Establishment of a Drug-Induced, Bile Acid–Dependent Hepatotoxicity Model Using HepaRG Cells

Journal of Pharmaceutical Sciences xxx (2016) 1e11

Contents lists available at ScienceDirect

Journal of Pharmaceutical Sciences journal homepage: www.jpharmsci.org

Pharmacokinetics, Pharmacodynamics and Drug Transport and Metabolism

Establishment of a Drug-Induced, Bile AcideDependent Hepatotoxicity Model Using HepaRG Cells Takeshi Susukida 1, Shuichi Sekine 1, Mayuka Nozaki 1, Mayuko Tokizono 1, Kumiko Oizumi 1, Toshiharu Horie 2, Kousei Ito 1, * 1 2

Laboratory of Biopharmaceutics, Graduate School of Pharmaceutical Sciences, Chiba University, Chiba, Japan Biopharmaceutics and Molecular Toxicology Unit, Faculty of Pharmaceutical Sciences, Teikyo Heisei University, Tokyo, Japan

a r t i c l e i n f o

a b s t r a c t

Article history: Received 19 October 2015 Revised 4 January 2016 Accepted 8 January 2016

Bile acid (BA) retention within hepatocytes is an underlying mechanism of cholestatic drug-induced liver injury (DILI). We previously developed an assay using sandwich-cultured human hepatocytes (SCHHs) to evaluate drug-induced hepatocyte toxicity accompanying intracellular BA accumulation. However, due to shortcomings commonly associated with the use of primary human hepatocytes (e.g., limited availability, lot-to-lot variability, and high cost), we examined if the human hepatic stem cell line, HepaRG, might also be applicable to our assay system. Consequently, mRNA expression levels of human BA efflux and uptake transporters were lower in HepaRG cells than in SCHHs but higher than in HepG2 human hepatoma cells. Nevertheless, HepaRG cells and SCHHs showed similar toxicity responses to 22 selected drugs, including cyclosporine A (CsA). CsA (10 mM) was cytotoxic toward HepaRG cells in the presence of BAs and also reduced the biliary efflux rate of [3H]taurocholic acid from 38.5% to 19.2%. Therefore, HepaRG cells are useful for the evaluation of BA-dependent drug toxicity caused by biliary BA efflux inhibition. Regardless, the prediction accuracy for cholestatic DILI risk was poor for HepaRG cells versus SCHHs, suggesting that our DILI model system requires further improvements to increase the utility of HepaRG cells as a preclinical screening tool. © 2016 American Pharmacists Association®. Published by Elsevier Inc. All rights reserved.

Keywords: hepatocytes bile acid transporters biliary excretion in vitro models toxicology cell lines

Introduction Drug-induced liver injury (DILI) is a potentially serious adverse event leading to severe damage of the liver, resulting in liver transplantation in worst-case scenarios. Because numerous candidate

Abbreviations: ALP, alkaline phosphatase; BA, bile acid; BEI, biliary excretion index; BSEP/Bsep, bile salt export pump; CsA, cyclosporine A; DILI, drug-induced liver injury; DMEM, Dulbecco's modified Eagle's medium; DMSO, dimethyl sulfoxide; FBS, fetal bovine serum; GCDC, glycochenodeoxycholate; Glib, glibenclamide; HBSS, Hank's balanced salt solution; ITS, human insulin/transferrin/sodium selenite; LDH, lactate dehydrogenase; MRP/Mrp, multidrug resistance-associated protein; NTCP/Ntcp, Naþ-taurocholate co-transporting polypeptide; OATP/Oatp, organic anion-transporting polypeptide; PFIC2, progressive familial intrahepatic cholestasis type 2; qPCR, quantitative real-time PCR; ROC, receiver-operating characteristic; SCHH, sandwich-cultured human hepatocyte; SCRH, sandwichcultured rat hepatocyte; TC, taurocholic acid; Valp, valproic acid; WME, Williams' Medium E. Conflicts of interest: The authors declare no conflicts of interests in association with this article. This article contains supplementary material available from the authors by request or via the Internet at http://dx.doi.org/10.1016/j.xphs.2016.01.013. * Correspondence to: Kousei Ito (Telephone/Fax: þ81-43-226-2886). E-mail address: [email protected] (K. Ito).

compounds have been eliminated from drug development due to DILI, and already marketed drugs were withdrawn from clinical use for similar reasons,1,2 it is necessary to promptly identify, remove, and/or assign alerts for possible risk compounds of liver injury at all stages of the drug development process. The bile salt export pump (BSEP) is localized on the apical side of the hepatocyte plasma membrane, where it plays a major role in the excretion of bile acids (BAs) from the liver into the bile.3 Several genetic mutations of BSEP are associated with progressive familial intrahepatic cholestasis type 2 (PFIC2), causing severe intracellular accumulation of BAs within the liver.4 Such BA accumulation is suggested as an underlying mechanism of cholestatic DILI,5-8 and therefore, BSEP dysfunction is quite likely related to liver injury. Moreover, multidrug resistance-associated proteins 3 and 4 (MRP3 and MRP4) are additional BA efflux transporters localized on the basal side of the hepatocyte membrane,9-11 which seemingly protect hepatocytes from intracellular accumulation of toxic BAs when BSEP function is abolished or compromised.12-16 In fact, most drugs causing cholestatic DILI also potently inhibit BSEP, MRP3, and MRP4.17-22 Hence, the function of these BA efflux transporters is essential for the regulation/dysregulation of hepatic BA content.

http://dx.doi.org/10.1016/j.xphs.2016.01.013 0022-3549/© 2016 American Pharmacists Association®. Published by Elsevier Inc. All rights reserved.

2

T. Susukida et al. / Journal of Pharmaceutical Sciences xxx (2016) 1e11

We recently used sandwich-cultured rat hepatocytes (SCRHs) to construct an in vitro BA-dependent hepatocyte toxicity assay system to mimic cholestatic DILI.23,24 Recognized potent BSEP inhibitors, as well as inhibitors of MRP3, MRP4, and other basal BA efflux transporters, induced BA-dependent hepatocyte toxicity in SCRHs; we also observed the influence of cytochrome P450emediated drug metabolism on BA-dependent drug toxicity.24,25 Furthermore, our toxicity assay system successfully predicted the risk of cholestatic DILI in both SCRHs and sandwichcultured human hepatocytes (SCHHs),26 which is important for applicability of the assay to studies of human medicine. Nevertheless, the use of primary human hepatocytes is hampered by their limited availability, high associated costs, and lot-to-lot variability. The latter can lead to misestimated results and decreased prediction accuracy. Indeed, some drugs (i.e., clopidogrel, leflunomide, and ticlopidine) showed lot-to-lot variation for BAdependent hepatocyte toxicity in SCHHs and underestimated the frequency of in vivo serum test abnormalities.26 Accordingly, the importance of an established alternative cell source to primary human hepatocytes is now increasingly recognized. To overcome the shortcomings of SCHHs, a unique hepatic stem cell line, HepaRG, was recently developed. HepaRG cells express features of mature hepatocytes, including typical bile canaliculi.27-30 These cells also show permanent proliferation at the progenitor cell stage, yet stably express mRNAs for P450 enzymes, phase II enzymes, transporters, and nuclear transcription factors, in contrast to other human hepatoma cell lines (e.g., HepG2).27 Several studies have demonstrated that chlorpromazine and cyclosporine A (CsA) can inhibit BA efflux and uptake in HepaRG cells,28,29 whereas other work has demonstrated high bile canaliculi contraction/relaxation activity in these cells.30 In light of these observations, we propose that HepaRG cells might provide a suitable alternative model to SCHHs for the investigation of hepatobiliary transporter actions and drug-induced cholestasis. The present study focused on the utility of HepaRG cells in our sandwich culture toxicity assay system. CsA, glibenclamide (Glib), and valproic acid (Valp) were chosen as prototypical test compounds because they showed strong, moderate, and nonexistent BA-dependent hepatocyte toxicity toward SCRHs, respectively, in our earlier work.24 HepaRG cells were compared with SCHHs as a positive control and HepG2 cells as a negative control for the capacity to predict cholestatic DILI risk. BA-dependent toxicity, biliary BA efflux, and mRNA expression levels of efflux and uptake BA transporters were first evaluated in each cell type. Next, in vitro toxicity data were generated for 22 selected drugs in HepaRG and HepG2 cells, and the data were correlated with increases in the clinical frequency of serum DILI markers (i.e., alkaline phosphatase and transaminases).26 Our results now indicate that HepaRG cells can serve as a useful preclinical screening tool to predict the risk of drug-induced liver damage. Experimental Procedures Materials BAs and test compounds were purchased from Wako Pure Chemical Industries, Ltd. (Osaka, Japan), Sigma-Aldrich (St. Louis, MO), or Calbiochem (Darmstadt, Germany). Williams' Medium E (WME), antibioticeantimycotic solution, and GlutaMAX™ were purchased from Invitrogen (Carlsbad, CA). Dulbecco's modified Eagle's medium and insulin were purchased from Sigma-Aldrich. Matrigel and human insulin/transferrin/sodium selenite Premix Culture Supplement were purchased from BD Biosciences (San Jose, CA). Collagenase and dexamethasone were purchased from Wako Pure Chemical Industries, Ltd. [3H]taurocholic acid (TC) (5 Ci/mmol)

