- Email: [email protected]
Expression and hormonal regulation of membrane progesterone receptors in human astrocytoma cells
Accepted Manuscript Title: Expression and hormonal regulation of membrane progesterone receptors in human astrocytoma cells Author: Paulina Valadez-Cosmes Liliana Germ´an-Castel´an Aliesha Gonz´alez-Arenas Marco A. Velasco-Vel´azquez Valeria Hansberg-Pastor Ignacio Camacho-Arroyo PII: DOI: Reference:
S0960-0760(15)30043-1 http://dx.doi.org/doi:10.1016/j.jsbmb.2015.08.006 SBMB 4469
To appear in:
Journal of Steroid Biochemistry & Molecular Biology
Received date: Revised date: Accepted date:
25-2-2015 22-7-2015 9-8-2015
Please cite this article as: Paulina Valadez-Cosmes, Liliana Germ´an-Castel´an, Aliesha Gonz´alez-Arenas, Marco A.Velasco-Vel´azquez, Valeria Hansberg-Pastor, Ignacio Camacho-Arroyo, Expression and hormonal regulation of membrane progesterone receptors in human astrocytoma cells, Journal of Steroid Biochemistry and Molecular Biology http://dx.doi.org/10.1016/j.jsbmb.2015.08.006 This is a PDF file of an unedited manuscript that has been accepted for publication. As a service to our customers we are providing this early version of the manuscript. The manuscript will undergo copyediting, typesetting, and review of the resulting proof before it is published in its final form. Please note that during the production process errors may be discovered which could affect the content, and all legal disclaimers that apply to the journal pertain.
Expression and hormonal regulation of membrane progesterone receptors in human astrocytoma cells
Paulina Valadez-Cosmes 1, Liliana Germán-Castelán1, Aliesha González-Arenas2, Marco A. Velasco-Velázquez3, Valeria Hansberg-Pastor4 and Ignacio CamachoArroyo 1* 1
Unidad de Investigación en Reproducción Humana, Instituto Nacional de
Perinatología-Facultad de Química, Universidad Nacional Autónoma de México (UNAM). 2Departamento de Medicina Genómica y Toxicología Ambiental, Instituto de Investigaciones Biomédicas, UNAM. 3Facultad de Medicina, UNAM. 4Facultad de Química, Departamento de Biología, UNAM, México, D.F., México.
*To whom correspondence should be addressed: Dr. Ignacio Camacho-Arroyo, Unidad de Investigación en Reproducción Humana, Instituto Nacional de Perinatología-Facultad de Química, Universidad Nacional Autónoma de México, Ciudad Universitaria, Av. Universidad 3000, Coyoacán 04510, México, D.F., México; Tel.: +52 55 5622 3732; E-mail address: [email protected] Highlights
U251 and U87 human astrocytoma cells express mPRα, mPRβ and mPRγ
mPRα and mPRβ are expressed in cell surface of U251 and U87 cells
mPRα and mPRβ are the predominant subtypes in U251 and U87 cells
Progesterone and estradiol decrease mPRα content in astrocytoma cells
Progesterone and estradiol increase mPRβ content in astrocytoma cells
1
Abstract Progesterone (P) participates in the regulation of the growth of several tumors, including astrocytomas, the most common and malignant human brain tumors. It has been reported that P induces astrocytomas growth in part by its interaction with its intracellular receptors (PR). Recently, it has been reported that membrane progesterone receptors (mPRs) are expressed in ovarian and breast cancer cells, and that P could exert some actions through these receptors, however, it is unknown whether mPRs are expressed in astrocytomas. In this work, U251 and U87 cell lines derived from human astrocytomas grade IV were used to study the expression, localization and hormonal regulation of three mPRs subtypes. Using RT-qPCR and Western blot techniques, we found that mPRα and mPRβ are clearly expressed at mRNA and protein levels in astrocytoma cells whereas mPRγ was barely expressed in these cells. Immunofluorescence staining showed that mPRα and mPRβ were mainly located in the cell surface. Flow cytometry assays demonstrated that in U251 and U87 cells, mPRβ is expressed by a higher percentage of both permeabilized and non-permeabilized cells as compared with mPRα. The percentage of cells expressing mPRγ was very low. P and estradiol (E) (10, 100 nM and 1 μM) decreased mPRα protein content at 12 h. In contrast, both P (100 nM and 1 µM) and E (10 and 100 nM) increased mPRβ content. Finally, by in silico analysis, we identified that mPRα, mPRβ and mPRγ promoters contain several progesterone and estrogen response elements. Our results indicate that mPRs are expressed in human astrocytoma cells, exhibiting a differential regulation by E and P. These data suggest that some P actions in astrocytoma cells may be mediated by mPRs.
Keywords: membrane progesterone receptors, astrocytomas, progesterone, estradiol, glioblastomas, brain tumors. 2
1. Introduction Astrocytomas are the most common and malignant primary brain tumors. They arise from glial progenitor cells, astrocytes, or transformed stem cells [1–3], and they are most frequently localized in the cerebral cortex of 40 to 60 years old individuals [4]. The World Health Organization classifies astrocytomas into four grades (I-IV) depending on their histopathological and molecular characteristics, being the grade IV (glioblastomas) the most malignant [5–7]. Many factors regulate the growth and invasion of astrocytomas, one of them is progesterone (P) [8], a steroid hormone derived from cholesterol and synthesized in the corpus luteum, adrenal cortex, placenta, neurons and glial cells [9,10]. It has been reported that progesterone (10 nM) increased the number of U373 and D54 cells derived from human astrocytomas grades III and grade IV, respectively [11]. It was also established that P increased S phase of cell cycle in U373 cells and that the increment in cell number was not due to a decrease in apoptosis [11]. In vivo data obtained in our laboratory indicated that P increased the tumor area and infiltration of U373 cells implanted in the motor cortex of adult male rats [12]. The mechanisms of P-elicited effects are classified as classical (genomic) and nonclassical (non-genomic). It has been reported that P can activate both mechanisms in the same cell [13], allowing a finer hormonal-regulation of diverse cellular functions. The genomic mechanism is involved in many P long-term effects, which are mediated by the intracellular progesterone receptor (PR), a ligand-regulated transcription factor that modulates the expression of its target genes [14]. On the other hand, non-genomic actions are generally rapid, independent of mRNA synthesis, and affect ionic conductance and activation of second messenger cascades. Several candidates have been proposed for mediating the non-genomic effects of P, including: a) classical steroid receptors localized in the plasma membrane and cytoplasm, b) ionic channels, c) modulatory sites located in neurotransmitter receptors, d) membrane proteins with steroid-binding domain, e) 3
