Evolution of a highly polymorphic human cytochrome P450 gene cluster: CYP2D6

GENOMICS 14, 49-58 (1992)

Evolution of a Highly Polymorphic Human Cytochrome P450 Gene Cluster: CYP2D6 MARKUS H. HElM AND URS A. MEYER Department of Pharmacology, Biocenter of the University of Basel, CH.4056 Basel, Switzerland Received February 17, 1992; revisedMay 13, 1992

nous substrates presumably evolved to detoxify plant toxins (Gonzalez and Nebert, 1990). As plants and habitats changed, a particular P450 in a given species may not have been required for survival and its presence was no longer selected for. M u t a n t alleles of its gene could have spread in some populations. This may be the basis for the marked inherited variations in drug metabolism detected in rodents and man (Gonzalez, 1989; Meyer et al., 1990). Similar mechanisms also may explain interethnic differences in drug metabolism (Kalow, 1991). A genetic deficiency of P450 CYP2D6 causes the debrisoquine/sparteine polymorphism, an extensively studied genetic variation in oxidative drug metabolism in man. Five to 10% of the Caucasian populations of Europe and North America are "poor metabolizers," i.e., inefficient in the metabolism of the antihypertensive drug debrisoquine and over 25 other drugs, many of them derived from plant alkaloids (Meyer et al., 1990). The debrisoquine/sparteine polymorphism is caused by mutations of the C Y P 2 D 6 gene. This gene is part of a gene cluster on chromosome 22 that includes related pseudogenes, two of which have been sequenced, namely C Y P 2 D 7 P and C Y P 2 D 8 P (Kimura et al., 1989; Gonzalez et al., 1988a). Restriction fragment length polymorphisms (RFLPs) after digestion with the restriction endonuclease XbaI identify several haplotypes of this gene cluster. The three most frequent XbaI fragments were found to be 29, 44, and 11.5 kb, respectively (Skoda et al., 1988). They represent the following C Y P 2 D gene clusters: The X b a I 29-kb fragment contains the two pseudogenes C Y P 2 D 7 P and C Y P 2 D 8 P and the C Y P 2 D 6 gene. Four allelic variants of the C YP2D6 gene in this arrangement have been identified: the functional C Y P 2 D 6 . W T wildtype allele and the defective C Y P 2 D 6 . A , C Y P 2 D 6 . B , and C Y P 2 D 6 . C alleles (Kagimoto et al., 1990; Tyndale et al., 1991). These mutant alleles contain one or more than one inactivating point mutation and if present in the homozygous situation or combined with another defective allele result in the poor metabolizer phenotype. The X b a I 11.5-kb fragment lacks the entire C Y P 2 D 6 gene and consists of only the two pseudogenes C Y P 2 D 7 P and C Y P 2 D 8 P (Gaedigk et al., 1991). In the present study, we have analyzed the structure of the gene cluster variant that is characterized by a X b a I

The C Y P 2 D gene cluster on human chromosome 22 containing the functional cytochrome P450 gene C Y P 2 D 6 a n d t w o or t h r e e h i g h l y h o m o l o g o u s p s e u d o g e n e s is i n v o l v e d i n a c l i n i c a l l y i m p o r t a n t v a r i a t i o n i n the inactivation of drugs and environmental chemicals. Several mutant haplotypes of CYP2D6 have been identified by restriction analysis and by PCR-based allelespecific amplification. To understand the evolutionary s e q u e n c e o f m u t a t i o n a l e v e n t s a s w e l l a s r e c e n t l y disc o v e r e d i n t e r r a c i a l d i f f e r e n c e s , w e a n a l y z e d t h e arrangement of the CYP2D haplotype containing a comm o n m u t a n t a l l e l e o f C Y P 2 D 6 a s s o c i a t e d w i t h a XbaI 44-kb fragment. This haplotype contains four CYP2D genes instead of three. Comparison of the sequences of these genes with those of previously characterized hapl o t y p e s s u g g e s t s t h a t a n e a r l y p o i n t m u t a t i o n w a s followed by a crossover and a gene conversion event, the latter found preferentially in Caucasians. These data are consistent with the rapid evolution of this locus during "plant-animal warfare" with practical consequences for present-day defense of the organism a g a i n s t e n v i r o n m e n t a l a d v e r s i t y . © 1992 AcademicPress, Inc.

INTRODUCTION Cytochromes P450 (P450) are enzymes involved in the oxidative metabolism of numerous endogenous and exogenous molecules, including steroids, fatty acids, prostaglandins, leukotrienes, biogenic amines, pheromones, plant metabolites, drugs, and chemical carcinogens. These enzymes are present in all eucaryotes examined and in at least some procaryotes and probably have existed for more than 1.5 billion years (Nebert and Gonzales, 1987). In mammals the P450 superfamily consists of at least 10 families and a total of over 100 individual genes (Nebert et al., 1991). An interesting feature of these enzymes is their overlapping substrate specificity; a single P450 protein can metabolize numerous structurally diverse chemicals or one chemical can be metabolized by several P450s, providing the organism's capacity to metabolize and detoxify countless substances in the diet and environment. P450s with predominantly exoge49

0888-7543/92 $5.00 Copyright © 1992 by Academic Press, Inc. All rights of reproduction iil any form reserved.