was purchased from Perkin-Elmer (Waltham, MA). All other chemicals and solvents were of analytical grade, unless otherwise noted. Cell Culture Tissue culture (24- or 96-well) plates were precoated with type 1 collagen (BD Biosciences) at least 1 h before the preparation of hepatocyte cultures. Cryopreserved human hepatocytes (Lot IZT; Celsis, Baltimore, MD) and HepaRG cells (Biopredic International, Rennes, France) were thawed and seeded according to the manufacturer's protocol, as follows. Thawed hepatocytes were dispersed in CHRM® medium (Life Technologies, Grand Island, NY) at 37 C. The cells were centrifuged at 100  g for 10 min at room temperature and resuspended in plating medium consisting of WME plus 5% fetal bovine serum, 0.1 mM dexamethasone, 4 mg/L insulin, 2 mM GlutaMAX™, 15 mM HEPES, pH 7.4, penicillin (100 units/mL), and streptomycin (100 mg/mL). Next, the hepatocytes were seeded onto collagen (1.5 mg/mL, pH 7.4)ecoated 96-well plates at a density of 0.48  105 cells per well. SCHHs were prepared as previously described.26 At 4 h after seeding, the medium was aspirated, and the hepatocytes were overlaid with Matrigel (0.25 mg/mL) dissolved in ice-cold culture medium consisting of WME plus 1% human insulin/transferrin/ sodium selenite, 0.1 mM dexamethasone, 2 mM GlutaMAX™, penicillin (100 units/mL), and streptomycin (100 mg/mL). The medium (WME) was changed daily until 5 days after cell seeding. For HepaRG cells, thawed cells were dispersed in Basal Hepatic Cell Medium plus HepaRG Thaw, Seed, and General Purpose Supplement (Medium 670; Biopredic International) at 37 C. The cells were centrifuged at 360  g for 2 min at room temperature and resuspended in Medium 670. The HepaRG cells were then seeded onto collagen (1.5 mg/mL, pH 7.4)ecoated 24- or 96-well plates at a density of 4.8  105 or 0.72  105 cells per well, respectively. At 24 h after seeding, the medium was aspirated and replaced with Basal Hepatic Cell Medium plus HepaRG Maintenance Metabolism Supplement (Medium 620; Biopredic International). The medium (Medium 620) was changed daily until 7 days after cell seeding. HepG2 cells were seeded onto collagen (1.5 mg/mL, pH 7.4)e coated 24- or 96-well plates at an initial density sufficient to yield approximately 15% confluence and cultured with Dulbecco's modified Eagle's medium plus 10% fetal bovine serum, penicillin (100 units/mL), and streptomycin (100 mg/mL) until they reached approximately 90% confluence. SCHHs, HepaRG, and HepG2 cells were all maintained at 37 C in a humidified atmosphere of 95% air/ 5% CO2. Assessment of BA-Dependent Cell Toxicity SCHHs, HepaRG and HepG2 cells were exposed to each test compound in the presence or absence of a BA mixture containing the 12 different BAs listed in Table 1. Test compounds were dissolved in dimethyl sulfoxide (DMSO) vehicle (final concentration of DMSO <0.5%). After 24 h, the activity of lactate dehydrogenase (LDH) released from damaged cells (LDHsample) was measured using the LDH-Cytotoxic Test (Takara Bio Inc., Shiga, Japan). Cell toxicity was expressed as a percentage of maximum LDH activity (LDHTriton X-100) measured in Triton X-100esolubilized lysates of control cells. The following equation was used:

Cell toxicity
 ¼ LDHsample  LDHblank ðLDHTriton X100  LDHblank Þ  100 LDHblank was determined from the LDH sample of untreated cells.

T. Susukida et al. / Journal of Pharmaceutical Sciences xxx (2016) 1e11 Table 1 BA Concentrations Used in the Cell Toxicity Assay, Determined With Reference to the Standard BA Constituents of Human Serum49 Bile Acid

Concentration (mM)

Cholic acid (CA) Chenodeoxycholic acid (CDCA) Glycochenodeoxycholic acid (GCDCA) Deoxycholic acid (DCA) Lithocholic acid (LCA) Ursodeoxycholic acid (UDCA) Glycocholic acid (GCA) Glycodeoxycholic acid (GDCA) Taurocholic acid (TC) Taurochenodeoxycholic acid (TCDCA) Taurolithocholic acid (TLCA) Tauroursodeoxycholic acid (TUDCA) Total

0.20 0.34 1.71 0.73 0.03 0.11 0.41 0.38 0.048 0.21 0.087 0.29 4.55

Gene

Primer Sequence: 50 / 30

Produced Fragment (bp)

BSEP

Forward: TGATCCTGATCAAGGGAAGG Reverse: TGGTTCCTGGGAAACAATTC Forward: GTCCGCAGAATGGACTTGAT Reverse: TCACCACTTGGGGATCATTT Forward: GCTCAGGTTGCCTATGTGCT Reverse: CGGTTACATTTCCTCCTCCA Forward: GGGACATGAACCTCAGCATT Reverse: CGTTTGGATTTGAGGACGAT Forward: TGGGGAACTTTGAAATGTGG Reverse: AAGGCTGGAACAAAGCTTGA Forward: GCCCAAGAGATGATGCTTGT Reverse: ATTGAGTGGAAACCCAGTGC Forward: GGGTGAATGCCCAAGAGATA Reverse: ATTGACTGGAAACCCATTGC Forward: TGATTGGCTATGGGGCTATC Reverse: CATATCCTCAGGGCTGGTGT Forward: TTCAACACCCCAGCCATGTACG Reverse: GTGGTGGTGAAGCTGTAGCC

100

MRP4 NTCP OATP1A2 OATP1B1 OATP1B3 OATP2B1

b-actin

Biliary Efflux of [3H]TC in HepaRG and HepG2 Cells Accumulationstandard and AccumulationCa2þ =Mg2þ free represent the TC content in (cells þ bile) and (cells), respectively. As mentioned earlier, test compounds were dissolved in DMSO vehicle (final concentration of DMSO <0.5%). Biliary efflux was evaluated using the biliary excretion index (BEI) method, as reported previously.31 Cells were washed twice with warm standard Hank's balanced salt solution (HBSS, 0.5 mL) and preincubated for 15 min with 10 mM CsA, 50 mM Glib, 50 mM Valp, or vehicle (DMSO) dissolved in standard or Ca2þ/Mg2þ-free HBSS. Next, the medium was removed and incubated for 10 min with standard or Ca2þ/Mg2þfree HBSS (0.5 mL) plus [3H]TC (1 mM) and 10 mM CsA, 50 mM Glib, 50 mM Valp, or vehicle (DMSO). The medium was aspirated, and the cells were washed 3 times with ice-cold standard HBSS and lysed with 1% (vol/vol) Triton X-100 (0.5 mL). All samples were quantified using an LSC-6100 Liquid Scintillation Counter (Hitachi Aloka Medical, Tokyo, Japan), and the bicinchoninic acid protein assay was used to normalize protein content. The biliary efflux ratio was calculated using the BEI calculation formula, as follows:

BEIð%Þ ¼

Table 2 Primers Used for qPCR

MRP3

BA, bile acid.

