibut, however similar results were also obtained using an IPNV isolate originating from Atlantic salmon (results not shown). This was not unexpected since IPNV is able to propagate in a wide range of fish cell lines and species specificity for IPNV isolates has not, to our knowledge, been observed at the level of cell lines. For NNV, no CPE or production of infectious particles was detected. Still, at early time points after infection there was a slight increase in viral RNA with a subsequent gradual decline. Further analysis showed that NNV induced changes in expression of the ISGs and of IL-12p40. Taken together the results indicate that the virus enters ACL cells, but is not able to complete its replication cycle. Whether the inhibition of NNV replication in ACL cells is caused by specific antiviral mechanisms is not known. However, in warmwater fish species NNV is known to be inhibited by the antiviral Mx-proteins [26,27]. Cod Mx genes have not yet been identified, so if it is similar for NNVs infecting coldwater fish such as cod awaits clarification. In the case of IPNV, ACL cells seemed to attempt generating an immune response before they rapidly died. The expression of the ISGs was induced, but at much lower levels than with NNV. IPNV is also known as a poor inducer of ISGs in salmonid cells in vitro [29,54,55]. This is probably related to the virus having mechanisms to inhibit the type I IFN response and thereby promoting viral replication and a rapid development of CPE [29]. Interestingly, the IL-6 gene was induced following IPNV infection and not by NNV. IL-6 is a multifunctional cytokine with various functions in inflammation. Recent studies in mammals suggest that IL-6 could be a potential disease severity marker in the terminal phase of viral infection [56], however studies of IL-6 in fish are scarce and whether related functions would be found in cod is so far not known. IL-12p40 was the only gene that was induced already 24 h pi. and by both viruses, although at higher intensities and more long lasting for NNV. The function of IL-12p40 is dependent on which polypeptide partner it interacts with, but this may indicate induction of signals stimulating cellular immune mechanisms by viral infection of ACL cells. In the present study we describe the establishment of an epithelial-like cell line named ACL cells from Atlantic cod. The ACL cell line has been subcultured for more than 100 passages and proliferates in a wide temperature range with optimal growth at 15
C. By exposure to a viral dsRNA mimic (poly I:C) the cells expressed high levels of several genes comprising both inflammatory mediators and interferon stimulated genes. Infection studies showed that IPNV propagates efficiently in ACL cells, while NNV appears to be unable to complete its replication cycle in these cells. The use of in vitro model systems, such as fish cell lines, is playing an increasingly important role in the characterisation of hoste pathogen interactions. The availability of this cell line provides a new cellular model system for pathogens relevant to Atlantic cod and other coldwater marine fish species. Acknowledgements This project was financed by the Norwegian Research Council (project number 158952 and 199672/S40) and by Nofima. We are grateful to Anne Grethe Hestnes, Department of Arctic and Marine Biology and Randi Olsen at the Laboratory of Electron Microscopy, University of Tromsø, Norway for assistance with microscopy and for performing TEM respectively. References [1] Kjesbu OS, Taranger GL, Trippel EA. Gadoid mariculture: development and future challenges. ICES J Mar Sci 2006;63:187e91.