50

HEIM AND MEYER

4 4 - k b f r a g m e n t , p r e v i o u s l y d e s i g n a t e d t h e " 4 4 - k b allele." A p p r o x i m a t e l y 30% of t h e m u t a n t alleles i n p o o r m e t a b olizers are a s s o c i a t e d w i t h a 4 4 - k b f r a g m e n t , a n d t h e e l u c i d a t i o n of its g e n e i n a c t i v a t i n g m e c h a n i s m will i n crease t h e p e r c e n t a g e of s e q u e n c e d m u t a n t alleles t o over 90%. Our results indicate that the 44-kb fragment contains four C Y P 2 D g e n e s ( c o m p a r e d t o t h r e e i n t h e w i l d t y p e c l u s t e r ) i n a r e g i o n s p a n n i n g m o r e t h a n 40,000 bp, namely, three pseudogenes and the mutant C YP2D6. B gene. T h e c o m p a r i s o n of t h i s a r r a n g e m e n t w i t h t h e p r e v i o u s l y a n a l y z e d g e n e c l u s t e r s r e f l e c t e d b y t h e 29- a n d 11.5-kb X b a I f r a g m e n t s ( d e s i g n a t e d 29wt, 29A, 29B, a n d 11.5 kb) c a n e x p l a i n h o w a n d i n w h a t s e q u e n c e t h e diff e r e n t m u t a n t c l u s t e r s evolved. A n u n e q u a l c r o s s o v e r e v e n t b e t w e e n a f u n c t i o n a l h a p l o t y p e w i t h a 2 9 - k b fragm e n t ( h a p l o t y p e 2 9 W T or w i l d t y p e ) a n d a d e f i c i e n t h a p lotype c o n t a i n i n g the CYP2D6.B allele a n d a 2 9 - k b f r a g m e n t ( h a p l o t y p e 29B) g e n e r a t e d a n e w d e f i c i e n t h a p l o t y p e w i t h a n 11.5-kb f r a g m e n t ( h a p l o t y p e 11.5) a n d a functional haplotype with a 44-kb fragment (haplotype 44E, E for e x t e n s i v e m e t a b o l i z e r ) a b o u t 1 m i l l i o n y e a r s ago. A f u n c t i o n a l 4 4 E h a p l o t y p e h a s b e e n o b s e r v e d w i t h a f r e q u e n c y of 38% i n t h e C h i n e s e p o p u l a t i o n ( J o h a n s s o n et al., 1991). I n a s e c o n d step, a g e n e c o n v e r s i o n e v e n t r e s u l t e d i n a m u t a n t h a p l o t y p e w i t h a 4 4 - k b fragm e n t ( h a p l o t y p e 44P, P for p o o r m e t a b o l i z e r ) f o u n d p r e f erentially in Caucasians and conferring deficient metabo l i s m of d e b r i s o q u o n e a n d o t h e r drugs. MATERIALS AND METHODS DNA source and isolation of clones. Leukocyte DNA from a poor metabolizer phenotyped with debrisoquine and genotyped by RFLP analysis as Xba144/44 kb (Skoda et al., 1988) was completely digested with EcoRI and used for construction of a library in XEMBL4 (Frischauf et al., 1983). The library was screened with [a-32P]dATP-labeled CYP2D6 cDNA (Gonzalez et al., 1988b). Phage were analyzed by digestion with EcoRI and BamHI followed by Southern blotting and hybridization to the radiolabeled CYP2D6 cDNA. Sequencing. The EcoRI inserts of the four phage 34, 41, 42, and 45 were digested with BamHI, and the resulting fragments were subcloned into the pBluescript vector (pBS, Stratagene). Subclones were either further subcloned or processed by the exonuclease III method (Henikoff, 1984) and sequenced by the dideoxy chain-termination procedure (Sanger et al., 1977) using universal and reverse primers. For exonic sequences, 18 synthesized oligonucleotides corresponding to the 5' and 3' parts of each of the nine exons were used (Kagimoto et al., 1990). Data were analyzed with the sequence analysis software package from the University of Wisconsin Group (Devereux et al., 1984). Genomic Southern blots. DNA from individuals with the extensive or poor metabolizer phenotype and the defined XbaI genotype was used for genomic Southern blots after digestion with BamHI. After alkaline blotting overnight, the Biotrace RP (Gelman) membranes were prehybridized in 1 M sodium chloride, 10% dextran sulfate, 1% sodium dodecyl sulfate (SDS), 100 #g/ml denatured salmon sperm DNA for at least 6 h at 65°C and hybridized to a [a-a2P]dATP-labeled CYP2D6 cDNA (Gonzalez et al., 1988b) overnight in the same solution at 70°C. Membranes were washed 2× for 5 rain at room temperature in 0.15 M sodium chloride, 0.015 M sodium citrate, and 1% SDS; once for 30 min at 72°C in 0.15 M sodium chloride, 0.015 M sodium citrate, and 1% SDS; and once for 30 rain at 72°C in 0.015 M sodium chloride, 0.0015 M sodium citrate, and 1% SDS.

Barn H I d i g e s t i o n

Eco R[ digestion 34 41 42 45

34 41 42 45

15.1 kb ---. 13.7 k b . ~ .

9.4 k b - ~ 8.8 k b - - *

6.7 kb--~ 4.9 k b - - * 3.2 kb---~

2.2 kb--~ 1.9 k b--.~ 1.7 kb----*

FIG. 1. Southern blots of phage DNAs each containing an EcoRI insert representing a different C YP2D gene or pseudogene of the XbaI 44P haplotype. Genomic DNA from a poor metabolizer with the XbaI genotype 44/44 kb was completely digested with EcoRI and used for construction of a library in XEMBL4. The isolated phages contained one of the four EcoRI inserts hybridizing to the [a-a2P]dATP-labeled CYP2D6 cDNA shown here with the examples of phage 34, 41, 42, and 45. The lengths of these inserts (9.4, 8.8, 15.1, and 13.7 kb) match the lengths of the four fragments detected by the same probe on genomic Southern blots with DNA from poor metabolizers with an Xba144/44 kb genotype. Phage 34 contains CYP2D6B, phage 41 CYP2D8P, phage 42 CYP2D7AP, and phage 45 CYP2D7BP (see also Fig. 3). The four different inserts can also be identified by their characteristic BamHI pattern.

PCR amplifications of junction fragments. A 604-bp fragment was amplified from 0.5 ttg of genomic DNA already used for construction of the library with primer 1 (5' CCCCAGCGGACTTATCAACC 3', complementary to position 7517 to 7536 downstream of CYP2D7BP and to position 7497 to 7516 downstream of CYP2D7AP) andprimer 2 (5' CCTCCATTGTGCAATGATGC 3', complementary to position -1230 to -1211 of CYP2D6 and to position -1232 to -1213 of CYP2D7BP). The reaction was carried out in a total volume of 100 #1 in the presence of 1.5 mM magnesium chloride, 10 mM Tris-hydrochloric acid, pH 8.3, 50 mM potassium chloride, 0.01% (w/v) gelatine, 200 ttM each dNTP, 0.5 #M each primer, 0.5 t~g of genomic DNA, and 1.5 U Taq polymerase (Perkin-Elmer). After an initial denaturation at 94°C for 90 s, 35 cycles of 60 s at 94°C, 90 s at 48°C, and 180 s at 72°C and a final extension period of 7 rain at 72°C were performed. The amplified fragment was gel-purified and sequenced directly using the same primers and the dideoxy chain-termination method (Sanger et al, 1977). Sequence comparison. Sequence comparison was performed using the software package from the University of Wisconsin Group (Devereux et al., 1984) and the computer program NAG, kindly supplied by T. Ota, based on the method of Nei and Gojobori (1986). The new sequences reported herein have the EMBL Database Accession numbers and names X58467 and HSCP2D7AP for CYP2D7AP, and X58468 and HSCP2D7BP for CYP2D7BP. RESULTS I s o l a t i o n of C Y P 2 D

Genes

DNA completely digested with EcoRI from a poor metabolizer (PM) with a XbaI 44/44 kb genotype c o n t a i n s f o u r E c o R I f r a g m e n t s of 8.5, 9.5, 16, a n d 18 kb, w h e r e a s the XbaI 29-kb f r a g m e n t lacks the 16-kb D N A , a n d the 11.5-kb f r a g m e n t o b v i o u s l y l a c k s b o t h t h e 16- a n d t h e 9 . 5 - k b D N A s ( S k o d a e t al., 1988). T h e d i f f e r e n t sizes o f

CYP2D6 POLYMORPHISM the EcoRI inserts and the characteristic B a m H I fragments therefore allowed us to classify the 22 phages isolated from the genomic library into four groups (Fig. 1). One phage from each group was processed for further analysis.