growth factors and their receptors and f) membrane progesterone receptors (mPR) [13,15,16]. Intracellular PR isoforms expression has been reported in human astrocytomas and P actions in these cells have traditionally been attributed to various cellular events triggered after P binding to PR [8,17–19]. However, there is evidence that the use of the PR antagonist, RU486, results in only a partial decrease of P effects in proliferation of human astrocytoma cell lines [11] and in infiltration of human astrocytoma cells implanted in the rat cerebral cortex [12]. In addition, in the U373 cell line (human astrocytoma grade III), it has been observed that P (10 nM) exerts rapid effects (1 h) on the expression of progesterone-induced blocking factor (PIBF) [20]. Besides, a recent report by our group showed that different genes related with cell migration and metastasis are regulated by P (10 nM) in a RU486insensitive way, indicating that PR does not mediate those effects [21]. Therefore, it has been suggested that P should also act on astrocytoma cells through the interaction with membrane receptors. mPRs are seven-transmembrane proteins belonging to the Progestin and AdipoQ Receptor Family (PAQR) that are expressed in steroid target tissues [22]. They activate G proteins in several vertebrate cell types, although the nature of the coupled G protein depends on the mPR subtype and the cell [23]. Thus, mPRs participate in the regulation of intracellular signaling pathways involved in different functions [24]. To date, five subtypes of mPRs have been found in humans: mPRα (PAQR7), mPRβ (PAQR8), mPRγ (PAQR5), mPRδ (PAQR6) and mPRε (PAQR9), all of them belonging to class II PAQRs [25,26]. In humans, mPRα is the predominant subtype in testis, ovary and placenta; mPRβ was found to be mainly expressed in neuronal tissues, while mPRγ is present in kidney, lung and gastrointestinal tract [22,24]. Regarding mPRδ and mPRε, a recent study showed that both receptors are expressed in different regions of the human brain, and interestingly, mPRβ and mPRδ were the predominant subtypes [25]. In rodents, mPRs have a similar tissue distribution, however, mPRα has also been identified in different brain regions and the spinal cord, and mPRγ has been localized within the 4
ovary, fallopian tube, lung and liver, with a low expression in the spinal cord [27,28]. Recent studies suggest that mPRs participate in the development of cancer by regulating processes such as cell proliferation and apoptosis. Expression of mPRα, mPRβ and mPRγ has been confirmed in several breast and ovary cancer cell lines and tissues [29–33]. However, it is still unknown whether mPRs are expressed in astrocytoma cells, thus we aimed to investigate mPRs expression and regulation in U251 and U87 cells derived from human astrocytomas grades III and IV, respectively.
2. Experimental procedures 2.1 Cell culture U251 and U87 astrocytoma cell lines (ATCC, VA, USA) derived from human astrocytomas grade IV, respectively, were used. Cells were plated in 10 cm dishes and maintained in DMEM medium (In vitro, Mexico City, MEX), supplemented with 10% fetal bovine serum (FBS), 1 mM pyruvate, 2 mM glutamine, 0.1 mM nonessential amino acids (GIBCO, NY, USA) at 37°C under a 95% air and 5% CO2. DMEM medium was changed every 48 hours until reaching 70-80 % cellular confluence. 2.2 Treatments Cells were grown as described above and 24 hours before any treatment, the medium was changed for DMEM phenol red free medium supplemented with 10% fetal bovine serum without steroid hormones. In order to study the hormonal regulation of mPRs expression in U87 cells, the following treatments were applied for 12 and 24 h: (a) vehicle (V; 0.02% cyclodextrin in sterile water); (b) P-water soluble (P coupled to cyclodextrin; 10, 100 and 1000 nM in sterile water); (c) Ewater soluble (E coupled to cyclodextrin E; 10, 100 and 1000 nM in sterile water). Cyclodextrin, P coupled to cyclodextrin and E coupled to cyclodextrin were purchased from Sigma-Aldrich (St. Louis, MO). 5
2.3 Total RNA extraction and RT-qPCR Total RNA was isolated from U251 and U87 cells by the single-step method based on guanidine isothiocyanate/phenol/chloroform extraction according to the TRIzol reagent manufacturer’s protocol (Invi-trogen, CA, USA). RNA was quantified using the spectrophotometer NanoDrop 2000 (Thermo Scientific, MA, USA). The firststrand cDNA was synthesized from 2 μg of total RNA by using SuperScript II reverse transcription (Invitrogen, CA, USA) and oligo (dT)12–18 primers (Sigma– Aldrich, MO, USA) according to its protocol. 1 μL of cDNA was subjected to qPCR in order to simultaneously amplify a gene fragment of mPRα, mPRβ mPRγ and 18S ribosomal RNA. The sequences of the specific primers for mPRα amplification fragment were 5´- AACTGTCAAGGGAGGTGCTG -3´ in the sense primer and 5´ATTGCATCCAGGCCATAATC -3´ in the antisense; for mPRβ amplification fragment were 5´- AGGACACAGCAAACAGGACA -3´ in the sense and 5´GGCAACACAGGCAGGAATAA in the antisense; for the mPRγ amplification fragment were 5´- CTGAGGTAGGTGCGGTGTAGT -3´in the sense and 5´AGGAGGCTGAGGTGGAAAG -3´in the antisense; and for 18S amplification region were 5´-CGCGGTTCTATTTTGTTGGT -3´ in the sense and 5´- AGTCGGCATCGTTTATGGTC -3´ in the antisense (Sigma–Aldrich, MO, USA). SYBR Green qPCR Master Mix and the thermocycler LightCyclerR Roche FastStart (Roche Molecular
Biochemicals,
Manheim,
Germany)
were
used
according
to
manufacturer’s protocol version 18. The results were analyzed by the method of ΔCt [34,35] . The 18S ribosomal gene was used as an expression constitutive control and data obtained were normalized to this gene. As a negative control for all reactions, preparations lacking RNA were used. Three independent experiments were performed by duplicate for each sample.
2.4 Protein extraction and Western blotting 6
After treatments, cells were homogenized in RIPA lysis buffer with protease inhibitors (1mM EDTA, 2 µg/ml leupeptin, 2 µg/ml aprotinin, 1 mM PMSF). Proteins were obtained by centrifugation at 12,500 rpm, at 4°C for 15 min and quantified by using the Protein A280 method in a NanoDrop 2000 Spectrophotometer (Thermo Scientific, MA, USA). Proteins (100 µg) were separated by electrophoresis on 12% SDS-PAGE at 20mA. Colored markers (Bio-Rad, CA, USA) were included for molecular size determination. Gels were transferred to nitrocellulose membranes (Millipore, MA, USA) for 1 h (45 mA, at room temperature in semi-dry conditions). Membranes were blocked with 3% non-fat dry milk and 2% bovine serum albumin at room temperature for 2 h and then incubated with 1 µg/ml of one of the following antibodies: anti-mPRα (sc-50111, Santa Cruz Biotechnology, TX, USA), anti-mPRβ (sc-50109, Santa Cruz Biotechnology, TX, USA) and anti-mPRγ (sc-28019, Santa Cruz Biotechnology, TX, USA) at 4°C overnight. Blots were then incubated with a 1:35000 dilution of donkey anti-goat secondary antibody conjugated to horseradish peroxidase (Santa Cruz Biotechnology, TX, USA) for 1 h at room temperature. The specificity of the immunoreactions was confirmed by using the peptides employed (sc-50111P and sc-50109P Santa Cruz Biotechnology, TX, USA) to generate the antibodies in order to block mPR-antibody binding. For correcting differences in the total amount of protein loaded, mPR content was normalized to that of α-tubulin. Blots were stripped with glycine (0.1 M, pH 2.5, 0.5% SDS) at room temperature for 30 min, and incubated with 0.2 µg/ml of mouse anti-α-tubulin monoclonal antibody (sc-5286, Santa Cruz Biotechnology, TX, USA) at 4°C overnight. Blots were incubated with a 1:5000 dilution of a goat anti-mouse IgG coupled to horseradish peroxidase (Santa Cruz Biotechnology, TX, USA) at room temperature for 1 h. Bands were detected using a manual setting by enhanced chemiluminescence (ECL). Signals were detected exposing membranes to Kodak Biomax Light Film (Sigma-Aldrich, MO, USA) using Supersignal West Femto as peroxidase substrate (Thermo Scientific, MA, USA) with an exposure time of 5 min for mPRs and 2 min for α- tubulin. Exposure times yielded bands in the linear range. The antigen-antibody complex was detected as the area under 7
the peak corresponding to a band density (the area is given in inches with a default scale of 72 pixels/inch) using an HP Scanjet G3110 apparatus (Hewlett-Packard Company, CA, USA) and the ImageJ 1.45S software (National Institutes of Health, WA, USA). Four independent cultures for each experiment were done.