208

I. Jensen et al. / Fish & Shellfish Immunology 34 (2013) 199e208

[2] Hellberg H, Kvellestad A, Dannevig B, Borno G, Modahl I, Haldorsen RN, et al. Outbreaks of viral nervous necrosis in juvenile and adult farmed Atlantic cod, Gadus morhua L., in Norway. J Fish Dis 2010;33:75e81. [3] Patel S, Korsnes K, Bergh O, Vik-Mo F, Pedersen J, Nerland AH. Nodavirus in farmed Atlantic cod Gadus morhua in Norway. Dis Aquat Organ 2007;77: 169e73. [4] Samuelsen OB, Nerland AH, Jorgensen T, Schroder MB, Swasand T, Bergh O. Viral and bacterial diseases of Atlantic cod Gadus morhua, their prophylaxis and treatment: a review. Dis Aquat Organ 2006;71:239e54. [5] Olsen AB, Mikalsen J, Rode M, Alfjorden A, Hoel E, Straum-Lie K, et al. A novel systemic granulomatous inflammatory disease in farmed Atlantic cod, Gadus morhua L., associated with a bacterium belonging to the genus Francisella. J Fish Dis 2006;29:307e11. [6] Lakra WS, Swaminathan TR, Joy KP. Development, characterization, conservation and storage of fish cell lines: a review. Fish Physiol Biochem 2011;37: 1e20. [7] Jensen NJ, Christensen K. A fish cell-line from gonads of cod (Gadus morhua). Nord Vet Med 1981;33:492e7. [8] Villena AJ. Applications and needs of fish and shellfish cell culture for disease control in aquaculture. Rev Fish Biol Fisher 2003;13:111e40. [9] Bakkemo KR, Mikkelsen H, Bordevik M, Torgersen J, Winther-Larsen HC, Vanberg C, et al. Intracellular localisation and innate immune responses following Francisella noatunensis infection of Atlantic cod (Gadus morhua) macrophages. Fish Shellfish Immunol 2011;31:993e1004. [10] Seppola M, Larsen AN, Steiro K, Robertsen B, Jensen I. Characterisation and expression analysis of the interleukin genes, IL-1beta, IL-8 and IL-10, in Atlantic cod (Gadus morhua L.). Mol Immunol 2008;45:887e97. [11] Jensen I, Seppola M, Steiro K, Sandaker E, Mennen S, Sommer AI. Susceptibility of Atlantic cod (Gadus morhua L.) juveniles to different routes of experimental challenge with infectious pancreatic necrosis virus (IPNV). Dis Aquat Organ 2009;85:105e13. [12] Seppola M, Stenvik J, Steiro K, Solstad T, Robertsen B, Jensen I. Sequence and expression analysis of an interferon stimulated gene (ISG15) from Atlantic cod (Gadus morhua L.). Dev Comp Immunol 2007;31:156e71. [13] Furnes C, Kileng O, Rinaldo CH, Seppola M, Jensen I, Robertsen B. Atlantic cod (Gadus morhua L.) possesses three homologues of ISG15 with different expression kinetics and conjugation properties. Dev Comp Immunol 2009;33: 1239e46. [14] Huising MO, van Schijndel JE, Kruiswijk CP, Nabuurs SB, Savelkoul HF, Flik G, et al. The presence of multiple and differentially regulated interleukin-12p40 genes in bony fishes signifies an expansion of the vertebrate heterodimeric cytokine family. Mol Immunol 2006;43:1519e33. [15] Star B, Nederbragt AJ, Jentoft S, Grimholt U, Malmstrom M, Gregers TF, et al. The genome sequence of Atlantic cod reveals a unique immune system. Nature 2011;477:207e10. [16] Starkey WG, Ireland JH, Muir KF, Jenkins ME, Roy WJ, Richards RH, et al. Nodavirus infection in Atlantic cod and Dover sole in the UK. Vet Rec 2001; 149:179e81. [17] Johnson SC, Sperker SA, Leggiadro CT, Groman DB, Griffiths SG, Ritchie RJ, et al. Identification and characterization of a piscine neuropathy and nodavirus from juvenile Atlantic cod from the Atlantic coast of North America. J Aquat Anim Health 2002;14:124e33. [18] Roberts RJ, Pearson MD. Infectious pancreatic necrosis in Atlantic salmon, Salmo salar L. J Fish Dis 2005;28:383e90. [19] Biering E, Nilsen F, Rodseth OM, Glette