Sequences of the Isolated CYP2D Genes Phage 41 contains the pseudogene C Y P 2 D 8 P (Kimura et al., 1989). It was characterized by restriction site mapping and partial sequencing. Phage 34 contains the mutant CYP2D6*B. All exons and exon-intron junctions were sequenced, and the mutations found were the same as those previously described by us (Kagimoto et al., 1990). Phage 42 contains a pseudogene we designated CYP2D7AP. Except for about 1470 bp in the 5' region of this pseudogene, the complete 15,070-bp insert was sequenced. C Y P 2 D 7 A P is nearly identical to a pseudogene designated CYP2D7 (44/11.5) recently isolated from a PM with the XbaI 11.5/44 kb genotype (Hanioka et al., 1990). The deduced amino acid sequences of C Y P 2 D 7 A P and of C Y P 2 D 7 P (Kimura et al., 1989) display 97.4% identity. The nucleotide differences in a region from 1150 bp upstream to 1489 bp downstream between the two pseudogenes are listed in Table 1. The T insertion in exon 1 of C Y P 2 D 7 P (T226) causes a premature termination of translation at amino acid position 253. This mutation is also present in CYP2D7AP, but an additional frameshift mutation in exon 4 (G2o35) leads to premature termination of translation at amino acid 225. Phage 45 contains a pseudogene designated CYP2D7BP. The complete 13677-bp insert was sequenced. C Y P 2 D 7 B P is a "chimeric" gene: In a 4853~bp region spanning from the second exon to 1489 bp downstream, only nine base changes from the C Y P 2 D 7 A P sequence were found. From 5' of exon 2, however, including intron 1, exon 1, and 776 bp of upstream sequence, C Y P 2 D 7 B P displays 42 base changes when compared to the sequence of CYP2D7AP, but only 5 when compared to that of CYP2D6. Table 1 therefore lists the differences from CYP2D6 for this 5' part of C Y P 2 D 7 B P until the end of intron I and then uses C Y P 2 D 7 P as the published reference sequence for exon 2 to 1489 bp downstream. C Y P 2 D 7 B P lacks the above-mentioned T insertion in exon 1, but the G insertion in exon 4 (G2o35) causes a premature termination of translation at amino acid 253. The sequences downstream of C Y P 2 D 7 A P and C Y P 2 D 7 B P are nearly identical (Fig. 2). The sequence CCCACCCTTC is repeated four times in C Y P 2 D 7 B P between position 2396 and position 2435 downstream, whereas in C Y P 2 D 7 A P it is repeated twice between position 2395 and position 2414 downstream (position 1 downstream corresponds to the published CYP2D7P). These repeats are flanked by direct repeats of the sequence ACCCCGGG. In addition to this difference, nine base changes were found when the 7789 bp of downstream sequence from C Y P 2 D 7 A P were compared with the 7809 bp of CYP2D7BP. The downstream sequences of both C Y P 2 D 7 A P and C Y P 2 D 7 B P have an insertion

51

of about 1600 bp at position 540 of the CYP2D6 downstream sequence. In these insertion sequences, we found several copies of 41- and 24-bp repeats that have been described in the 3' region of the human ~-globin cluster near the breakpoint of a deletion (Henthorn et al., 1986) and in the 370-bp sequence of clone SP-0.3-16 that was shown to be hypomethylated in sperm cell DNA (Zhang et al., 1987).

Gene Arrangement on the 44P Haplotype The arrangement of the four genes on the 44-kb fragment found with the 44P haplotype is depicted in Fig. 3. Southern blots with BamHI-digested genomic DNA from one individual homozygous for the ll.5-kb fragment (Fig. 3C, lane A), one individual homozygous for the 29-kb fragment (lane B), and three poor metabolizer individuals with the 44/44 kb genotype (lanes C, D, E) were hybridized to the [a-32P]dATP-labeled probes S1$6, the positions of which are indicated in Fig. 3B. S1 is 2.1-kb E c o R I - B a m H I fragment isolated from phage 41 (CYP2D8P), $2 is a 1.45-kb EcoRI-KpnI fragment from the same phage, $3 is a 2.15-kb E c o R I - B a m H I fragment from phage 42 (CYP2D7AP), $4 is a 4.25-kb EcoRIB a m H I fragment from the same phage that is nearly identical to the corresponding fragment from phage 45 (CYP2D7BP), $5 is a 0.55-kb E c o R I - B a m H I fragment from phage 34 ( C Y P 2 D 6 . B ) that is identical to the corresponding fragment of phage 45 (CYP2D7BP), and $6 is a 1.5-kb E c o R I - B a m H I fragment from phage 34. Digestion of genomic DNA with B a m H I yields fragments spanning the EcoRI boundaries of the phage inserts. If two probes from different phages hybridize to the same fragment, we conclude that the inserts of these phages are adjacent to each other on the chromosome. S1 and $6 hybridized to two different fragments of 3.7 and 9.5 kb, respectively, not detected by any other probe. C Y P 2 D 8 P therefore must be 5' of all the other genes, and C Y P 2 D 6 * B must be at the 3' end of the gene cluster in the orientations shown in Fig. 3. Consistent with the presumed arrangement of CYP2D8 and C Y P 2 D 7 P (Kimura et al., 1989), $2 and $3 both hybridized to an 8.8-kb fragment, showing that C Y P 2 D 7 A P lies immediately downstream of CYP2D8P. Only one additional fragment is detected by both $4 and $5. It corresponds to the 4.8-kb B a m H I - B a m H I fragment between C Y P 2 D 7 A P and C Y P 2 D 7 B P as well as the identical fragment between C Y P 2 D 7 B P and C Y P 2 D 6 . B . Any different alignment of the genes would yield different fragments detected by these probes. Since ll.5-kb fragments have only a C Y P 2 D 8 P and a CYP2D7P, the DNA of the individual homozygous for the ll.5-kb fragment (Fig. 3C, lane A) lacks the 4.8-kb fragment detected by $4 and $5. Our data also document for the first time that CYP2D6 lies downstream of CYP2D7 on the 29-kb fragment (Fig. 3C, lane B) and that the intergenic sequence between these two genes apparently is identical to the intergenic sequences between C YP2D 7AP and C YP2D 7BP, and be-

52

HEIM AND MEYER

TABLE 1 C o m p a r i s o n of U p s t r e a m , D o w n s t r e a m , Intron, and E x o n S e q u e n c e s o f C Y P 2 D T P , C Y P 2 D T A P , and C Y P 2 D T B P C YP2D 7P Upstream

1150 bp A_955 C-7v8 C-785 T_346 G-813 C-132 G-117 C-lo4 CAC-lo1~-96 G_67G_66 G-so