2.5 mPR localization by immunofluorescence U251and U87 cells were fixed for 20 min in 4% paraformaldehyde solution at room temperature. For intracellular localization, cells were permeabilized with 100% methanol at -20°C for 6 min, and for cell surface detection, non-permeabilized cells were used. Next, all samples were blocked with 1% Bovine Serum Albumin (BSA) in PBS at 37°C for 1 h and incubated at 4°C for 24 h with 4 µg/ml of goat antibodies against mPRα, mPRβ, or mPRγ (sc-50111, sc-50109, sc- 28019, respectively; Santa Cruz Biotechnology, TX, USA) in PBS with 0.5% BSA. Samples were rinsed three times in PBS for 5 min each and incubated in the dark with a 1:100 dilution of donkey anti-goat IgG-FITC secondary antibody (sc-2024, Santa Cruz Biotechnology, TX, USA) for 40 min at room temperature. Nuclei were stained with 1 µg/ml Hoechst 33342 solution (Thermo Scientific, IL, USA), and cells were coverslipped with a fluorescence-mounting medium (Biocare Medical, CA, USA). Samples were visualized in an Olympus Bx43 microscope (Olympus, PA, USA). Negative controls consisted of cells in which the primary antibody was omitted. 2.6 Flow cytometry mPRs protein expression in U251 and U87 cells was analyzed using specific antibodies for each receptor. 1x105 cells were scraped from culture plates, and washed with PBS. After low-speed centrifugation (250 g) to remove cellular debris and damaged cells, cells were resuspended in 200 µL PBS with 4% of FBS (P4F) and fixed in 4% paraformaldehyde solution at 37 °C f or 10 min. Next, cells were permeabilized or not with 100% methanol at 4°C for 30 min. After 4 min cold 8
centrifugation at 250 X g, samples were rinsed in P4F and were centrifuged again. Cells were resuspended in P4F and incubated with 4 µg/ml of goat antibodies against mPRα, mPRβ or mPRγ (sc-50111, sc-50109, sc-28019, respectively; Santa Cruz Biotechnology, TX, USA) for 30 min. Samples were rinsed in P4F for 5 min, centrifuged and incubated in the dark with donkey anti-goat IgG-FITC secondary antibody (sc-2024, Santa Cruz Biotechnology, TX, USA) for 20 min at 4°C. Cells were washed twice with P4F solution, resuspended in 200 µL P4F, and stored at 4°C for a maximum of 48 h before analysis on a FACS A ria III flow cytometer (BD Biosciences, NJ, USA). Autofluorescence of U251 and U87 cells and fluorescence of samples in which the primary antibody was omitted were analyzed for each independent experiment and used as negative controls. Data were analyzed with the FlowJo version 7.6.2 software (TreeStar, Inc., OR, USA), exported to Excel spreadsheets and subsequently analyzed using GraphPad Prism 5.0 (GraphPad Software, CA, USA).
2.7 Statistical analysis All data were analyzed and plotted using the GraphPad Prism 5.0 software (GraphPad Software, CA, USA). Statistical analysis between comparable groups was performed using a one-way ANOVA with a Dunnett post-test. A value of P<0.05 was considered statistically significant as stated in figure legends.
3. Results 3.1 Determination of mPRs mRNA and protein expression in human astrocytoma cell lines Using RT-qPCR technique, we established for the first time that human astrocytoma cells express mPRα and mPRβ. Interestingly, mPRα expression was higher in U251 and U87 cells as compared to that of mPRβ, being 4.5 times higher 9
in U251 cells and 3.2 times higher in U87 cells (Fig. 1A). In our conditions, it was not possible to amplify mPRγ cDNA which may indicate that there is a very low amount of this transcript in astrocytoma grade IV cells. Western blot analysis demonstrated the presence of main bands of 40 kD corresponding to mPRα, mPRβ and mPRγ in both U251 and U87 cells (Figs. B and C). We observed a similar protein expression pattern of all receptors in U251 and U87 cells; mPRβ and mPRα were the predominant subtypes in both cell lines, while mPRγ was barely detected in these cells. In some experiments, a band of 80 kD was also observed (data not shown), probably representing dimers, which have been described in other cell lines. Because of the polyclonal nature of antibodies used in Western blot experiments, we could observed unspecific bands, however, the specificity of 40 kD bands (arrows) were confirmed using blocking peptides for both mPRα and mPRβ (Supplemental Fig. 1).
3.2 mPRs localization in astrocytoma cells Cellular localization of mPRs in U251 (Fig. 2) and U87 (Fig. 3) cells was analyzed by immunofluorescence using specific antibodies against the N-terminal region of each receptor subtype. Immunofluorescence analysis of permeabilized cells showed positive staining of mPRα and mPRβ both in cytoplasm and nucleus, while staining of non-permeabilized cells resulted in a positive mark of both receptors in the surface of U251 and U87 cells (Figs. 2A/B and Figs. 3 A/B). Interestingly, in U251
and
U87
non-permeabilized
cells,
we
observed
punctated
immunofluorescence marks in cell surface compared with permeabilized cells that exhibited a more homogeneous staining. Both U251 and U87 cells showed a weak positive staining for mPRγ (Supplemental Fig. 2A) when compared with the negative controls. Negative controls were cells only incubated with the secondary antibody alone (Supplemental Fig. 2B).