Accumulationstandard  AccumulationCa2þ =Mg2þ free Accumulationstandard

 100

RNA Isolation and Quantitative Real-Time Polymerase Chain Reaction Total RNA was isolated from SCHHs, HepaRG cells, HepG2 cells, and primary human hepatocytes using the RNA-Solv™ reagent (Omega Bio-tek, Inc., Norcross, GA). Total RNA (1 mg) was reverse transcribed, and the resultant cDNA (equivalent to 40 ng of total RNA) was mixed with nuclease-free water and THUNDERBIRD™ quantitative real-time PCR mix (Toyobo Co., Ltd., Osaka, Japan). The mixture was subjected to quantitative real-time PCR using an LightCycler™ Nano Real-Time PCR System (Roche Diagnostics K.K., Tokyo, Japan) under the following thermal cycler conditions: 1 min at 95 C (activation), 40 cycles of denaturation at 95 C for 15 s, annealing at 55 C for 15 s, and extension at 72 C for 30 s. Primer sequences used for each transporter are listed in Table 2. Relative mRNA expression levels were calculated after normalizing to b-actin mRNA levels using LightCycler™ Nano Real-Time PCR Software. Statistical Analyses Statistical analyses were performed using GraphPad Prism 6 Software (GraphPad Software, Inc., La Jolla, CA). The significance of

3

120 100 199 119 160 168 107 230

BSEP, bile salt export pump; MRP, multidrug resistance-associated protein; NTCP, Naþ-taurocholate co-transporting polypeptide; OATP, organic anion-transporting polypeptide; qPCR, quantitative real-time PCR.

differences between vehicle (DMSO) and test compound treatment in HepaRG and HepG2 cells (see Fig. 2) was determined using Dunnett test for multiple comparisons following 1-way ANOVA. Analysis of correlation was performed by Pearson correlation method. In all cases, p values < 0.05 were considered statistically significant. Results Estimation of BA-Dependent Toxicity in SCHHs, HepaRG, and HepG2 Cells We previously reported that both SCRHs and SCHHs were good testing materials to predict the clinical risk of cholestatic DILI in the context of our BA-dependent hepatocyte toxicity assay.24,25 To determine the utility of HepaRG cells in this assay system, 3 test compounds (10 mM CsA, 50 mM Glib, and 50 mM Valp) were initially assessed for cytotoxicity toward HepaRG and HepG2 cells relative to SCHHs in the presence of a standard BA mixture (Table 1) containing various components at 0- to 250-fold their concentration in standard human serum (Fig. 1). The cytotoxicity of the BA mixture itself toward SCHHs was noted at a concentration of 100-fold and increased thereafter in a concentration-dependent manner (Figs. 1a-1c; open circles). HepaRG cells were less susceptible to BAinduced toxicity compared with SCHHs; the cytotoxicity of the BA mixture was first observed at a concentration of 200-fold, but it was <10% at any concentration used here (Figs. 1d-1f; open circles). In contrast, HepG2 cells were more sensitive to BA-induced toxicity than SCHHs; cytotoxicity toward these cells was first observed at a concentration of 50-fold and reached a plateau at 150-fold (Figs. 1g1i; open circles). In all cell types, 10 mM CsA exacerbated the cytotoxicity of the BA mixture (Figs. 1a, 1d, and 1g; closed circles), whereas the drug showed minimal toxicity by itself (see data for BA-dependent drug toxicity at a BA concentration of 0-fold). The cytotoxicity of the BA mixture was extremely strong at a concentration of 250-fold toward SCHHs and >125-fold toward HepG2 cells (almost hitting the toxicity ceiling of 100%). Therefore, BA-dependent CsA toxicity was not clearly observed at these BA concentrations. Neither Glib nor Valp at 50 mM was cytotoxic toward any of the cell types in the absence or presence of the BA mixture at any concentration (Figs. 1b, 1c, 1e, 1f, 1h, and 1i).

4

T. Susukida et al. / Journal of Pharmaceutical Sciences xxx (2016) 1e11

Figure 1. BA-dependent toxicity in the absence or presence of test compounds. SCHHs (lot IZT) (a-c), HepaRG (d-f), and HepG2 cells (g-i) were incubated with test compounds (closed circles) or vehicle (DMSO; open circles) for 24 h in the presence of various concentrations of BAs, corresponding to human serum contents. Cell toxicity was calculated using LDH leakage based on the equation described in the Experimental Procedures section. Each data point represents the mean ± SD (n ¼ 3 triplicate samples in a single preparation).

Assessment of Biliary [3H]TC Efflux in HepaRG and HepG2 Cells We next examined the biliary efflux ratio of [3H]TC, a typical substrate of BSEP, in HepaRG and HepG2 cells. Biliary [3H]TC efflux was determined using the BEI method (Fig. 2). The uptake of [3H]TC

in control HepaRG cells was 27.4 ± 5.1 pmol/mg protein/10 min, and the calculated BEI value of [3H]TC was 38.5 ± 5.8% (Fig. 2a and Table 3). Among 3 test compounds (CsA, Glib, and Valp), CsA at 10 mM and Glib at 50 mM inhibited [3H]TC uptake (Fig. 2a). CsA tended to reduce the BEI value to 19.2 ± 14% (46.5% of control

Figure 2. Inhibitory effects of 10 mM CsA, 50 mM Glib, and 50 mM Valp against biliary [3H]TC efflux in HepaRG (a) or HepG2 cells (b). Cells were preincubated with test compounds or vehicle (DMSO) dissolved in warm standard HBSS (cells þ bile; closed bars) or Ca2þ/Mg2þ-free HBSS (cells; open bars) for 15 min. Next, the medium was removed and incubated with [3H]TC (1 mM) plus test compounds or vehicle (DMSO) for 10 min at 37 C. Accumulation of [3H]TC was quantified using a liquid scintillation counter. Each bar represents the mean ± SD (n ¼ 4-6, duplicate or triplicate samples from 2 preparations).

T. Susukida et al. / Journal of Pharmaceutical Sciences xxx (2016) 1e11 Table 3 Summary of BEI Values and Inhibitory Effects of CsA, Glib, and Valp in HepaRG and HepG2 Cells Variable

Compounds Control

HepaRG cells BEI (%) 38.5 ± 5.8 p value HepG2 cells BEI (%) 10.5 ± 14 p value

CsA (10 mM)

Glib (50 mM)

Valp (50 mM)

19.2 ± 14 0.07

39.5 ± 9.6 0.99

41.7 ± 12 0.95

14.4 ± 8.6 0.83

16.1 ± 17 0.69

N.D.

p values indicate the probability of significant differences between treatment with vehicle (DMSO) and treatment with test compounds. BEI, biliary excretion index; CsA, cyclosporine A; Glib, glibenclamide; N.D., not detected; Valp, valproic acid.