~ --~ -~ -~ --~ --~ -~ --~ "-> -~

Exon 1 Intron 1

398/399

Exon 2 Intron 2

G1336

C YP2D 7AP

C YP2D 7BP

1149 bp C T T C C G A T Deleted CA A

1531 bp T AA inserted G A

"--

1531 bp C-1368 -1149/-1148 A-114v

~-

6_912

None

T

~'-

6188

G inserted

T Deleted G G

~-

6396 C66s C8~4

~'-

T931

None

None

Deleted

--~

Deleted A

Deleted C inserted Deleted A

-~ --~

A T

A T

None

None GC G inserted TC

1406/1407

61626 61667 Exon 3

T1676 G1682

Intron 3 Exon 4

C2o43T2044

--~

GC G inserted TC

Intron 4

62323 62468 62481

--~ --~ --~

T A G

T A G

Exon 5

T2523 62632 62663 T2667

-~ --~ -~ --~

C A A A

C A A A

None

None

C191561916

-~

2035/2036

Intron 5 Exon 6

None

C2974 Intron 6 Exon 7

Intron 7

C3148

Deleted -~

G

G T A

C3300 G3311 A6862

-~ --~

A3625

--->

T A Deleted G

A3664 A3~56

--~ --*

G G

T~425 3432/3433

--~

G6437 G3523 A659o

--.-> -...->

C T inserted A

T6666

-~

Exon 8

A C

C T inserted A A Deleted C

None

Aaa99 Intron 8

G G G

G None

None

C YP2D6

"-

53

CYP2D6 POLYMORPHISM T A B L E 1--Continued C YP2D 7P Exon 9

C4239 C42s9

Downstream

1489 bp C151 A152 C580 G~84 C5s6 G755 T12Go A1317 1373/1374 1461/1462

C YP2D 7A P --~ -~ -~ --~ --~

-~ --~ --~

T T

T T

1491 bp

1489 bp A G T Deleted Deleted A C G G inserted G inserted

G T

C G G inserted G inserted

tween C Y P 2 D 7 B P and CYP2D6B on the 44-kb fragment. Additional evidence for this arrangement is obtained from the comparison of calculated restriction fragments for digestion with EcoRV, NcoI, and HindIII with our previous Southern blot data (Skoda et al., 1988): DNA from poor metabolizers with the XbaI polymorphic fragment was shown to contain EcoRI fragments of 8.5, 9.5, 16, and 18 kb, EcoRV fragments of 14.5 and 44 kb, NcoI 2D7AP RH

B N B

II

I

NIV

~

B

IJl II I I I I I

II

•

I

lB../"

1

2 34 5 6 7 . .8'9"

HI

Ill

B

E:~l~l::i:]:il

N

I[/t

"-,. u "'"'-, --.

. ,J

H

R

I

/

N

""%..

.

,.,

2DTBP B

RB

II m

" ""%

•

I

1

2 34 567 89

II

nab

B

HI

/-

B"" N

u

JJ~

H R mm~

LEGEND:

I

EXON

[ZZ]CCCACCCTTC REPEAT ~ ~ALU

REPEAT

NOT SEQUENCED ~ M I S S I N G

IN 2D6

SP-0 3-16 ~

C YP2D 7BP

41BP REPEAT

C YP2D6

fragments of 6.3, 8, 9.9, and 12.5 kb, and only three HindIII fragments of 10.5, 14, and 16 kb with the CYP2D6 cDNA. All these fragments are consistent with the calculated restriction map shown in Fig. 3A. The large EcoRV fragment can be obtained only if C Y P 2 D 8 P and C Y P 2 D 6 , B are on opposite ends of the cluster because the other genes have no EcoRV sites. The calculated length of the fragment of 38.5 kb is well within the range of the Southern blot data. The arrangement now also explains the lack of an additional HindIII fragment, since two of the HindIiI fragments were calculated to have exactly the same length of 13.6 kb, i.e., will have the same mobility on gel electrophoresis. The possibility of a small EcoRI-EcoRI fragment between C Y P 2 D 7 A P and C Y P 2 D 7 B P or between C Y P 2 D 7 B P and CYP2D6B was excluded by PCR amplification of a fragment spanning the EcoRI site between these genes using primers hybridizing to the 3' end of the EcoRI inserts of phages 42 and 45 and to the 5' end of phages 45 and 41, respectively (primer 1, 5' CCCCAGCGGACTTATCAACC 3'; primer 2, 5' CCTCCATTGTGCAATGATGC 3'). The sequences of the obtained 604-bp fragments proved that the phage insert sequences connect with each other directly as indicated (data not shown, available on request).

4,,. 24BP REPEAT

F I G . 2. Features of C Y P 2 D 7 A P and CYP2D7BP. The sequenced inserts of phage 42 and 45 of Fig. 1 are shown. The 13,677-bp insert of phage 45 was sequenced completely. It contains the nine exons of a pseudogene designated CYP2D7BP. The 15.1-kb insert of phage 42 was sequenced except for about 1470 bp. It contains the nine exons of a pseudogene designated CYP2D7AP. Both sequences are highly similar from exon 2 to the 3' EcoRI site, but display marked differences 5' of exon 2, where C Y P 2 D 7 B P is homologous to CYP2D6B. Five Alu repeats were found on the insert containing CYP2D7AP, whereas four are present 5' and 3' of CYP2D7BP. The sequence CCCACCCTTC is repeated four times 3' of CYP2D7BP and two times 3' of C Y P 2 D 7 A P at the positions indicated. A 1600-bp sequence that is missing in the 3' region of CYP2D6 is present 3' of both pseudogenes and contains 41-b and 24-bp repeats found near the breakpoint of a large deletion in the human fl-globin gene cluster (Henthorn et al., 1986) as indicated by the small arrows. A 370-bp segment of this sequence also displays marked homology to a 370-bp insert of clone SP-0.3-16 that is specifically hypomethylated (Zhang et al., 1987).

Evolutionary Distances between H u m a n CYP2D Genes The results of pairwise comparisons of deduced AA sequences after correction for insertions and deletions are summarized in Table 2. Three classes of CYP2D genes can be distinguished: the CYP2D6 class with three alleles (CYP2D6, WT, C Y P 2 D 6 , A, and CYP2D6,B), the C Y P 2 D 7 P class with three variant forms (CYP2D7P, CYP2D7AP, and CYP2D7BP), and the C Y P 2 D 8 P class. C Y P 2 D 7 B P and CP2D7AP are not inherited in a strictly allelic way, since they can be transmitted together as in the case of the 44P haplotype here described. The deduced AA sequence of human CYP2D6 displays between 69 and 72% identity to the deduced AA sequences of the five rat genes of the CYP2D family

54

HEIM AND MEYER

A

ECO RV 14.5KB NCOI I

38.5KB

6 1KB

8.0KB

HIND III

13.7KB

;

13.6KB

9.8KB

I

i

13.6KB

I

B JUNCTION 7AP/7BP B

iI

<

! I I

l 5'

I

#41

><

2D8P

nNNB

#42

><

2DTAP NVRH

BNB

JUNCTION 7BPf6B @ #45

><

2D7BP B

BN

HRB

B

#34

>

21~B B

BN It"

HRB

B

B N N BNVR 3'

II ~

S~

$2 $3

54

I

$4

$5

$5

$6

l

J

C $2 A

BCDE

$3

$4

$5

ABCDE

ABCDE

ABCDE

%: ~- 4.8kb.*"