10
3.3 mPRs expression and cell surface localization in astrocytoma cells Expression and cell surface localization of mPRs was confirmed by flow cytometry (Figs. 4A and 4B). Both permeabilized and non-permeabilized U251 and U87 cells incubated with N-terminal antibodies that recognize mPRα and mPRβ presented an increase in fluorescence compared with the negative control (cells not incubated with the primary antibody). Lower percentages of cells expressing mPRα (3% of U251 and 6% of U87 cells) or mPRβ (20% in U251 and 40% in U87 cells) were detected in non-permeabilized cells as compared with permeabilized ones (20% and 10 % for mPRα in U251 and U87 cells, respectively, and almost 100% for mPRβ in both cell lines). In contrast, mPRγ did not show a positive mark compared with control in any cell line. These results indicate the presence of mPRα and mPRβ proteins on the cytoplasm and surface of astrocytoma cells with an extracellular N-terminal orientation, and confirm our immunofluorescence results.
3.4 Hormonal regulation of mPRα and mPRβ in U87 cells To study P and E regulation of mPRα and mPRβ expression in U87 cells, Western blot assays were performed using total proteins extracted from cells treated with vehicle (V) or different concentrations of P (10 nM, 100 nM and 1 µM) or E (10 nM, 100 nM and 1 µM) for 12 or 24 h. mPRα protein content was reduced by E or P at 12 h independently of the concentration (Fig. 5A, left panel). This reduction was maintained after 24 h of E (100 nM and 1 μM) treatment (Fig. 5A, right panel). On the contrary, mPRβ protein content was increased after P (100 nM and 1 μM) and E (10 and 100 nM) treatments at 12 h, whereas neither E nor P significantly modified mPRβ content at 24 h (Fig. 5B). These results indicate a differential regulation of mPRα and mPRβ expression in U87 astrocytoma cells.
11
3.5 Prediction of PRE and ERE in mPRs promoters by an in silico analysis mPRα, mPRβ and mPRγ promoter sequences (1000 bp upstream of the transcription start site) were obtained by the Eukaryotic Promoter Database (EPD) [31] and were confirmed by BLAST analysis (http://www.ncbi.nlm.nih.gov/BLAST/). Some promoter characteristics as TATA-box, CG-box and CCAAT-box were also predicted by EPD (Fig. 6). By using JASPAR database, Genomatix-MatInspector and NUBIscan software [36–38]; we identified in silico that all mPRs promoters in study have potential progesterone response elements (PRE) and estrogen response elements (ERE): mPRα contains 5 PRE and 5 ERE, mPRβ contains 3 PRE and 1 ERE, and mPRγ contains 6 PRE and 3 ERE (Fig. 6). All PRE and ERE identified, present a relative score of 0.8 or higher which indicate the similitude with the PRE or ERE consensus sequences (Suppl. Fig. 3). In all cases, we established as potential PRE or ERE, those sequences found in two or more of the three databases and software used.
4. Discussion In this study we demonstrated for the first time the expression, cellular localization and hormonal regulation of mPRs subtypes in astrocytoma cells. By RT-qPCR we established that mPRα and mPRβ are expressed in U251 and U87 cells being mPRα the predominant subtype in both cell lines at mRNA level. Western blot using specific mPRα, mPRβ and mPRγ antibodies confirmed the expression of the three mPRs subtypes in U251 and U87 cells with molecular masses of approximately 40 kD as it has been reported in other cell types [39,40]. Using an immunofluorescence approach we showed that in permeabilized cells, mPRα and mPRβ proteins are widely expressed in the cytoplasm and nucleus of U251 and U87 cells. This result is not unexpected, since mPR synthesis involves several organelles including endoplasmic reticulum, Golgi apparatus and secretory vesicles. Therefore, a high fluorescent mark in cytoplasm may be due to the 12
synthesis or degradation pathway of membrane receptors. Importantly, in nonpermeabilized U251 and U87 cells, a positive fluorescence signal was detected in the cell surface, indicating that mPRα and mPRβ are expressed in the membrane of astrocytoma cells as it has been widely reported in other models such as human myometrium, mouse spinal cord and breast cancer cells [30,39,41]. Interestingly, a recent study showed that in several breast cancer cell lines, mPRα and progesterone receptor membrane component 1 (PGRMC1) are closely associated, suggesting that PGRMC1 acts like an adaptor protein that transports mPRα to the cell surface and that mPRα and PGRMC1 are components of a membrane progesterone receptor protein complex [42]. Due to the above, it is possible that PGRMC1 contributes to plasma membrane expression of mPRs in astrocytoma cells, which is an interesting topic for further research. By flow cytometry we determined that mPRβ was present in a higher number of U251 and U87 cells as compared with mPRα both at intracellular and membrane levels. mPRα also exhibited a higher expression when compared to the negative control, while mPRγ expression was extremely low. A comparison between mPRs expression in human normal astrocytes and in astrocytoma cells could be important to determine if the expression pattern of these receptors is different depending on the cancer or the physiological status. Above results agree with other reports in which mPRβ is the predominant mPR in different human and rodent brain regions such as cerebral cortex, cerebellum, pituitary, thalamus, hypothalamus and caudate nucleus [22,43]. In contrast, mPRα is predominantly expressed in human reproductive tissues, though some recent studies have reported its expression in cerebral cortex, hippocampus, thalamus, hypothalamus and cerebellum of rat and mouse [41,44,45]. Another study shows that in a mouse neuroblastoma cell line, mPRα and mPRβ are expressed at mRNA level [44]. Besides, an interesting report suggests that mPRα is expressed in some neurons of the frontal and pyriform cortex, different hypothalamic nuclei, hippocampus and striatum of male rats, but neither in oligodendrocytes nor in astrocytes, however, after a traumatic brain injury, mPRα expression is induced in 13
oligodendrocytes, astrocytes and the reactive glia [41]. Similarly, it has been reported that mPRα and mPRβ proteins are expressed in mouse spinal cord, and interestingly, double immunofluorescence staining showed that mPRα is expressed in neurons, astrocytes and oligodendrocytes, while mPRβ is expressed in neurons but not in glia cells [28]. In addition, mPRα, mPRβ and mPRγ expression has been reported in human breast cancer and in several cancer cell lines, including PR-positive MCF-7 cells, and PR-negative SKBR3, MDA-MB-231 and MDA-Mb-468 as well as in ovarian cancer cells and tumors [29,30,33,46]. Importantly, mPRα expression is elevated in ovarian and breast tumors compared with normal tissues, suggesting that mPRs should have an important participation in cancer [33,46]. Sex hormones have a key role in the regulation of different processes including gene expression of their own receptors. Previous reports of our laboratory shown that in astrocytoma cell lines, E increases PR expression at protein level and P is able to decrease E-induced PR expression [17]. Our findings are the first to show that female sex steroids regulate mPRα and mPRβ expression in astrocytoma cells. In the present work we demonstrate that in U87 cells, mPRα and mPRβ proteins are differentially regulated by E and P, mPRα was downregulated by E and P at 12 and 24 h, whereas mPRβ was upregulated by both hormones at 12 h. These results suggest that despite their structural similarities, mPRα and mPRβ have distinct roles in astrocytomas, and that sex hormones regulate their function by differently modifying their expression. It is important to note that both PR and estrogen receptor (ER) expression in U251 and U87 astrocytoma cells has been previously reported, and the in silico analysis performed by our group showed for the first time that human mPRα and mPRβ promoter regions contain putative estrogen response elements (ERE) and progesterone response elements (PRE) (Fig. 6 and Supplemental Fig. 2), however, further studies are required to elucidate the functional relevance of these regulatory elements. In fact, ERE and PRE have been reported in promoter regions of mPRα, mPRβ and mPRγ of catfish [47].