HepaRG cells), but the decrease was not significant (p ¼ 0.07) (Table 3). Contrarily, neither 50 mM Glib nor Valp had any effect on biliary [3H]TC efflux (Fig. 2a and Table 3). In HepG2 cells, both the uptake of [3H]TC and the BEI value were low, at 6.5 ± 0.9 pmol/mg protein/10 min and 10.5% ± 14%, respectively (Fig. 2b and Table 3). None of the test compounds had a significant effect on the BEI in HepG2 cells (Table 3). Expression Levels of BA Efflux and Uptake Transporter mRNAs in SCHHs, HepaRG, and HepG2 Cells At present, several studies have compared mRNA expression levels of BA efflux and uptake transporters in HepaRG cells with cryopreserved human hepatocytes or HepG2 cells.27,32,33 However,

5

no comparisons have been made between HepaRG cells and SCHHs. Therefore, we first confirmed transporter mRNA expression levels in SCHHs, both before seeding onto culture plates (day 0) and on day 5 in culture and in HepaRG on day 7 and confluent HepG2 cells (Fig. 3). The mRNA expression level of MRP4 was increased by 310% in SCHHs after 5 days in culture (Fig. 3c). In contrast, BSEP and MRP3 mRNA levels were decreased to 17.9% and 39.3% of their levels on day 0, respectively (Figs. 3a and 3b). However, the mRNA expression levels of Naþ-taurocholate cotransporting polypeptide (NTCP) and organic anion-transporting polypeptide 1B1 (OATP1B1), which are jointly responsible for BA uptake in human hepatocytes,34 were maintained at 82.5% and 86.1%, respectively. On the other hand, OATP1A2, OATP1B3, and OATP2B1 mRNA levels were decreased to 2.3%, 7.0%, and 23.7% of their levels on day 0, respectively (Figs. 3d-3h). All mRNA expression levels of the BA transporters tested here (except for MRP4) were lower in HepaRG and HepG2 cells than in primary human hepatocytes (<15%). Next, we compared the mRNA expression levels of BA efflux and uptake transporters in HepaRG cells on day 7 and confluent HepG2 cells versus those in SCHHs on day 5. Extremely low BSEP mRNA expression levels were observed in HepaRG cells (0.2% of the level in SCHHs), whereas MRP3 and MRP4 mRNA expression levels were 15.0% and 50.5%, respectively, of the values in SCHHs. The mRNA expression levels of NTCP and OATP1B1, both major BA uptake transporters, were 0.9% and 2.2% of the values in SCHHs, whereas the mRNA expression levels of other uptake transporters were higher, at 26.7%-70.0%. In HepG2 cells, BSEP mRNA was not detected, and the mRNA levels of other BA transporters were lower than those in HepaRG cells (<15%).

Figure 3. Expression levels of mRNA for BA efflux (a-c) and uptake (d-h) transporters in SCHHs (Lot IZT) on day 5 of culture (open bars), HepaRG cells on day 7 of culture (closed bars), and confluent HepG2 cells (shaded bars) versus primary human hepatocytes on day 0 of culture (before cell seeding onto culture plates). The mRNA expression levels in primary hepatocytes on day 0 were set to 100%, indicated by the horizontal dotted lines. Total RNA (1 mg) was reverse transcribed, and the resulting cDNAs were subjected to quantitative real-time PCR analysis. Relative mRNA expression levels were calculated after normalization to that of b-actin. Each bar represents the mean ± SD (n ¼ 1 for SCHHs; n ¼ 3 for HepaRG cells; n ¼ 3 for HepG2 cells). N.D., not detected.

6

T. Susukida et al. / Journal of Pharmaceutical Sciences xxx (2016) 1e11

Evaluation of BA-Dependent Drug Toxicity in HepaRG and HepG2 Cells

Prediction of Clinical DILI Risk From In Vitro Data in HepaRG and HepG2 Cells

We recently used a set of test drugs to demonstrate that the SCHH-based toxicity assay can successfully predict the risk of cholestatic DILI and, particularly, the increased frequency of serum DILI markers (alkaline phosphatase and transaminases) in clinical situations.26 To determine whether these findings extend beyond primary hepatocytes, we next assessed the cytotoxic actions of the same set of test drugs (n ¼ 22 compounds; Table 4) in HepaRG and HepG2 cells. The concentrations of all drugs were fixed to 50 mM, except for that of CsA, which was used at 10 mM. The BA mixture was also used at concentrations of 250-fold (HepaRG cells) and 50fold (HepG2 cells), where 20%-30% basal toxicity was observed (Figs. 1d-1i). All drugs showed minimal cytotoxicity toward HepaRG cells in the absence of the BA mixture, except for amiodarone (Fig. 4a). Drug toxicities were more or less enhanced by the presence of the BA mixture at 250-fold (Fig. 4a). Similarly, the drugs showed minimal toxicity toward HepG2 cells in the absence of BAs, again expect for amiodarone. However, BA-dependent drug toxicity was observed for several of the test compounds (i.e., CsA, simvastatin, and tacrolimus) in the presence of the 50-fold BA mixture (Fig. 4b).

To evaluate whether the in vitro toxicity data in HepaRG and HepG2 cells reflected the clinical risk of cholestatic DILI, the relationships between in vitro findings and in vivo clinical data (see Table 4) were examined. Clinical increases in serum markers of 1.0% were used to separate drugs into low- and high-risk groups. Most of the drugs with lower risk showed minimal in vitro BA-dependent drug toxicity toward HepaRG and HepG2 cells, whereas those with higher risk showed enhanced BAdependent toxicity (Fig. 6). A receiver-operating characteristic analysis was performed to separate high and low DILI risk drugs by the in vitro toxicity data. The sensitivity was at most 50.0%56.3% in both cell types, and the specificity was 66.7%-88.3% (Supplemental Table 1). Regardless, the prediction accuracy obtained in HepaRG cells was poorer than those previously reported using SCHHs (43.8%-50.0% sensitivity and 66.7%-88.3% specificity in Hu1437, 68.8%-70.0% sensitivity and 83.3% specificity in Hu1524, and 80.0% sensitivity and 75.0%-85.7% specificity in Hu4197).26

Comparison of HepaRG/HepG2 Cell and SCHH Toxicity Data

We initially proposed an established SCHH-based toxicity assay as useful for the comprehensive evaluation of cholestatic DILI-risk compounds because the assay system included certain molecular players related to BA disposition (e.g., metabolic enzymes and BA efflux transporters other than BSEP).24,25 In fact, the assay recently successfully predicted the cholestatic DILI risk of 22 selected drugs.26 However, in our previous study, certain drugs (i.e., clopidogrel, leflunomide, and ticlopidine) showed hepatocyte lotdependent variation in their cytotoxic actions, raising the concern that prediction accuracy might be influenced by a particular primary hepatocyte preparation. The limited availability and high associated costs of primary human hepatocytes are additional

Next, correlation analyses of BA-dependent drug toxicities toward each cell type were performed for the 22 selected drugs (Fig. 5). Consequently, a positive correlation was observed between HepaRG cells and SCHHs (Fig. 5a: y ¼ 0.9077x þ 6.850, R2 ¼ 0.7870, p < 0.0001; Fig. 5b: y ¼ 0.6525x þ 2.525, R2 ¼ 0.7397, p < 0.0001; and Fig. 5c: y ¼ 0.5592x þ 4.598, R2 ¼ 0.5833, p < 0.0001). Contrarily, the correlation between HepG2 cells and SCHHs was relatively weak (Fig. 5d: y ¼ 0.6344x þ 3.285, R2 ¼ 0.3115, p ¼ 0.007; Fig. 5e: y ¼ 0.4535x  0.4437, R2 ¼ 0.3347, p ¼ 0.005; and Fig. 5f: y ¼ 0.3573x þ 2.462, R2 ¼ 0.1930, p ¼ 0.041).