FIG. 3. Arrangement of the four genes on the XbaI 44P haplotype. Phage inserts are depicted by number of the phage (34, 41, 42, 45). Restriction sites are R, EcoRI; B, BamHI; H, HindIII; N, NcoI; V, EcoRV. The arrangement is based on three lines of evidence: (1) Genomic Southern blots with DNA from poor metabolizers with XbaI 44/44 kb genotype have EcoRI, EcoRV, NcoI, and HindIII fragments consistent with the calculated restriction map in A. (2) Sequences of DNA fragments amplified with primers complementary to sequences 5' and 3' of the EcoRI sites between CYP2D7AP, CYP2D7BP, and CYP2D6B show that the EcoRI inserts of phage 42, 45, and 41 are adjacent to each other (B). (3) Southern blots with the specific probes $1-$6 (B, C). Genomic DNA from a poor metabolizer with XbaI genotype 11.5/11.5 kb (lane A), an extensive metabolizer with genotype 29/29 kb (lane B), and three poor metabolizers with genotype 44/44 kb (lanes C, D, E) was digested with BamHI and analyzed by Southern blotting and hybridization to [a-~2P]dATP-labeled fragments $1-$6. Both $2 and $3 detect an 8.8-kb fragment corresponding to the segment from the BarnHI site in phage 41 to the first BamHI site in phage 42. $4 and $5, which are homologous to the 3' ends of phage 42 and 45 and the 5' ends of phage 45 and 34, respectively, detect a 4.8-kb fragment corresponding to the identical segments from the last BamHI site of phage 42 and 45 and the first BamHI site of phage 45 and 34. S1 detects a 3.7-kb fragment not detected by any other probe, and $6 a 9.5-kb fragment not detected by any other probe (data not shown). The corresponding segments on phage 41 and 34 are situated, therefore, at the 5' and 3' ends of the gene cluster.

CYP2D6 POLYMORPHISM

55

TABLE 2

N u m b e r of A m i n o Acid Differences and P e r c e n t a g e of Identity of D e d u c e d A m i n o Acid S e q u e n c e s b e t w e e n H u m a n C Y P 2 D Genes

2D6 2D6B 2D7P 2D7AP 2D7BP 2D8P

2D6

2D6B

2D 7P

2D 7AP

2D 7BP

2D8P

-4 29 34 31 60

99.0% -28 33 28 61

94.2% 94.4% -13 16 63

93.3% 93.4% 97.4% -7 66

93.8% 94.4%

87.9% 87.8% 87.3% 86.7% 86.7% --

( M a t s u n a g a et al., 1990) a n d b e t w e e n 66 a n d 69% to t h r e e m o u s e C Y P 2 D genes Cyp2d-9, Cyp2d-lO, a n d Cyp2d6-11 ( W o n g et al., 1989). Pairwise c o m p a r i s o n of all these genes suggests a p p r o x i m a t e l y c o n s t a n t rates of a m i n o acid s u b s t i t u t i o n s since the divergence of r o d e n t s and primates. Assuming that the rodent and primate lineage s e p a r a t e d in evolution a b o u t 75 million years ago, the rate of AA s u b s t i t u t i o n s per site per 109 y e a r s (~ × 109; Nei, 1987) is b e t w e e n 2.19 ( s t a n d a r d deviation = 0.03) a n d 2.77 (0.03) for the C Y P 2 D genes. T h e rate of nucleotide s u b s t i t u t i o n p e r site per 109 years was calculated s e p a r a t e l y for s y n o n y m o u s (silent) a n d n o n s y n o n y m o u s (AA altering) s u b s t i t u t i o n s using a c o m p u t e r p r o g r a m b a s e d on the m e t h o d of Nei a n d Gojobori (1986). C o m p a r i n g the coding sequences of hum a n C Y P 2 D 6 a n d r a t C Y P 2 D 1 , b o t h k n o w n to m e t a b o lize debrisoquine, a n d a s s u m i n g again a divergence t i m e of 75 million years, X × 109 has a value of 3.91 ( s t a n d a r d deviation 0.37) a n d 1.25 (0.09) for s y n o n y m o u s a n d n o n s y n o n y m o u s substitutions, respectively. T h e ratio bet w e e n t h e s e two t y p e s of s u b s t i t u t i o n s is 3.13. T h e ratios b e t w e e n s y n o n y m o u s a n d n o n s y n o n y m o u s substitutions c o m p a r i n g C Y P 2 D 8 P w i t h C Y P 2 D 6 a n d C Y P 2 D 7 A P with C Y P 2 D 6 are 1.72 a n d 1.03, respectively. T h e overall rate of nucleotide s u b s t i t u t i o n s per site per 109 y e a r s for s y n o n y m o u s a n d n o n s y n o n y m o u s nucleotide a l t e r a t i o n s calculated b y the s a m e c o m p u t e r p r o g r a m (Nei a n d Gojobori, 1986) is 1.8. I t was used to e s t i m a t e the t i m e of divergence of different h u m a n C Y P 2 D genes a n d p s e u d o g e n e s b y dividing t h e p r o p o r t i o n of different nucleotides b e t w e e n a n y two of t h e m b y 2 t i m e s this r a t e (Nei, 1987).

-66

m e t h o d ( H e i m a n d Meyer, 1990; Broley et al., 1991) can identify C Y P 2 D 6 * A a n d C Y P 2 D 6 * B , a n d R F L P analysis adds no i n f o r m a t i o n with regard to t h e p h e n o t y p e for these m u t a t e d 29-kb h a p l o t y p e s as well as for the m u t a t e d 44P haplotypes. It is n o t e w o r t h y t h a t of the six m u t a t i o n s p r e s e n t in exons of C Y P 2 D 6 * B , t h r e e were also f o u n d in t h e p s e u d o g e n e C Y P 2 D 8 P , four of t h e m in C Y P 2 D 7 A P a n d C Y P 2 D 7 P , a n d five of t h e m in C Y P 2 D 7 B P . P C R g e n o t y p i n g m e t h o d s t h e r e f o r e should be controlled for false positive identifications of C Y P 2 D 6 . B o b t a i n e d t h r o u g h amplification f r o m C Y P 2 D 7 genes. T h e incidence of p o o r m e t a b o l i z e r s of debrisoquine is v e r y low a m o n g the Chinese a n d J a p a n e s e , approxim a t e l y 1%, b u t a surprisingly high n u m b e r of Chinese extensive m e t a b o l i z e r s are h o m o z y g o u s for t h e " 4 4 E h a p lotype" ( J o h a n s s o n et al., 1991). A l t h o u g h individuals h o m o z y g o u s for this h a p l o t y p e have a slightly lower cap a c i t y for m e t a b o l i s m of debrisoquine, t h e y c a n n o t be classified as p o o r metabolizers. T h e m o l e c u l a r basis of the differences b e t w e e n the Chinese a n d the C a u c a s i a n X b a I 44E a n d 44P h a p l o t y p e s is n o t yet u n d e r s t o o d , b u t the s t u d y of the Chinese 44E h a p l o t y p e should benefit s u b s t a n t i a l l y f r o m the knowledge p r o v i d e d here on t h e C a u c a s i a n c o u n t e r p a r t . In addition, t h e u n d e r s t a n d i n g of this i n t e r e t h n i c difference c a n provide insights into the evolution of c y t o c h r o m e P450 C Y P 2 D 6 . T h e i m p o r t a n c e of i n t e r e t h n i c differences for drug d e v e l o p m e n t a n d t e s t i n g is increasingly recognized (Kalow, 1991). STRUCTURE