J. Susceptibility of Atlantic halibut hippoglossusehippoglossus to infectious pancreatic necrosis virus. Dis Aquat Organ 1994;20:183e90. [20] Garcia J, Urquhart K, Ellis AE. Infectious pancreatic necrosis virus establishes an asymptomatic carrier state in kidney leucocytes of juvenile Atlantic cod, Gadus morhua L. J Fish Dis 2006;29:409e13. [21] Martin-Armas M, Zykova S, Smedsrod B. Effects of CpG-oligonucleotides, poly I:C and LPS on Atlantic cod scavenger endothelial cells (SEC). Dev Comp Immunol 2007. [22] Skall HF, Mellergaard S, Olesen NK. Isolation of Birnavirus serogroup B in wild and aquacultured fish species. Bull Eur Assn Fish Pathol 2000;20:229e36. [23] Martin-Armas M, Sommer AI, Smedsrod B. Studies on uptake and intracellular processing of infectious pancreatic necrosis virus by Atlantic cod scavenger endothelial cells. J Fish Dis 2007;30:701e10. [24] Lorenzen E, Olesen N, Strøm A, Evensen Ø. Outbreaks of IPN in reared fry of Atlantic cod (Gadus morhua). In: Bernoth E, editor. 7th international EAFP conference “diseases of fish & shellfish”; 1995. Palma de Mallorca: abstract, p. 38. [25] Robertsen B, Bergan V, Rokenes T, Larsen R, Albuquerque A. Atlantic salmon interferon genes: cloning, sequence analysis, expression, and biological activity. J Interferon Cytokine Res 2003;23:601e12. [26] Chen YM, Su YL, Shie PS, Huang SL, Yang HL, Chen TY. Grouper Mx confers resistance to nodavirus and interacts with coat protein. Dev Comp Immunol 2008;32:825e36. [27] Wu YC, Lu YF, Chi SC. Anti-viral mechanism of barramundi Mx against betanodavirus involves the inhibition of viral RNA synthesis through the interference of RdRp. Fish Shellfish Immunol 2010;28:467e75. [28] Fenner BJ, Thiagarajan R, Chua HK, Kwang J. Betanodavirus B2 is an RNA interference antagonist that facilitates intracellular viral RNA accumulation. J Virol 2006;80:85e94.

[29] Skjesol A, Aamo T, Hegseth MN, Robertsen B, Jorgensen JB. The interplay between infectious pancreatic necrosis virus (IPNV) and the IFN system: IFN signaling is inhibited by IPNV infection. Virus Res 2009;143:53e60. [30] Sommer AI, Strand MA, Rasmussen E, Mennen S. Susceptibility of spotted wolffish Anarhichas minor to experimental infection with nodavirus and infectious pancreatic necrosis virus. Dis Aquat Organ 2004;59:101e8. [31] Ødegard J, Sommer AI, Praebel AK. Heritability of resistance to viral nervous necrosis in Atlantic cod (Gadus morhua L). Aquaculture 2010;300:59e64. [32] Lannan CN, Winthon JR, Fryer JL. Fish cell lines: establishment and characterization of nine cell lines from salmonids. In Vitro 1984;220:671e6. [33] Iwamoto T, Nakai T, Mori K, Arimoto M, Furusawa I. Cloning of the fish cell line SSN-1 for piscine nodaviruses. Dis Aquat Organ 2000;43:81e9. [34] Reed LT, Muench H. A simple method of calculating fifty percent end point. Am J Hyg 1938;27:493e8. [35] Mikkelsen H, Lund V, Larsen R, Seppola M. Vibriosis vaccines based on various sero-subgroups of Vibrio anguillarum O2 induce specific protection in Atlantic cod (Gadus morhua L.) juveniles. Fish Shellfish Immunol 2011;30: 330e9. [36] Seppola M, Johnsen H, Mennen S, Myrnes B, Tveiten H. Maternal transfer and transcriptional onset of immune genes during ontogenesis in Atlantic cod. Dev Comp Immunol 2009;33:1205e11. [37] Grove S, Faller R, Soleim KB, Dannevig BH. Absolute quantitation of RNA by a competitive real-time RT-PCR method using piscine nodavirus as a model. J Virol Methods 2006;132:104e12. [38] Livak KJ, Schmittgen TD. Analysis of relative gene expression data using real-time quantitative PCR and the 2(-Delta Delta