14
Therefore, it is possible that the hormonal regulation of mPRs involves PR and/or ER actions. Diverse results have been reported regarding the hormonal-regulation of mPRs, depending on the animal model, target organ, dosing schedule or hormone concentrations. Moreover, most research about mPRs hormonal-regulation has been performed in physiological models and to date apart from this work there are no reports about this topic in cancer. In the CNS, one study revealed that in the median septum of ovariectomized rats, 48 h of E treatment increases mPRβ protein level [43]. Similarly, using quantitative PCR, Inteklofer and Petersen reported an upregulation of mPRβ, but no mPRα mRNA in the anteroventral periventricular nucleus (AVPV), ventromedial nucleus and sexually dimorphic nucleus of the preoptic area after implanted E-containing capsules for a longer than 56-h exposure in female rats, while in the same model, P repressed mPRβ gene expression only in AVPV [48]. It has been shown that mRNA levels of mPRα and mPRβ varied during estrous cycle in the mediobasal hypothalamus of cycling rats, being higher on pro-oestrous and decreasing on estrous which is consistent with the up-regulation by E and subsequent down-regulation by P [45]. In this respect, E has also been shown to up-regulate PRα and mPRβ subtypes in the human myometrium [39]. Few reports have analyzed the role of mPRs in cancer progression, however, a recent study suggest that mPRα should mediate P effects on cell death in breast cancer since P or an specific mPR agonist, 10-ethenyl-19-norprogesterone (Org OD 02-0), significantly decreased cell death and apoptosis in response to serum starvation in two breast cancer cell lines, and the knockdown of mPRα in these cells blocked the inhibitory effects of P on cell death [49]. This report concurs with others studies suggesting that apoptosis inhibition produced by P in teleost granulosa cells and Jurkat cells are also mediated through mPRα [50,51]. Interestingly, other mPR subtype, mPRδ, could regulate neuroprotective actions of allopregnanolone and P by exerting antiapoptotic actions in hippocampal neuronal cells [25]. Besides, it has been reported that in breast cancer cells, mPRs are 15
capable to initiate intracellular signaling pathways involved in growth and development of breast cancer such as MAPK/Erk and Akt/PI3K [23,52]. In an interesting study, it has been suggested that in human myometrial cells, activation of an mPR pathway results in an altered PR transactivation, suggesting a crosstalk between both progestin receptors [39], which open an attractive topic for further research about P actions in human astrocytoma cells. Regarding to the functions of mPRs in ovarian cancer, it has been suggested that contrary to breast cancer, mPRα should mediate protective role of P against this disease upregulating the expression of pro-apoptotic markers [29]. In conclusion, our data indicate that human astrocytoma cells express mPRα, mPRβ and mPRγ, showing a high content and a clear membrane localization of mPRα and mPRβ. Besides, in the U87 cell line, mPRβ and mPRα expression is differentially regulated by E and P. These results open a new interesting research field in the study of the mechanisms of P action in human astrocytomas, and the participation of mPRs in cancer events such as cell proliferation, apoptosis and migration. Acknowledgements We want to thank MSc Emiliano Hisaki from Facultad de Medicina, Universidad Nacional Autónoma de México for his technical support. This work was supported by Grant No. 250866 from Consejo Nacional de Ciencia y Tecnología, México.
References [1]
D. Friedmann-Morvinski, E.A. Bushong, E. Ke, Y. Soda, T. Marumoto, O. Singer, et al., Dedifferentiation of neurons and astrocytes by oncogenes can induce gliomas in mice, Science. 338 (2012) 1080–1084.
[2]
S. Alcantara Llaguno, J. Chen, C.H. Kwon, E.L. Jackson, Y. Li, D.K. Burns, et al., Malignant astrocytomas originate from neural stem/progenitor cells in a somatic tumor suppressor mouse model, Cancer Cell. 15 (2009) 45–56. 16
[3]
L. Cheng, S. Bao, J.N. Rich, Potential therapeutic implications of cancer stem cells in glioblastoma, Biochem. Pharmacol. 80 (2010) 654–665.
[4]
H. Ohgaki, P. Kleihues, Epidemiology and etiology of gliomas, Acta Neuropathol. 109 (2005) 93–108.
[5]
C. Daumas-Duport, B. Scheithauer, J. O’Fallon, P. Kelly, Grading of astrocytomas. A simple and reproducible method, Cancer. 62 (1988) 2152– 2165.
[6]
D.N. Louis, Molecular pathology of malignant gliomas, Annu. Rev. Pathol. 1 (2006) 97–117.
[7]
F.B. Furnari, T. Fenton, R.M. Bachoo, A. Mukasa, J.M. Stommel, A. Stegh, et al., Malignant astrocytic glioma: genetics, biology, and paths to treatment, Genes Dev. 21 (2007) 2683–2710.
[8]
E. Cabrera-Muñoz, O.T. Hernández-Hernández, I. Camacho-Arroyo, Role of progesterone in human astrocytomas growth, Curr Top Med Chem. 11 (2011) 1663–1667.
[9]
J.D. Graham, C.L. Clarke, Physiological action of progesterone in target tissues, Endocr Rev. 18 (1997) 502–519.
[10] M. Schumacher, R. Hussain, N. Gago, J.P. Oudinet, C. Mattern, A.M. Ghoumari, Progesterone synthesis in the nervous system: implications for myelination and myelin repair, Front Neurosci. 6 (2012) 10. [11] G. González-Agüero, A.A. Gutiérrez, D. González-Espinosa, J.D. Solano, R. Morales, A. González-Arenas, et al., Progesterone effects on cell growth of U373 and D54 human astrocytoma cell lines, Endocrine. 32 (2007) 129–135. [12] L. Germán-Castelán, J. Manjarrez-Marmolejo, A. González-Arenas, M.G. González-Morán, I. Camacho-Arroyo, Progesterone induces the growth and infiltration of human astrocytoma cells implanted in the cerebral cortex of the rat, Biomed Res. Int. 2014 (2014) 393174. [13] T. Simoncini, A.R. Genazzani, Non-genomic actions of sex steroid hormones, Eur. J. Endocrinol. 148 (2003) 281–292. [14] D.L. Bain, A.F. Heneghan, K.D. Connaghan-Jones, M.T. Miura, Nuclear receptor structure: implications for function, Annu. Rev. Physiol. 69 (2007) 201–220.