FREQUENCY

44

. 8P ~

29A

" 8P . 7(A)P

R 6A

~

R

R 8P

R 7(A)P

. 6B

R

R 8P

R 7(A)PR

DISCUSSION W i t h the elucidation of t h e m o l e c u l a r s t r u c t u r e of the m u t a n t 44P h a p l o t y p e of t h e C Y P 2 D locus c h a r a c t e r ized b y a X b a I 44-kb f r a g m e n t described here, the debrisoquine p o l y m o r p h i s m p r o b a b l y is the m e c h a n i s t i cally b e s t u n d e r s t o o d inherited v a r i a t i o n in h u m a n drug m e t a b o l i s m . Over 90% of the m u t a n t h a p l o t y p e s of the C Y P 2 D 6 are now characterized: T h e 11.5 h a p l o t y p e ( l l . 5 - k b f r a g m e n t ) lacks the entire C Y P 2 D 6 ; t h e 29A haplotype contains a mutated CYP2D6, namely, C Y P 2 D 6 . A ; a n d t h e 29B h a p l o t y p e h a r b o r s the m u t a t e d C Y P 2 D 6 . B , which is also p r e s e n t on the 44P h a p lotype (Fig. 4). G e n o t y p i n g individuals b y a P C R - b a s e d

96.8% 98.6%

29B 11.5

~::::::::::~

~:::::::~ ~

R 7AP ~

~

~

~

R 7BP ~

~

R 6B ~

R

0.30 0.05 0.42 0.15

FIG. 4. Schematic representation of four mutant haplotypes of CYP2D6 representing over 90% of the mutant haplotypes associated with the debrisoquine polymorphism. 8P, 7AP, 7BP, 6A, and 6B stand for CYP2D8P, CYP2D7AP, CYP2D7BP, CYP2D6*A, and CYP2D6.B, respectively. 7(A)P stands for either CYP2D7P or CYP2D7AP. The frequencies of these haplotypes in poor metabolizers are from Helm and Meyer (1990) and Broly et al. (1991).

56

HEIM AND MEYER

A

29WT R 2~P~

2DTAP

R

2D6

29B R 2D8PR 2 0 7 ~'~" ~

11.5 R 2D8P

~

B

44E R R 2DSP R 2DTAP

R 2DZAP

, ~

l

~ j

R 2D6 ~

.

44E R 2DSPR l ~ 2D7AP [:::]

~ 2D6 , ~,

~ 2D6B

R

1

44P R

2DSPR

2DTAP

R2DTBP

R 2D6B

R

FIG. 5. Hypothesis of the generation of the 44P haplotype by two conservative gene rearrangement events: (A) An unequal crossover between a haplotype 29WT with a XbaI 29-kb fragment with a functional CYP2D6* WT allele and a haplotype 29B with a XbaI 29-kb fragment with a mutant CYP2D6*B allele results in an ll.5-kb XbaI fragment (haplotype 11.5) and a 44-kb XbaI fragment containing both a functional CYP2D6* WT and a mutant CYP2D6*B allele (haplotype 44E). (B) A gene conversion event inactivates the CYP2D6 on the "44E haplotype" from exon 2 to about 500 bp 3' of this gene into the chimeric pseudogene CYP2D7BP. CYP2D7AP not only delivered this region, but also introduced the 1600-bp segment 3' of the gene missing in CYP2D6 (for details, see Fig. 3 and text). The resulting mutant allele is designated 44P.

F o u r C Y P 2 D genes are a r r a n g e d h e a d - t o - t a i l on the 44P h a p l o t y p e (Fig. 3). T h e a r r a n g e m e n t of C Y P 2 D 8 P a n d C Y P 2 D 7 P on the 29-kb f r a g m e n t was deduced f r o m the isolation of o v e r l a p p i n g clones. T h e position of C Y P 2 D 6 on this f r a g m e n t , however, r e m a i n e d controversial. Our findings provide direct evidence t h a t it is situated a b o u t 9.3 kb d o w n s t r e a m of C Y P 2 D 7 P (Fig. 3). A possible m e c h a n i s t i c e x p l a n a t i o n for t h e g e n e r a t i o n of the c o m m o n m u t a n t h a p l o t y p e s reflected b y X b a I 11.5- a n d 44-kb f r a g m e n t s is suggested in Fig. 5. In a first step, unequal crossover b e t w e e n a 29 wildtype a n d a 29B h a p l o t y p e g e n e r a t e d the 11.5- a n d t h e 44-kb f r a g m e n t s containing a "wildtype" CYP2D6 and a mutated C Y P 2 D 6 , B . T h i s cluster would t h u s c a r r y a functional " e x t e n s i v e m e t a b o l i z e r " gene a n d is designated " 4 4 E " in Fig. 5. E c o R I digestion of this " 4 4 E " a r r a n g e m e n t would yield f r a g m e n t s of 8.8 kb ( C Y P 2 D 8 P ) , 9.4 kb ( C Y P 2 D 6 * B ) , 15.1 kb ( C Y P 2 D 7 A P ) , a n d a b o u t 12.1 kb ( C Y P 2 D 6 * W T ) i n s t e a d of 13.7 kb as observed in m u t a n t 44P haplotypes. One rare C a u c a s i a n "44-kb haplot y p e " associated with the E M p h e n o t y p e (44E) recently was r e p o r t e d (Roots et al., 1992), a n d R F L P studies in fact revealed a n E c o R I f r a g m e n t 2 kb smaller t h a n its c o u n t e r p a r t of the m u t a n t 44-kb f r a g m e n t . In a second