Discussion

Table 4 List of the Drugs Used in the Study and Their In Vivo Profiles and In Vitro Toxicity Toward Each Cell Type No.

Drug

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22

Amiodarone Atorvastatin Carbamazepine Clopidogrel Cyclosporine A Everolimus Famotidine Fexofenadine Flutamide Lamivudine Leflunomide Levofloxacin Losartan Methotrexate Pioglitazone Pravastatin Rosuvastatin Simvastatin Tacrolimus Ticlopidine Tranilast Voriconazole

Frequency of Serum Marker Increase (%)a ALP 0.22 1.26 5.54 2.87 1.53 2.00 0.065 0.013 3.14 1.23 5.21 0.041 0.029 0.55 0.48 0.13 0.20 0.22 1.07 0.15 0.13 7.00

(3/1352) (72/5702) (18/325) (65/2268) (112/7300) (25/1247) (13/20,137) (1/7838) (201/6393) (40/3253) (19/365) (13/31,810) (11/36,288) (22/4038) (23/4776) (15/11,137) (18/8997) (23/10,420) (107/10,038) (12/7933) (32/24,788) (7/100)

HepaRG Cells Toxicity (%)b

Transaminases

() BA

1.63 5.28 12.2 9.17 2.47 11.6 0.39 0.24 26.5 2.55 6.58 0.35 0.21 1.61 2.34 1.08 1.45 1.35 2.32 0.73 0.33 13.0

51.3 1.8 1.9 2.1 6.6 6.5 1.5 4.6 0.2 3.0 0.8 1.2 0.7 2.7 0.0 0.0 0.3 0.3 15.8 3.5 0.0 0.0

(22/1352) (301/5702) (41/335) (208/2268) (180/7300) (145/1247) (78/20,137) (19/7838) (1692/6393) (83/3253) (24/365) (111/31,810) (76/36,288) (65/4038) (112/4776) (120/11,137) (130/8997) (141/10,420) (233/10,038) (58/7933) (81/24,788) (13/100)

± ± ± ± ± ± ± ± ± ± ± ± ± ± ± ± ± ± ± ± ± ±

HepG2 Cells Toxicity (%)b

(þ) BA 1.4 0.4 0.9 1.6 0.8 2.7 2.6 3.3 0.5 2.2 0.4 1.4 0.4 3.0 1.4 1.8 0.8 1.0 3.0 2.0 0.9 0.9

48.0 22.3 1.6 12.2 51.0 51.4 0.0 19.9 33.8 8.4 5.8 13.2 0.0 14.6 0.0 0.0 0.0 28.0 49.8 17.0 0.0 0.0

± ± ± ± ± ± ± ± ± ± ± ± ± ± ± ± ± ± ± ± ± ±

() BA 3.9 5.3 16.1 4.4 4.2 1.4 9.4 4.6 2.9 6.6 7.9 1.9 2.1 9.6 3.8 0.9 2.2 7.4 3.4 2.8 6.6 16.6

29.7 3.0 2.1 3.2 2.2 1.0 2.4 1.2 0.0 0.0 0.0 0.4 1.0 5.6 0.3 0.2 2.6 16.0 12.2 1.0 0.0 0.0

± ± ± ± ± ± ± ± ± ± ± ± ± ± ± ± ± ± ± ± ± ±

(þ) BA 3.8 4.2 0.3 0.5 2.9 1.3 0.8 0.9 0.8 0.3 2.3 0.9 1.4 1.4 0.6 0.7 0.5 3.4 8.6 0.5 0.2 0.2

54.2 5.2 0.0 6.5 29.0 11.6 0.0 0.0 0.0 0.0 0.3 0.0 0.0 1.1 0.0 0.0 0.0 58.3 63.7 0.5 0.0 0.0

± ± ± ± ± ± ± ± ± ± ± ± ± ± ± ± ± ± ± ± ± ±

2.4 5.4 1.7 2.2 13.6 6.5 0.4 4.4 1.3 1.5 3.1 2.2 0.6 1.3 1.2 2.3 1.1 16.4 11.9 1.9 0.6 1.1

ALP, alkaline phosphatase; BA, bile acid. a The frequencies of serum marker abnormalities were calculated based on data included in interview forms.26 Values for the (number of cases with serum test abnormalities)/(number of patients enrolled in clinical studies in Japan) are shown at the right of each percentage. b Cell toxicity (LDH release) in the absence (() BA) or presence ((þ) BA) of the BA mixture, given as the mean ± the SD. Basal toxicity obtained in the absence of each drug was subtracted to yield the values shown here.

T. Susukida et al. / Journal of Pharmaceutical Sciences xxx (2016) 1e11

7

Figure 4. In vitro toxicity of selected drugs toward HepaRG (a) and HepG2 cells (b) in the absence or presence of the BA mixture. HepaRG cells were cultured for 7 days, whereas HepG2 cells were cultured until they reached approximately 90% confluence. Cells were treated with CsA (10 mM) or other test drugs (50 mM) in the absence (open bars) or presence (closed bars) of the BA mixture (250-fold concentration for HepaRG cells; 50-fold concentration for HepG2 cells). The basal toxicities in the absence and presence of the BA mixture were obtained and subtracted (41.8%, the mean of 38.6% and 44.9%; n ¼ 2) in HepaRG cells and 13.4 ± 2.7% (the mean ± the SD; n ¼ 3) in HepG2 cells, respectively, from the corresponding data obtained in the presence of test drugs. Data are given as the means ± SD (n ¼ 3 for HepaRG cells; n ¼ 3-6 for HepG2 cells).

concerns. Therefore, an alternative cellular tool to SCHHs is desired for drug development investigations. Here, we assessed the utility of the HepaRG human hepatic stem cell line in our toxicity assay system. This cell line has received increasing attention as a promising model for the study of hepatobiliary transporters and drug-induced cholestasis.28-30,35 Among the 3 initially tested compounds (CsA, Glib, and Valp), only CsA at 10 mM showed BA-dependent toxicity toward HepaRG cells (Figs. 1d-1f), reminiscent of the drug toxicity results in SCHHs (Figs. 1a-1c). Consistently, biliary [3H]TC efflux from HepaRG cells was blocked by 10 mM CsA, whereas the other 2 drugs failed to show any inhibitory effects (Fig. 2a and Table 3). Because a previous study reported that 24-h treatment with 10 mM CsA did not affect BSEP mRNA expression levels in HepaRG cells,29 direct inhibition of biliary BA efflux and intracellular accumulation of BAs (Supplemental Figure 1) might be the underlying mechanism for BA-dependent cell toxicity in HepaRG cells. Moreover, BAdependent toxicities of 22 drugs tested in HepaRG cells correlated well with the toxicities observed in SCHHs (Figs. 4a and 5a-5c). These findings imply that HepaRG cells are appropriate for the evaluation of BA-dependent toxicity stemming from the inhibition of biliary BA efflux. An apparently similar toxicity profile was observed in HepG2 cells; as in HepaRG cells, only 10 mM CsA exhibited BA-dependent toxicity (Figs. 1g-1i). However, these data are difficult to explain based on the inhibition of BA efflux transporters because the BEI value for HepG2 cells was approximately 10%, and none of the test drugs exerted significant inhibitory actions against biliary [3H]TC efflux (Fig. 2b and Table 3). Moreover, BA-dependent toxicities of