17
[15] V. Boonyaratanakornkit, Y. Bi, M. Rudd, D.P. Edwards, The role and mechanism of progesterone receptor activation of extra-nuclear signaling pathways in regulating gene transcription and cell cycle progression, Steroids. 73 (2008) 922–928. [16] A. Wendler, C. Albrecht, M. Wehling, Nongenomic actions of aldosterone and progesterone revisited, Steroids. (2012) 1002–1006. [17] E. Cabrera-Muñoz, A. González-Arenas, M. Saqui-Salces, J. Camacho, F. Larrea, R. García-Becerra, et al., Regulation of progesterone receptor isoforms content in human astrocytoma cell lines, J Steroid Biochem Mol Biol. 113 (2009) 80–84. [18] A. González-Arenas, O. Villamar-Cruz, C. Guerra-Araiza, I. CamachoArroyo, Regulation of progesterone receptor isoforms expression by sex steroids in the rat lung, J Steroid Biochem Mol Biol. 85 (2003) 25–31. [19] G. González-Agüero, R. Ondarza, A. Gamboa-Domónguez, M.A. Cerbón, I. Camacho-Arroyo, Progesterone receptor isoforms expression pattern in human astrocytomas, Brain Res Bull. 56 (2001) 43–48. [20] A. González-Arenas, P. Valadez-Cosmes, C. Jiménez-Arellano, M. LópezSánchez, I. Camacho-Arroyo, Progesterone-induced blocking factor is hormonally regulated in human astrocytoma cells, and increases their growth through the IL-4R/JAK1/STAT6 pathway, J Steroid Biochem Mol Biol. 144 (2014) 463–470. [21] A. González-Arenas, A. Cabrera-Wrooman, N. Fabián Díaz, T.K. GonzálezGarcía, I. Salido-Guadarrama, M. Rodríguez-Dorantes, et al., Progesterone receptor subcellular localization and gene expression profile in human astrocytoma cells are modified by progesterone, Nucl. Recept. Res. 1 (2014) 1–10. [22] Y. Zhu, J. Bond, P. Thomas, Identification, classification, and partial characterization of genes in humans and other vertebrates homologous to a fish membrane progestin receptor, Proc. Natl. Acad. Sci. U. S. A. 100 (2003) 2237–2242. [23] Y. Zhu, C.D. Rice, Y. Pang, M. Pace, P. Thomas, Cloning, expression, and characterization of a membrane progestin receptor and evidence it is an intermediary in meiotic maturation of fish oocytes, Proc. Natl. Acad. Sci. U. S. A. 100 (2003) 2231–2236.
18
[24] P. Thomas, Y. Pang, J. Dong, P. Groenen, J. Kelder, J. de Vlieg, et al., Steroid and G protein binding characteristics of the seatrout and human progestin membrane receptor alpha subtypes and their evolutionary origins, Endocrinology. 148 (2007) 705–718. [25] Y. Pang, J. Dong, P. Thomas, Characterization, neurosteroid binding and brain distribution of human membrane progesterone receptors δ and {epsilon} (mPRδ and mPR{epsilon}) and mPRδ involvement in neurosteroid inhibition of apoptosis, Endocrinology. 154 (2013) 283–95. [26] Y.T. Tang, T. Hu, M. Arterburn, B. Boyle, J.M. Bright, P.C. Emtage, et al., PAQR proteins: a novel membrane receptor family defined by an ancient 7transmembrane pass motif, J. Mol. Evol. 61 (2005) 372–380. [27] M. Nutu, B. Weijdegård, P. Thomas, C. Bergh, A. Thurin-Kjellberg, Y. Pang, et al., Membrane progesterone receptor gamma: tissue distribution and expression in ciliated cells in the fallopian tube, Mol. Reprod. Dev. 74 (2007) 843–850. [28] F. Labombarda, D. Meffre, B. Delespierre, S. Krivokapic-Blondiaux, A. Chastre, P. Thomas, et al., Membrane progesterone receptors localization in the mouse spinal cord, Neuroscience. 166 (2010) 94–106. [29] N.J. Charles, P. Thomas, C.A. Lange, Expression of membrane progesterone receptors (mPR/PAQR) in ovarian cancer cells: implications for progesterone-induced signaling events, Horm. Cancer. 1 (2010) 167–176. [30] G.E. Dressing, P. Thomas, Identification of membrane progestin receptors in human breast cancer cell lines and biopsies and their potential involvement in breast cancer, Steroids. 72 (2007) 111–116. [31] Y. Pang, P. Thomas, Progesterone signals through membrane progesterone receptors (mPRs) in MDA-MB-468 and mPR-transfected MDA-MB-231 breast cancer cells which lack full-length and N-terminally truncated isoforms of the nuclear progesterone receptor, Steroids. 76 (2011) 921–928. [32] L. Zuo, W. Li, S. You, Progesterone reverses the mesenchymal phenotypes of basal phenotype breast cancer cells via a membrane progesterone receptor mediated pathway, Breast Cancer Res. 12 (2010) R34. [33] M. Xie, X. Zhu, Z. Liu, M. Shrubsole, V. Varma, I.A. Mayer, et al., Membrane progesterone receptor alpha as a potential prognostic biomarker for breast cancer survival: A retrospective study, PLoS One. 7 (2012) e35198.
19
[34] M.W. Pfaffl, M.W. Pfaffl, A new mathematical model for relative quantification in real-time RT-PCR, Nucleic Acids Res. 29 (2001) e45. [35] T.D. Schmittgen, K.J. Livak, Analyzing real-time PCR data by the comparative C(T) method, Nat. Protoc. 3 (2008) 1101–1108. [36] M. Podvinec, M.R. Kaufmann, C. Handschin, U.A. Meyer, NUBIScan, an in silico approach for prediction of nuclear receptor response elements, Mol. Endocrinol. 16 (2002) 1269–1279. [37] A. Sandelin, W. Alkema, P. Engström, W.W. Wasserman, B. Lenhard, JASPAR: an open-access database for eukaryotic transcription factor binding profiles, Nucleic Acids Res. 32 (2004) D91–D94. [38] K. Cartharius, K. Frech, K. Grote, B. Klocke, M. Haltmeier, A. Klingenhoff, et al., MatInspector and beyond: promoter analysis based on transcription factor binding sites, Bioinformatics. 21 (2005) 2933–2942. [39] E. Karteris, S. Zervou, Y. Pang, J. Dong, E.W. Hillhouse, H.S. Randeva, et al., Progesterone signaling in human myometrium through two novel membrane G protein-coupled receptors: potential role in functional progesterone withdrawal at term, Mol. Endocrinol. 20 (2006) 1519–1534. [40] C. Dosiou, A.E. Hamilton, Y. Pang, M.T. Overgaard, S. Tulac, J. Dong, et al., Expression of membrane progesterone receptors on human T lymphocytes and Jurkat cells and activation of G-proteins by progesterone, J. Endocrinol. 196 (2008) 67–77. [41] D. Meffre, F. Labombarda, B. Delespierre, a Chastre, a F. De Nicola, D.G. Stein, et al., Distribution of membrane progesterone receptor alpha in the male mouse and rat brain and its regulation after traumatic brain injury, Neuroscience. 231 (2012) 111-124. [42] P. Thomas, Y. Pang, J. Dong, Enhancement of cell surface expression and receptor functions of membrane progestin receptor α (mPRα) by progesterone receptor membrane component 1 (PGRMC1): evidence for a role of PGRMC1 as an adaptor protein for steroid receptors, Endocrinology. 155 (2014) 1107–1119. [43] D.G. Zuloaga, S.L. Yahn, Y. Pang, A.M. Quihuis, M.G. Oyola, A. Reyna, et al., Distribution and estrogen regulation of membrane progesterone receptorbeta in the female rat brain, Endocrinology. 153 (2012) 4432–4443.