step, a gene conversion e v e n t b e t w e e n a C Y P 2 D 7 A P a n d the C Y P 2 D 6 gene on this 44E f r a g m e n t s p a n n i n g t h e region f r o m t h e second exon to a b o u t 2000 bp downs t r e a m of the C Y P 2 D 7 A P gene would generate the "chim e r i c " C Y P 2 D 7 B P gene. T h e resulting h a p l o t y p e (44P) would c o n t a i n only n o n f u n c t i o n a l C Y P 2 D 6 genes a n d would yield the additional E c o R I 13.7-kb f r a g m e n t ( C Y P 2 D 7 B P ) detected with all m u t a n t 44P haplotypes. T h e following c o n s i d e r a t i o n s s u p p o r t this hypothesis: (a) G e n e c o n v e r s i o n s in P450s t h a t e x t e n d over long regions of the gene h a v e b e e n r e p o r t e d (Higashi et al., 1988). (b) T h e repetitive e l e m e n t s in the 1600-bp insertion d o w n s t r e a m of C Y P 2 D 7 A P a n d C Y P 2 D 7 B P (Fig. 2) h a v e b e e n described in o t h e r genes with D N A r e a r r a n g m e n t s , i.e., in the g e n e r a t i o n of a large deletion in the fl-globin gene cluster ( H e n t h o r n et al., 1986). Kinetic studies with e x p r e s s e d c D N A s of the r a t C Y P 2 D 1 a n d the h u m a n C Y P 2 D 6 indicated t h a t these genes indeed are orthologous (Gonzalez et al., 1988b; M a t s u n a g a et al., 1989). C o m p a r i s o n of nucleotide sequences b e t w e e n these genes t h e r e f o r e was used to calculate rates of nucleotide s u b s t i t u t i o n s per site per 109 years. In general, low rates are f o u n d in genes t h a t code for p r o t e i n s with strong functional c o n s t r a i n t s (Nei, 1987). H i s t o n e H 4 with rates of 0.004 for AA altering ( n o n s y n o n y m o u s ) a n d 1.43 for silent ( s y n o n y m o u s ) substitutions, for example, is one of the m o r e c o n s e r v e d p r o t e i n s during evolution, whereas i n t e r f e r o n - a 1 w i t h rates of 1.41 ( n o n s y n o n y m o u s ) a n d 3.53 ( s y n o n y m o u s ) is a r a t h e r fast evolving p r o t e i n (Li et al., 1985). W i t h a rate of 1.25 for n o n s y n o n y m o u s a n d 3.91 for s y n o n y m o u s nucleotide s u b s t i t u t i o n p e r site per 109 years, the C Y P 2 D genes also are relatively fast evolving genes. In functional genes, s y n o n y m o u s m u t a t i o n s are f o u n d to be m o r e f r e q u e n t t h a n n o n s y n o n y m o u s m u t a t i o n s . T h i s can be e x p l a i n e d b y the n e u t r a l t h e o r y of m o l e c u l a r evolution ( K i m u r a , 1968). Accordingly, m u t a t i o n s occur at r a n d o m , b u t m o s t a m i n o acid altering m u t a t i o n s are deleterious a n d are quickly e l i m i n a t e d f r o m the p o p u l a tion, whereas silent m u t a t i o n u n d e r l a y no " p u r i f y i n g " selection. P s e u d o g e n e s are no longer exposed to selective pressures, a n d t h e r e f o r e s y n o n y m o u s a n d n o n s y n o n y m o u s s u b s t i t u t i o n s occur at the s a m e rate. In C Y P 2 D 7 A P t h e ratio of s y n o n y m o u s to n o n s y n o n y m o u s m u t a t i o n s indeed is 1.03. C Y P 2 D 7 A P t h e r e f o r e p r o b a bly was i n a c t i v a t e d shortly a f t e r its g e n e r a t i o n t h r o u g h a gene duplication e v e n t in C Y P 2 D 6 . C o m p a r i n g C Y P 2 D 6 with C Y P 2 D 8 P , s y n o n y m o u s s u b s t i t u t i o n s are still observed 1.7 t i m e s m o r e f r e q u e n t l y t h a n AA altering m u t a tions. T h u s , for some million y e a r s C Y P 2 D 8 P m a y h a v e b e e n a functional gene. T h e t o t a l n u m b e r of s u b s t i t u t i o n s per site per 109 years for the C Y P 2 D genes is 1.8 ( s t a n d a r d deviation = 0.1). T h i s value a n d the t o t a l n u m b e r of different nucleotides b e t w e e n a n y two C Y P 2 D genes can be used to calculate the t i m e of divergence b e t w e e n these genes (Nei, 1987). Figure 6 displays a phylogenetic tree for the h u m a n C Y P 2 D genes. I t is realized t h a t s o m e b r a n c h lengths m a y have b e e n o v e r e s t i m a t e d because of the

CYP2D6 POLYMORPHISM 6 10 years

20

57

In any case, the clinical observation of inherited variation of drug metabolism has spurred the investigation of these highly polymorphic genes in the human genome and their evolution with regard to their function of defending the organism against exogenous adversity.

15' 10. 5. 0

ACKNOWLEDGMENTS We thank Markus Beer for his expert technical assistance, Masaaki Kagimoto for stimulating discussions, and Roger Jenni and Reinhard Doelz for help with computer analysis of sequences. This work was supported by the Swiss National Science Foundation. REFERENCES

FIG. 6. Phylogenetic tree of the human C Y P 2 D genes and pseudogenes. Time since divergence is displayed by the length of the branches.

higher overall nucleotide substitution rate in pseudogenes, but the principal scenario of the evolution of these genes should be correct: A first gene duplication of a CYP2D6-1ike gene occurred about 18 million years ago and generated a CYP2D8, which probably was a functional gene for some million years. Once the gene was duplicated into two, a further increase in the number of genes was facilitated by unequal crossover events. About 9 million years ago, a second duplication of CYP2D6 leads to the CYP2D7, which probably became a pseudogene soon after. The resulting gene cluster is the prototype of the XbaI 29-kb fragment. An unequal crossover as proposed in Fig. 5 produced both the 11.5 and 44E haplotypes about 1 to 2 million years ago. At about the same time, gene conversion events may have introduced some of the mutations of CYP2D7P pseudogenes into CYP2D6, resulting in the mutant CYP2D6.B, which is found in over 70% of mutant alleles (Fig. 4). CYP2D6.A, finally, is the result of a relatively recent point mutation in CYP2D6. Poor metabolizers of debrisoquine have no apparent serious illnesses and according to present knowledge have no reproductive disadvantage. Does this mean that the CYP2D6 gene is on its way to being a pseudogene and that possibly it is predestined for extinction? It is likely that the ancestors of drug metabolizing enzymes evolved during so-called plant-animal warfare: As plants and animals diverged, animals began to ingest plants and plants defended themselves by developing new toxins (alkaloids, terpenes, etc.). In response, animals developed new P450s able to detoxify these "phytoalexins" (Gonzalez and Nebert, 1990). It is of interest that the preferred drug substrates and competitive inhibitors of CYP2D6 are plant alkaloids (sparteine, N-propylajmaline, codeine, quinidine) or are derived from plant components, as most drugs are (Fonne-Pfister and Meyer, 1988). Obviously, the present nutrition of Western societies no longer requires CYP2D6 activity. Could the low incidence of poor metabolizers in Chinese populations reflect variant dietary pressures and explain the interethnic difference in the CYP2D6 polymorphism?