the 22 selected drugs in HepG2 cells were poorly correlated with those in SCHHs (Figs. 4b and 5d-5f). Therefore, HepG2 cells may not be suitable to our assay system. The accumulation of [3H]TC was not observed in the presence of 10 mM CsA-treated HepaRG cells (Fig. 2a) because CsA was known to inhibit uptake transporters of [3H]TC (i.e., NTCP and OATP).36 However, when unconjugated BA (e.g., [14C]-labeled chenodeoxycholic acid ([14C]CDCA)) was used as a substrate, such uptake inhibition was not observed and significant increase of [14C]CDCA cellular accumulation by cholestatic drugs could be evaluated.37 Therefore, we hypothesized that BA species other than TC might be accumulated in cytotoxic drug-treated HepaRG cells and induced BA-dependent toxicity because the uptake clearance mediated by NTCP was taurine-conjugated BA species greater than the unconjugated BA species.38 To prove this concept, we incubated HepaRG cells with 10 BA species (other than TC and lithocholic acid) for 15 min and measured the intracellular amount in drug-treated or untreated HepaRG cells using LC-MS/MS system (Supplemental Fig. 1). We tested 2 drug groups: (1) 5 drugs (50 mM atorvastatin, 10 mM CsA, 50 mM everolimus, 50 mM flutamide, and 50 mM simvastatin) that showed BA-dependent cell toxicity but did not show cell toxicity in the absence of BAs, and (2) 2 drugs (50 mM carbamazepine and 50 mM tranilast) that did not show BAdependent hepatocyte toxicity in HepaRG cells. As a result, cytotoxic drugs (group 1) except 50 mM flutamide significantly increased the intracellular amount of BAs in HepaRG cells, whereas noncytotoxic drugs (group 2) did not elevate intracellular amount of any BA species in HepaRG cells (Supplemental Fig. 1). On the other hand, CsA-induced BA accumulations were not

8

T. Susukida et al. / Journal of Pharmaceutical Sciences xxx (2016) 1e11

Figure 5. Comparison of in vitro BA-dependent drug toxicities toward HepaRG (a-c) and HepG2 cells (d-f) versus SCHHs (Lots Hu1437, Hu1524, and Hu4197). Original data are shown in Figure 4 (HepaRG and HepG2 cells) and our previous report (SCHHs).26 A positive correlation was observed between HepaRG cells and SCHHs (a: y ¼ 0.9077x þ 6.850, R2 ¼ 0.7870, p < 0.0001; b: y ¼ 0.6525x þ 2.525, R2 ¼ 0.7397, p < 0.0001; and b: y ¼ 0.5592x þ 4.598, R2 ¼ 0.5833, p < 0.0001), whereas the correlation was weak between HepG2 cells and SCHHs (d: y ¼ 0.6344x þ 3.285, R2 ¼ 0.3115, p ¼ 0.007; e: y ¼ 0.4535x  0.4437, R2 ¼ 0.3347, p ¼ 0.005; and f: y ¼ 0.3573x þ 2.462, R2 ¼ 0.1930, p ¼ 0.041).

observed in HepG2 cells (Supplemental Fig. 2) and it was consistent with the result of BEI in HepG2 cells (Fig. 2b). Hence, these results suggested that the damage of HepaRG cells by the cytotoxic drugs (except flutamide) was at least partly caused by the excessive intracellular accumulation of BAs, and such mechanism could not be evaluated in HepG2 cells. Moreover, some unconjugated BAs (i.e., CDCA and DCA) were significantly more accumulated in HepaRG cells only when strong cytotoxic drugs (i.e., CsA and everolimus) were exposed (Supplemental Fig. 1). Given that DCA was reported as cytotoxic BA species against HepaRG cells39 (CDCA was not tested in that study), intracellular accumulation levels of these unconjugated BA species might determine the extent of cell toxicity in HepaRG cells. Unexpectedly, 50 mM flutamide did not elevate intracellular amount of any BA species in HepaRG cells (Supplemental Fig. 1). According to the previous study, flutamide did not show inhibitory effect against BSEP and other BA efflux transporters (i.e., MRP3 and MRP4).22 Therefore, a different mechanism other than inhibition of BA efflux transporters might be underlying in flutamide-induced BA-dependent cell toxicity. As we could not observe pharmacologic interaction of flutamide and BAs in short term (15 min incubation), long-term effect against BSEP dysfunction (such as downregulation of BSEP expression40) might underlie. Further investigations are needed to answer this question.

The mRNA expression levels of some transporters (i.e., BSEP, NTCP, and OATP1B1) were lower in HepaRG cells than in SCHHs (Figs. 3a, 3d, and 3f). Other research groups previously reported good [3H]TC uptake in SCHHs (150-200 pmol/mg protein/10 min), with a calculated BEI value of approximately 75%.30,41,42 In contrast, we observed relatively low [3H]TC uptake and BEI values in HepaRG cells (Fig. 2a), consistent with the mRNA expression analysis. Moreover, a relatively high concentration of BAs (250-fold of the standard human serum BA mixture) was required to induce BAdependent toxicity in HepaRG cells (Figs. 1d-1f), as opposed to only 100-fold for SCHHs (Figs. 1a-1c). Although the HepaRG cell findings might be explained by low BA transporter mRNA content relative to SCHHs, the mRNA expression of CYP enzymes, nuclear receptors, and BA transporters is reportedly higher in HepaRG versus HepG2 cells.27 The same tendency was observed for BA efflux and uptake transporters in the present study (Fig. 3). We also failed to detect BSEP mRNA expression in HepG2 cells, in agreement with the low [3H]TC BEI value in these cells (Figs. 2b and 3a). In the present study, [3H]TC BEI was still partially maintained in HepaRG cells (Fig. 2a), but it was much higher than expected from the low BSEP mRNA expression level compared with SCHHs (Fig. 3a). Therefore, it was possible to consider that the protein level of BSEP might be maintained in HepaRG cells than its mRNA level. Previous studies may support this hypothesis: (1) BSEP molecules

T. Susukida et al. / Journal of Pharmaceutical Sciences xxx (2016) 1e11

9

Figure 6. Relationship between the frequency of serum marker increases in vivo and BA-dependent drug toxicity in vitro. The frequency of increases in the serum levels of ALP (a and b) and transaminases (c and d) are shown in comparison with in vitro drug toxicities toward HepaRG (a and c) and HepG2 (b and d) cells. The vertical dotted lines represent the borderline frequencies of 1%. Drug numbers correspond to those listed in Table 4.

reside in intrahepatic compartments and can be delivered to the canalicular domain after increased physiological demand (e.g., TC stimulation)43 and (2) Bsep protein levels remained maintained in SCRHs although its mRNA expression was dramatically decreased,44 and (3) at least, BSEP expression was detected on canalicular membranes of HepaRG cells by immunostaining.30 However, none of the studies including ours have quantitatively assessed the protein expression level of BSEP in HepaRG cells. Thus, protein levels should be quantitatively measured in addition to mRNA levels in the future. The concentration of total BAs (50-fold of the standard human serum BA mixture) required to detect BA-dependent toxicity in HepG2 cells was surprisingly low (Figs. 1g-1i), given the extremely low mRNA expression levels of NTCP and OATP1B1 (Figs. 3d and 3f). Although the toxicity mechanism in HepG2 cells is not clearly understood, similar results were documented in a previous study.35 In another study, HepG2 cells showed significant BA-dependent cytotoxicity after treatment with 28 mM glycochenodeoxycholate (GCDC) for 24 h, whereas a 10-fold higher concentration of GCDC was necessary to induce toxicity in cultured primary human hepatocytes and HepaRG cells.35,45 Interestingly, exposure of HepG2 cells to the same concentration of GCDC for 6 h yielded no cytotoxicity, but such time-dependent BA actions were not observed for either primary human hepatocytes or HepaRG cells.35,45 Therefore, HepG2 cells might be less resistant against a BA mixture including GCDC when exposed for longer periods of time. Further research aimed at identifying mechanistic differences of BA-induced cytotoxicity between HepG2 cells and other cell types would assist in providing an answer to this question. The current investigation indicated that high and low DILI-risk drugs were not efficiently separated in HepaRG cells compared