20
[44] N. Sleiter, Y. Pang, C. Park, T.H. Horton, J. Dong, P. Thomas, et al., Progesterone receptor A (PRA) and PRB-independent effects of progesterone on gonadotropin-releasing hormone release, Endocrinology. 150 (2009) 3833–3844. [45] B. Liu, L.A. Arbogast, Gene expression profiles of intracellular and membrane progesterone receptor isoforms in the mediobasal hypothalamus during pro-oestrus, J. Neuroendocrinol. 21 (2009) 993–1000. [46] M. Romero-Sánchez, S.C. Peiper, B. Evans, Z. Wang, L. Catasús, A. Ribe, et al., Expression profile of heptahelical putative membrane progesterone receptors in epithelial ovarian tumors, Hum. Pathol. 39 (2008) 1026–1033. [47] Y. Kazeto, R. Goto-Kazeto, P. Thomas, J.M. Trant, Molecular characterization of three forms of putative membrane-bound progestin receptors and their tissue-distribution in channel catfish, Ictalurus punctatus, J. Mol. Endocrinol. 34 (2005) 781–791. [48] K.A. Intlekofer, S.L. Petersen, 17β-estradiol and progesterone regulate multiple progestin signaling molecules in the anteroventral periventricular nucleus, ventromedial nucleus and sexually dimorphic nucleus of the preoptic area in female rats, Neuroscience. 176 (2011) 86–92. [49] G.E. Dressing, P. Thomas, Y. Pang, R. Alyea, Membrane progesterone receptors (mPRs) Mediate progestin induced antimorbidity in breast cancer cells and are expressed in human breast tumors, Horm. Cancer. 3 (2012) 101–112. [50] G.E. Dressing, Y. Pang, J. Dong, P. Thomas, Progestin signaling through mPRα in atlantic croaker granulosa/theca cell cocultures and its involvement in progestin inhibition of apoptosis, Endocrinology. 151 (2010) 5916–5926. [51] A. Kon, B. Yuan, T. Hanazawa, H. Kikuchi, M. Sato, R. Furutani, et al., Contribution of membrane progesterone receptor α to the induction of progesterone-mediated apoptosis associated with mitochondrial membrane disruption and caspase cascade activation in Jurkat cell lines, Oncol. Rep. 30 (2013) 1965–1970. [52] M. Alkhalaf, A.M. El-Mowafy, Overexpression of wild-type p53 gene renders MCF-7 breast cancer cells more sensitive to the antiproliferative effect of progesterone., J. Endocrinol. 179 (2003) 55–62.
21
Figure captions: Fig. 1. mPRs mRNA and protein expression in human astrocytoma cell lines. RNA extraction following by RT-qPCR were carried out in U251 and U87 cells. Three independent experiments were performed by duplicate for each sample. mPRs relative expression (normalized to 18S ribosomal RNA expression) is showed. Results are expressed as the mean ± S.E.M. (∗) p < 0.01 vs mPRβ (A). U251 (B) and U87 (C) cells were lysed and proteins (100 μg) were separated by electrophoresis in 12% SDS-PAGE gel, transferred to a nitrocellulose membrane and incubated with antibodies against mPRα, mPRβ or mPRγ. ECL was used for protein-antibody complex detection. Blots were stripped and incubated with an anti α-tubulin antibody and detected by ECL. Representative Western blots of 3 independent experiments are shown. The bands representing mPRs expression are indicated by arrows.
Fig. 2. mPRs cellular localization in U251 astrocytoma cells. Cells were fixed with paraformaldehyde and permeabilized or not with methanol. Immunofluorescence was performed using specific primary antibodies that recognize the N-terminal region of mPRα (A) or mPRβ (B), and secondary antibodies coupled to FITC. Images for the nuclear staining with Hoechst (left), mPRs positive cells (middle) and merge (right) are shown. All images have an amplification of 600X, and all experiments were done in triplicate.
Fig. 3. mPRs cellular localization in U87 astrocytoma cells. Immunolocalization of mPRα (A) or mPRβ (B) in U87 cells. Hoechst (left), mPRs positive cells (middle) and merge (right) are shown. All images have an amplification of 600X, and all experiments were done in triplicate.
22
Fig. 4. mPRs protein expression and cell surface localization in U251 and U87 astrocytoma cells. U251 (A) and U87 (B) cells were fixed and permeabilized as described in Experimental procedures. Flow cytometry using specific primary antibodies against the N-terminal region of mPRα, mPRβ or mPRγ, and secondary antibodies coupled to FITC was performed. Upper panels: representative histograms of control samples (dotted lines) or mPRs-stained samples, in permeabilized and non-permeabilized cells (solid lines). Lower panels show the relative FITC signal representing mPRs expression after performing four independent
flow
cytometry
experiments
with
permeabilized
and
non-
permeabilized cells. The results are expressed as the mean ± S.E.M. In all panels (∗) p<0.05, (∗∗) p<0.001 and (∗∗∗) p<0.0001 compared with the negative control.
Fig. 5. P and E effects on mPRα and mPRβ protein content in U87 human astrocytoma cells. Cells were lysed after treatments with P or E (10 nM, 100 nM and 1 μM) during 12 or 24 h. Proteins (100 μg) were separated by electrophoresis on 12% SDS-PAGE gel, transferred to a nitrocellulose membrane and incubated with an antibody against mPRα or mPRβ. ECL was used for protein-antibody complex detection. A representative Western blot (upper panels) and the densitometric analysis (lower panels) of mPRα (A) and mPRβ (B) content relative to α-tubulin in U87 cells are shown. Results are expressed as the mean ± S.E.M., n = 4; (∗) p<0.05 and (∗∗) p<0.01 compared with vehicle (V). Fig. 6. In silico analysis of mPRs promoters. Continuous lines represent mPRα, mPRβ and mPRγ promoter sequences. Glucocorticoid/progesterone response elements (GRE/PRE) and estrogen response elements (ERE) are highlighted in grey and black boxes, respectively, if they are above the baseline it means they are located in sense orientation, whereas if they are below the baseline they are located in antisense orientation. Transcription start site (TSS). TATA-box, CG-box and CCAAT-box are also identified in the image.