Broly, F., Gaedigk, A., Heim, M. H., Eichelbaum, M., MSrike, K., and Meyer, U. A. (1991). Debrisoquine/sparteine hydroxylation genotype and phenotype. D N A Cell Biol. 10: 545-558. Devereux, T. J., Haeberli, P., and Smithies, O. (1984). A comprehensive set of sequence analysis programs for the VAX. Nucleic Acid Res. 12: 387-395. Fonn~-Pfister, R., and Meyer, U. A. (1988). Xenobiotic and endobiotic inhibitors of cytochrome P450db1 function, the target of the debrisoquine/sparteine type polymorphism. Biochem. Pharmacol. 37: 3829-3835. Frischauf, A. M., Lehrach, H., Poustka, A., and Murray, N. (1983). Lambda replacement vectors carrying polylinker sequences. J. Mol. Biol. 170: 827-842. Gaedigk, A., Blum, M., Gaedigk, R., Eichelbaum, M., and Meyer, U. A. (1991). Deletion of the entire cytochrome P450 CYP2D6 gene as a cause of impaired drug metabolism in poor metabolizers of the debrisoquine/sparteine polymorphism. Am. J. Hum. Genet. 48: 943950. Gonzalez, F. J., Vilbois, F., Hardwick, J. P., McBride, O. W., Nebert, D. W., Gelboin, H. V., and Meyer, U. A. (1988a). Human debrisoquine 4-hydroxylase (P450IID1): cDNA and deduced amino acid sequence and assignment of the CYP2D locus to chromosome 22. Genomics 2: 174-179. Gonzalez, F. J., Skoda, R. C., Kimura, S., Umeno, M., Zanger, U. M., Nebert, D. W., Gelboin, H. V., Hardwick, J. P., and Meyer, U. A. (1988b). Characterization of the common genetic defect in humans deficient in debrisoquine metabolism. Nature 331: 442-446. Gonzalez, F. J. (1989). The molecular biology of cytochrome P450s. Pharmacol. Rev. 40: 243-288. Gonzalez, F. J., and Nebert, D. W. (1990). Evolution of the P450 gene superfamily: Animal-plant "warfare," molecular drive and human genetic differences in drug oxidation. Trends Genet. 6: 182-186. Hanioka, N., Kimura, S., Meyer, U. A., and Gonzalez, F. J. (1990). The human CYP2D locus associated with a common genetic defect in drug oxidation: A G1934 --~ A base change in intron 3 of a mutant CYP2D6 allele results in an aberrant 3' splice recognition site. Am. J. Hum. Genet. 47: 994-1001. Heim, M. H., and Meyer, U. A. (1990). Genotyping of poor metabolizers of debrisoquine by allele-specific PCR amplification. Lancet 3 3 6 : 529-532. Henikoff, S. (1984). Undirectional digestion with exonuclease III creates targeted breakpoints for DNA sequencing. Gene 28: 351. Henthorn, P. S., Mager, D. L., Huisman, T. H. J., and Smithies, O. (1986). A gene deletion ending within a complex array of repeated sequences 3' to the human fl-globin gene cluster. Proc. Natl. Acad. Sci. USA 83: 5194-5198. Higashi, Y., Tanea, A., Inoue, H., and Fujii-Kuriyama, Y. (1988). Evidence for frequent gene conversion in the steroid 21-hydroxylase P-450(C21) gene: Implications for steroid 21-hydroxylase deftciency. Am. J. Hum. Genet. 42: 17-25. Johansson, I., Yue, Q. Y., Dahl, M. L., Heim, M. H., Sawe, J., Bertils-

58

HEIM AND MEYER

son, L., Meyer, U. A., SjSqvist, F., Ingelman-Sundberg, M. (1991). Genetic analysis of the interethnic difference between Chinese and Caucasians in the polymorphic metabolism of debrisoquine and codeine. Eur. J. Clin. Pharmacol. 40: 553-556. Kagimoto, M., Heim, M. H., Kagimoto, K., Zeugin, T., and Meyer, U.A. (1990). Multiple mutations of the human cytochrome P450IID6 gene (CYP2D6) in poor metabolizers of debrisoquine: Study of the functional significance of individual mutations by expression of chimeric genes. J. Biol. Chem. 2 6 5 : 17209-17214. Kalow, W. (1991). Interethnic variation of drug metabolism. Trends Pharmacol. Sci. 12: 102-107. Kimura, M. (1968). Evolutionary rate at the molecular level. Nature 217: 624-626. Kimura, S., Umeno, M., Skoda, R. C., Meyer, U. A., and Gonzalez, F . J . (1989). The human debrisoquine 4-hydroxylase (CYP2D) locus: Sequence and identification of the polymorphic CYP2D6 gene, a related gene and a pseudogene. Am. J. Hum. Genet. 45: 889-904. Li, W.-H., Luo, C.-C., and Wu, C.-I. (1985). Evolution of DNA sequences. In "Molecular Evolutionary Genetics" (R. J. MacIntyre, Ed.), Plenum, New York. Matsunaga, E., Zanger, U. M., Hardwick, J. P., Gelboin, H. V., Meyer, U. A., and Gonzalez, F. J. (1989). The CYP2D gene subfamily: Analysis of the molecular basis of the debrisoquine 4-hydroxylase deficiency in DA rats. Biochemistry 28: 7349-7355. Matsunaga, E., Umeno, M., and Gonzalez, F. J. (1990). The rat P450IID subfamily: Complete sequences of four closely linked genes and evidence that gene conversions maintained sequence homogeneity at the heme-binding region of the cytochrome P450 active site. J. Mol. Evol. 30: 155-169. Meyer, U. A., Zanger, U. M., Grant, D., and Blum, M. (1990). Genetic polymorphism of drug metabolism. In "Advances in Drug Research" (B. Testa, Ed.), Vol. 19, pp. 197-241, Academic Press, London. Nebert, D. W., and Gonzalez, F. J. (1987). P450 genes: Structure, evolution, and regulation. Annu. Rev. Biochem. 56: 945-993.

Nebert, D. W., Nelson, D. R., Coon, M. J., Estabrook, R. W., Feyereisen, R., Fujii-Kuriyama, Y., Gonzalez, F. J., Guengerich, F. P., Gunsalus, I. C., Johnson, E. F., Loper, J. C., Sato, R., Waterman, M. R., and Waxman, D. J. (1991). The P450 superfamily: Update on new sequences gene mapping, and recommended nomenclature. D N A 10: 1-14. Nei, M., and Gojobori, T. (1986). Simple methods for estimating the numbers of synonymous and nonsynonymous nucleotide substitutions. Mol. Biol. Evol. 3(5): 418-426. Nei, M. (1987). "Molecular Evolutionary Genetics," pp. 39-66, Columbia Univ. Press, New York. Roots, I., Drakoulis, N., and BrockmSller, J. (1992). Polymorphic enzymes and cancer risk: Concepts, methodology and data review. In "Pharmacogenetics of Drug Metabolism: International Encyclopedia of Pharmacology and Therapeutics" (Kalow, W., Ed.), Pergamon Press, New York. In press. Sanger, F., Nicklen, S., and Coulson, A. R. (1977). DNA sequencing with chain-terminating inhibitors. Proc. Natl. Acad. Sci. USA 74: 5463-5467. Skoda, R. C., Gonzalez, F. J., Demierre, A., and Meyer, U. A. (1988). Two mutant alleles of the human cytochrome P450db1 gene (P450IID1) associated with genetically deficient metabolism of debrisoquine and other drugs. Proc. Natl. Acad. Sci. USA 85: 52405343. Tyndale, R., Aoyama, T., Broly, F., Matsunaga, T., Inaba, T., Kalow, W., Gelboin, H. V., Meyer, U. A., and Gonzalez, F. J. (1991). Identification of a new variant CYP2D6 allele lacking the codon encoding Lys-281: Possible association with the poor metabolizer phenotype. Pharmacogenetics 1: 26-32. Wong, G., Itakura, T., Kawajiri, K., Skow, L., and Negishi, M. (1989). Gene family of male-specific testerone 16a-Hydroxylase (C-P-450 16,) in mice. J. Biol. Chem. 264: 2920-2927. Zhang, X. Y., Loflin, P. T., Gehrke, C. W., Andrews, P. A., and Ehrlich, M. (1987). Hypermethylation of human DNA sequences in embryonal carcinoma cells and somatic tissues but not in sperm. Nucleic Acids Res. 15: 9229-9449.