with SCHHs. A possible explanation is that both clopidogrel and leflunomide showed BA-dependent toxicity in HepaRG cells (Fig. 4a) but resulted in overall poor separation sensitivity when receiver-operating characteristic analysis was performed (Fig. 6 and Supplemental Table 1). It is notable that we have recently observed poor separation with a particular hepatocyte lot (i.e., Lot Hu1437) mainly due to the false-negative results of clopidogrel and leflunomide.26 Because apparent discrepancy of the cell toxicity between lot Hu 1437 and the other 2 lots could not been explained by the difference of CYP1A2, 2B6, and 3A4 activity obtained from the product sheet of each lot, we hypothesized that the donor of Lot Hu1437 apparently possesses low CYP2C19 enzymatic activity that was not described in the product sheet (available from https://tools.thermofisher.com/content/sfs/COAPDFs/2012/ HU1437_HMCPTS.pdf [Hu1437]; https://tools.thermofisher. com/content/sfs/COAPDFs/2013/HU1524_HMCPIS.pdf [Hu1524]; https://tools.thermofisher.com/content/sfs/COAPDFs/2012/HU4197_ HMCPIS.pdf [Hu4197]). Considering such similar tendencies between HepaRG cells and Lot Hu1437, overlooking the CYP2C19 metabolism-dependent toxicity of clopidogrel and leflunomide likely accounted for the poor prediction accuracy in HepaRG cells. Indeed, CYP2C19 activity in HepaRG cells was lower on day 7 of culture relative to that in primary human hepatocytes on day 5 of culture.46 Previously, other groups successfully enhanced CYP2C19 activity in HepaRG cells using the prototypical CYP inducer, phenobarbital, or longer times in culture than our time frame of 7 days.46,47 Therefore, false-negative drugs (i.e., clopidogrel and leflunomide) may show increased cytotoxicity in CYP2C19-induced HepaRG cells. Throughout this study, we used matured HepaRG cells including differentiated hepatocytes and typical bile canaliculi27-30 and

10

T. Susukida et al. / Journal of Pharmaceutical Sciences xxx (2016) 1e11

cultured them in accordance with the manufacturer's protocol for this assay. Because we did not selectively isolate hepatocyte-like and cholangiocyte-like HepaRG cells before seeding onto the plate, our cytotoxicity assay result might include both these 2 cell types. However, although hepatocyte-like HepaRG cells were either selectively detached using mild trypsinization or isolated by centrifugation on an OptiPrep gradient, they transdifferentiated into hepatocytic and biliary lineages through a bipotent progenitor.48 Therefore, it seems difficult to purify and evaluate only hepatocyte-like HepaRG cells unless such transdifferentiation is suppressed. In conclusion, we demonstrated that HepaRG cells are potentially applicable to our BA-dependent toxicity assay system and established similar toxicity profiles for 22 selected drugs in HepaRG cells and SCHHs. These observations suggest that HepaRG cells might provide an alternative cellular tool to SCHHs for drug screening. However, the prediction accuracy of cholestatic DILI risk in HepaRG cells was inadequate. For the practical use of HepaRG cells in preclinical screening, improvements to the assay system (e.g., induction of CYP2C19 metabolic activity in HepaRG cells) are probably required. Acknowledgments This work was supported by the Japan Society for the Promotion of Science (JSPS) (JSPS KAKENHI Grant Nos. 24390037 and 23790172) and the Leading Graduate School at Chiba University. The authors express their gratitude to the KAC Corporation (Kyoto, Japan) for the kind gift of HepaRG cells (Biopredic International, Rennes, France). References 1. Kaplowitz N. Drug-induced liver disorders: implications for drug development and regulation. Drug Saf. 2001;24(7):483-490. 2. Schuster D, Laggner C, Langer T. Why drugs failda study on side effects in new chemical entities. Curr Pharm Des. 2005;11(27):3545-3559. 3. Meier PJ, Stieger B. Bile salt transporters. Annu Rev Physiol. 2002;64:635-661. 4. Strautnieks SS, Bull LN, Knisely AS, et al. A gene encoding a liver-specific ABC transporter is mutated in progressive familial intrahepatic cholestasis. Nat Genet. 1998;20(3):233-238. 5. Stieger B, Fattinger K, Madon J, Kullak-Ublick GA, Meier PJ. Drug- and estrogeninduced cholestasis through inhibition of the hepatocellular bile salt export pump (Bsep) of rat liver. Gastroenterology. 2000;118(2):422-430. 6. Fattinger K, Funk C, Pantze M, et al. The endothelin antagonist bosentan inhibits the canalicular bile salt export pump: a potential mechanism for hepatic adverse reactions. Clin Pharmacol Ther. 2001;69(4):223-231. 7. Byrne JA, Strautnieks SS, Mieli-Vergani G, Higgins CF, Linton KJ, Thompson RJ. The human bile salt export pump: characterization of substrate specificity and identification of inhibitors. Gastroenterology. 2002;123(5):1649-1658. 8. Kostrubsky SE, Strom SC, Kalgutkar AS, et al. Inhibition of hepatobiliary transport as a predictive method for clinical hepatotoxicity of nefazodone. Toxicol Sci. 2006;90(2):451-459. 9. Jemnitz K, Veres Z, Vereczkey L. Contribution of high basolateral bile salt efflux to the lack of hepatotoxicity in rat in response to drugs inducing cholestasis in human. Toxicol Sci. 2010;115(1):80-88. 10. Akita H, Suzuki H, Hirohashi T, Takikawa H, Sugiyama Y. Transport activity of human MRP3 expressed in Sf9 cells: comparative studies with rat MRP3. Pharm Res. 2002;19(1):34-41. 11. Rius M, Nies AT, Hummel-Eisenbeiss J, Jedlitschky G, Keppler D. Cotransport of reduced glutathione with bile salts by MRP4 (ABCC4) localized to the basolateral hepatocyte membrane. Hepatology. 2003;38(2):374-384. 12. Teng S, Piquette-Miller M. Hepatoprotective role of PXR activation and MRP3 in cholic acid-induced cholestasis. Br J Pharmacol. 2007;151(3):367-376. 13. Mennone A, Soroka CJ, Cai SY, et al. Mrp4-/- mice have an impaired cytoprotective response in obstructive cholestasis. Hepatology. 2006;43(5):1013-1021. 14. Vanwijngaerden YM, Wauters J, Langouche L, et al. Critical illness evokes elevated circulating bile acids related to altered hepatic transporter and nuclear receptor expression. Hepatology. 2011;54(5):1741-1752. 15. Keitel V, Burdelski M, Warskulat U, et al. Expression and localization of hepatobiliary transport proteins in progressive familial intrahepatic cholestasis. Hepatology. 2005;41(5):1160-1172. 16. Zollner G, Wagner M, Fickert P, et al. Expression of bile acid synthesis and detoxification enzymes and the alternative bile acid efflux pump MRP4 in patients with primary biliary cirrhosis. Liver Int. 2007;27(7):920-929.