C(T)) method. Methods 2001;25:402e8. [39] Bryson SP, Joyce EM, Martell DJ, Lee LEJ, Holt SE, Kales SC, et al. A cell line (HEW) from embryos of haddock (Melanogrammus aeglefinius) and its capacity to tolerate environmental extremes. Mar Biotechnol 2006;8: 641e53. [40] Ganassin RC, Tran QH, Rabgey TF, Bols NC. Enhancement of proliferation in cultures of Chinook salmon embryo cells by interactions between inosine and bovine sera. J Cell Physiol 1994;160:409e16. [41] Chen SL, Ren GC, Sha ZX, Hong YH. Development and characterization of a continuous embryonic cell line from turbot (Scophthalmus maximus). Aquaculture 2005;249:63e8. [42] Chen SL, Ren GC, Sha ZX, Shi CY. Establishment of a continuous embryonic cell line from Japanese flounder Paralichthys olivaceus for virus isolation. Dis Aquat Organ 2004;60:241e6. [43] Holen E, Kausland A, Skjaerven K. Embryonic stem cells isolated from Atlantic cod (Gadus morhua) and the developmental expression of a stage-specific transcription factor ac-Pou2. Fish Physiol Biochem 2010;36: 1029e39. [44] Drinkwater KF. The response of Atlantic cod (Gadus morhua) to future climate change. ICES J Mar Sci 2005;62:1327e37. [45] Portner HO, Berdal B, Blust R, Brix O, Colosimo A, De Wachter B, et al. Climate induced temperature effects on growth performance, fecundity and recruitment in marine fish: developing a hypothesis for cause and effect relationships in Atlantic cod (Gadus morhua) and common eelpout (Zoarces viviparus). Cont Shelf Res 2001;21:1975e97. [46] Bols NC, Mosser DD, Steels GB. Temperature studies and recent advances with fish cells in vitro. Comp Biochem Physiol 1992;103A:1e14. [47] Gee K, Guzzo C, Che Mat NF, Ma W, Kumar A. The IL-12 family of cytokines in infection, inflammation and autoimmune disorders. Inflamm Allergy Drug Targets 2009;8:40e52. [48] Zou J, Secombes CJ. Teleost fish interferons and their role in immunity. Dev Comp Immunol 2011;35:1376e87. [49] Rise ML, Hall J, Rise M, Hori T, Gamperl AK, Kimball J, et al. Functional genomic analysis of the response of Atlantic cod (Gadus morhua) spleen to the viral mimic polyriboinosinic polyribocytidylic acid (pIC). Dev Comp Immunol 2008; 32:916e31. [50] Caipang CM, Hirono I, Aoki T. Induction of antiviral state in fish cells by Japanese flounder, Paralichthys olivaceus, interferon regulatory factor-1. Fish Shellfish Immunol 2005;19:79e91. [51] Bruns AM, Horvath CM. Activation of RIG-I-like receptor signal transduction. Crit Rev Biochem Mol Biol 2012;47:194e206. [52] Chang M, Collet B, Nie P, Lester K, Campbell S, Secombes CJ, et al. Expression and functional characterization of the RIG-I-like receptors MDA5 and LGP2 in Rainbow trout (Oncorhynchus mykiss). J Virol 2011;85:8403e12. [53] Novikov A, Cardone M, Thompson R, Shenderov K, Kirschman KD, Mayer-Barber KD, et al. Mycobacterium tuberculosis triggers host type I IFN signaling to regulate IL-1beta production in human macrophages. J Immunol 2011;187:2540e7. [54] Røkenes TP, Larsen R, Robertsen B. Atlantic salmon ISG15: expression and conjugation to cellular proteins in response to interferon, double-stranded RNA and virus infections. Mol Immunol 2007;44:950e9. [55] Jensen I, Robertsen B. Effect of double-stranded RNA and interferon on the antiviral activity of Atlantic salmon cells against infectious salmon anemia virus and infectious pancreatic necrosis virus. Fish Shellfish Immun 2002;13: 221e41. [56] Paquette SG, Banner D, Zhao Z, Fang Y, Huang SS, Leomicronn AJ, et al. Interleukin-6 is a potential biomarker for severe pandemic H1N1 influenza A infection. PLoS ONE 2012;7:e38214.