17. Dawson S, Stahl S, Paul N, Barber J, Kenna JG. In vitro inhibition of the bile salt export pump correlates with risk of cholestatic drug-induced liver injury in humans. Drug Metab Dispos. 2012;40(1):130-138. 18. Morgan RE, Trauner M, van Staden CJ, et al. Interference with bile salt export pump function is a susceptibility factor for human liver injury in drug development. Toxicol Sci. 2010;118(2):485-500. 19. Pedersen JM, Matsson P, Bergstrom CA, et al. Early identification of clinically relevant drug interactions with the human bile salt export pump (BSEP/ ABCB11). Toxicol Sci. 2013;136(2):328-343. 20. Warner DJ, Chen H, Cantin LD, et al. Mitigating the inhibition of human bile salt export pump by drugs: opportunities provided by physicochemical property modulation, in silico modeling, and structural modification. Drug Metab Dispos. 2012;40(12):2332-2341. 21. Kock K, Ferslew BC, Netterberg I, et al. Risk factors for development of cholestatic drug-induced liver injury: inhibition of hepatic basolateral bile acid transporters multidrug resistance-associated proteins 3 and 4. Drug Metab Dispos. 2014;42(4):665-674. 22. Morgan RE, van Staden CJ, Chen Y, et al. A multifactorial approach to hepatobiliary transporter assessment enables improved therapeutic compound development. Toxicol Sci. 2013;136(1):216-241. 23. Swift B, Pfeifer ND, Brouwer KL. Sandwich-cultured hepatocytes: an in vitro model to evaluate hepatobiliary transporter-based drug interactions and hepatotoxicity. Drug Metab Rev. 2010;42(3):446-471. 24. Ogimura E, Sekine S, Horie T. Bile salt export pump inhibitors are associated with bile acid-dependent drug-induced toxicity in sandwich-cultured hepatocytes. Biochem Biophys Res Commun. 2011;416(3-4):313-317. 25. Susukida T, Sekine S, Ogimura E, et al. Basal efflux of bile acids contributes to drug-induced bile acid-dependent hepatocyte toxicity in rat sandwichcultured hepatocytes. Toxicol In Vitro. 2015;29(7):1454-1463. 26. Susukida T, Sekine S, Nozaki M, Tokizono M, Ito K. Prediction of the clinical risk of drug-induced cholestatic liver injury using an in vitro sandwich cultured hepatocyte assay. Drug Metab Dispos. 2015;43(11):1760-1768. 27. Kanebratt KP, Andersson TB. Evaluation of HepaRG cells as an in vitro model for human drug metabolism studies. Drug Metab Dispos. 2008;36(7):14441452. 28. Antherieu S, Bachour-El Azzi P, Dumont J, et al. Oxidative stress plays a major role in chlorpromazine-induced cholestasis in human HepaRG cells. Hepatology. 2013;57(4):1518-1529. 29. Sharanek A, Azzi PB, Al-Attrache H, et al. Different dose-dependent mechanisms are involved in early cyclosporine a-induced cholestatic effects in hepaRG cells. Toxicol Sci. 2014;141(1):244-253. 30. Bachour-El Azzi P, Sharanek A, Burban A, et al. Comparative localization and functional activity of the main hepatobiliary transporters in HepaRG cells and primary human hepatocytes. Toxicol Sci. 2015;145(1):157-168. 31. Kemp DC, Zamek-Gliszczynski MJ, Brouwer KL. Xenobiotics inhibit hepatic uptake and biliary excretion of taurocholate in rat hepatocytes. Toxicol Sci. 2005;83(2):207-214. 32. Le Vee M, Jigorel E, Glaise D, Gripon P, Guguen-Guillouzo C, Fardel O. Functional expression of sinusoidal and canalicular hepatic drug transporters in the differentiated human hepatoma HepaRG cell line. Eur J Pharm Sci. 2006;28(1-2):109-117. 33. Gerets HH, Tilmant K, Gerin B, et al. Characterization of primary human hepatocytes, HepG2 cells, and HepaRG cells at the mRNA level and CYP activity in response to inducers and their predictivity for the detection of human hepatotoxins. Cell Biol Toxicol. 2012;28(2):69-87. 34. St-Pierre MV, Kullak-Ublick GA, Hagenbuch B, Meier PJ. Transport of bile acids in hepatic and non-hepatic tissues. J Exp Biol. 2001;204(Pt 10):1673-1686. 35. Woolbright BL, McGill MR, Yan H, Jaeschke H. Bile acid-induced toxicity in HepaRG cells recapitulates the response in primary human hepatocytes. Basic Clin Pharmacol Toxicol. 2016;118(2):160-167. 36. Shitara Y, Itoh T, Sato H, Li AP, Sugiyama Y. Inhibition of transporter-mediated hepatic uptake as a mechanism for drug-drug interaction between cerivastatin and cyclosporin A. J Pharmacol Exp Ther. 2003;304(2):610-616. 37. Marion TL, Perry CH, St Claire III RL, Yue W, Brouwer KL. Differential disposition of chenodeoxycholic acid versus taurocholic acid in response to acute troglitazone exposure in rat hepatocytes. Toxicol Sci. 2011;120(2):371-380. 38. Mita S, Suzuki H, Akita H, et al. Vectorial transport of unconjugated and conjugated bile salts by monolayers of LLC-PK1 cells doubly transfected with human NTCP and BSEP or with rat Ntcp and Bsep. Am J Physiol Gastrointest Liver Physiol. 2006;290(3):G550-G556. 39. Sharanek A, Burban A, Humbert L, et al. Cellular accumulation and toxic effects of bile acids in cyclosporine A-treated HepaRG hepatocytes. Toxicol Sci. 2015;147(2):573-587. 40. Crocenzi FA, Mottino AD, Cao J, et al. Estradiol-17beta-D-glucuronide induces endocytic internalization of Bsep in rats. Am J Physiol Gastrointest Liver Physiol. 2003;285(2):G449-G459. 41. Bi YA, Kazolias D, Duignan DB. Use of cryopreserved human hepatocytes in sandwich culture to measure hepatobiliary transport. Drug Metab Dispos. 2006;34(9):1658-1665. 42. Wolf KK, Vora S, Webster LO, Generaux GT, Polli JW, Brouwer KL. Use of cassette dosing in sandwich-cultured rat and human hepatocytes to identify drugs that inhibit bile acid transport. Toxicol In Vitro. 2010;24(1): 297-309. 43. Kipp H, Arias IM. Trafficking of canalicular ABC transporters in hepatocytes. Annu Rev Physiol. 2002;64:595-608.

T. Susukida et al. / Journal of Pharmaceutical Sciences xxx (2016) 1e11 44. Tchaparian EH, Houghton JS, Uyeda C, Grillo MP, Jin L. Effect of culture time on the basal expression levels of drug transporters in sandwich-cultured primary rat hepatocytes. Drug Metab Dispos. 2011;39(12):2387-2394. 45. Woolbright BL, Dorko K, Antoine DJ, et al. Bile acid-induced necrosis in primary human hepatocytes and in patients with obstructive cholestasis. Toxicol Appl Pharmacol. 2015;283(3):168-177. 46. Lubberstedt M, Muller-Vieira U, Mayer M, et al. HepaRG human hepatic cell line utility as a surrogate for primary human hepatocytes in drug metabolism assessment in vitro. J Pharmacol Toxicol Methods. 2011;63(1):59-68.

11

47. Turpeinen M, Tolonen A, Chesne C, Guillouzo A, Uusitalo J, Pelkonen O. Functional expression, inhibition and induction of CYP enzymes in HepaRG cells. Toxicol In Vitro. 2009;23(4):748-753. 48. Cerec V, Glaise D, Garnier D, et al. Transdifferentiation of hepatocyte-like cells from the human hepatoma HepaRG cell line through bipotent progenitor. Hepatology. 2007;45(4):957-967. 49. Scherer M, Gnewuch C, Schmitz G, Liebisch G. Rapid quantification of bile acids and their conjugates in serum by liquid chromatography-tandem mass spectrometry. J Chromatogr B Anal Technol. 2009;877(30):3920-3925.