23
24
25
26
27
28
29
S0960-0760(15)30043-1 http://dx.doi.org/doi:10.1016/j.jsbmb.2015.08.006 SBMB 4469
To appear in:
Journal of Steroid Biochemistry & Molecular Biology
Received date: Revised date: Accepted date:
25-2-2015 22-7-2015 9-8-2015
Please cite this article as: Paulina Valadez-Cosmes, Liliana Germ´an-Castel´an, Aliesha Gonz´alez-Arenas, Marco A.Velasco-Vel´azquez, Valeria Hansberg-Pastor, Ignacio Camacho-Arroyo, Expression and hormonal regulation of membrane progesterone receptors in human astrocytoma cells, Journal of Steroid Biochemistry and Molecular Biology http://dx.doi.org/10.1016/j.jsbmb.2015.08.006 This is a PDF file of an unedited manuscript that has been accepted for publication. As a service to our customers we are providing this early version of the manuscript. The manuscript will undergo copyediting, typesetting, and review of the resulting proof before it is published in its final form. Please note that during the production process errors may be discovered which could affect the content, and all legal disclaimers that apply to the journal pertain.
Expression and hormonal regulation of membrane progesterone receptors in human astrocytoma cells
Paulina Valadez-Cosmes 1, Liliana Germán-Castelán1, Aliesha González-Arenas2, Marco A. Velasco-Velázquez3, Valeria Hansberg-Pastor4 and Ignacio CamachoArroyo 1* 1
Unidad de Investigación en Reproducción Humana, Instituto Nacional de
Perinatología-Facultad de Química, Universidad Nacional Autónoma de México (UNAM). 2Departamento de Medicina Genómica y Toxicología Ambiental, Instituto de Investigaciones Biomédicas, UNAM. 3Facultad de Medicina, UNAM. 4Facultad de Química, Departamento de Biología, UNAM, México, D.F., México.
*To whom correspondence should be addressed: Dr. Ignacio Camacho-Arroyo, Unidad de Investigación en Reproducción Humana, Instituto Nacional de Perinatología-Facultad de Química, Universidad Nacional Autónoma de México, Ciudad Universitaria, Av. Universidad 3000, Coyoacán 04510, México, D.F., México; Tel.: +52 55 5622 3732; E-mail address: [email protected] Highlights
U251 and U87 human astrocytoma cells express mPRα, mPRβ and mPRγ
mPRα and mPRβ are expressed in cell surface of U251 and U87 cells
mPRα and mPRβ are the predominant subtypes in U251 and U87 cells
Progesterone and estradiol decrease mPRα content in astrocytoma cells
Progesterone and estradiol increase mPRβ content in astrocytoma cells
1
Abstract Progesterone (P) participates in the regulation of the growth of several tumors, including astrocytomas, the most common and malignant human brain tumors. It has been reported that P induces astrocytomas growth in part by its interaction with its intracellular receptors (PR). Recently, it has been reported that membrane progesterone receptors (mPRs) are expressed in ovarian and breast cancer cells, and that P could exert some actions through these receptors, however, it is unknown whether mPRs are expressed in astrocytomas. In this work, U251 and U87 cell lines derived from human astrocytomas grade IV were used to study the expression, localization and hormonal regulation of three mPRs subtypes. Using RT-qPCR and Western blot techniques, we found that mPRα and mPRβ are clearly expressed at mRNA and protein levels in astrocytoma cells whereas mPRγ was barely expressed in these cells. Immunofluorescence staining showed that mPRα and mPRβ were mainly located in the cell surface. Flow cytometry assays demonstrated that in U251 and U87 cells, mPRβ is expressed by a higher percentage of both permeabilized and non-permeabilized cells as compared with mPRα. The percentage of cells expressing mPRγ was very low. P and estradiol (E) (10, 100 nM and 1 μM) decreased mPRα protein content at 12 h. In contrast, both P (100 nM and 1 µM) and E (10 and 100 nM) increased mPRβ content. Finally, by in silico analysis, we identified that mPRα, mPRβ and mPRγ promoters contain several progesterone and estrogen response elements. Our results indicate that mPRs are expressed in human astrocytoma cells, exhibiting a differential regulation by E and P. These data suggest that some P actions in astrocytoma cells may be mediated by mPRs.
Keywords: membrane progesterone receptors, astrocytomas, progesterone, estradiol, glioblastomas, brain tumors. 2
1. Introduction Astrocytomas are the most common and malignant primary brain tumors. They arise from glial progenitor cells, astrocytes, or transformed stem cells [1–3], and they are most frequently localized in the cerebral cortex of 40 to 60 years old individuals [4]. The World Health Organization classifies astrocytomas into four grades (I-IV) depending on their histopathological and molecular characteristics, being the grade IV (glioblastomas) the most malignant [5–7]. Many factors regulate the growth and invasion of astrocytomas, one of them is progesterone (P) [8], a steroid hormone derived from cholesterol and synthesized in the corpus luteum, adrenal cortex, placenta, neurons and glial cells [9,10]. It has been reported that progesterone (10 nM) increased the number of U373 and D54 cells derived from human astrocytomas grades III and grade IV, respectively [11]. It was also established that P increased S phase of cell cycle in U373 cells and that the increment in cell number was not due to a decrease in apoptosis [11]. In vivo data obtained in our laboratory indicated that P increased the tumor area and infiltration of U373 cells implanted in the motor cortex of adult male rats [12]. The mechanisms of P-elicited effects are classified as classical (genomic) and nonclassical (non-genomic). It has been reported that P can activate both mechanisms in the same cell [13], allowing a finer hormonal-regulation of diverse cellular functions. The genomic mechanism is involved in many P long-term effects, which are mediated by the intracellular progesterone receptor (PR), a ligand-regulated transcription factor that modulates the expression of its target genes [14]. On the other hand, non-genomic actions are generally rapid, independent of mRNA synthesis, and affect ionic conductance and activation of second messenger cascades. Several candidates have been proposed for mediating the non-genomic effects of P, including: a) classical steroid receptors localized in the plasma membrane and cytoplasm, b) ionic channels, c) modulatory sites located in neurotransmitter receptors, d) membrane proteins with steroid-binding domain, e) 3
growth factors and their receptors and f) membrane progesterone receptors (mPR) [13,15,16]. Intracellular PR isoforms expression has been reported in human astrocytomas and P actions in these cells have traditionally been attributed to various cellular events triggered after P binding to PR [8,17–19]. However, there is evidence that the use of the PR antagonist, RU486, results in only a partial decrease of P effects in proliferation of human astrocytoma cell lines [11] and in infiltration of human astrocytoma cells implanted in the rat cerebral cortex [12]. In addition, in the U373 cell line (human astrocytoma grade III), it has been observed that P (10 nM) exerts rapid effects (1 h) on the expression of progesterone-induced blocking factor (PIBF) [20]. Besides, a recent report by our group showed that different genes related with cell migration and metastasis are regulated by P (10 nM) in a RU486insensitive way, indicating that PR does not mediate those effects [21]. Therefore, it has been suggested that P should also act on astrocytoma cells through the interaction with membrane receptors. mPRs are seven-transmembrane proteins belonging to the Progestin and AdipoQ Receptor Family (PAQR) that are expressed in steroid target tissues [22]. They activate G proteins in several vertebrate cell types, although the nature of the coupled G protein depends on the mPR subtype and the cell [23]. Thus, mPRs participate in the regulation of intracellular signaling pathways involved in different functions [24]. To date, five subtypes of mPRs have been found in humans: mPRα (PAQR7), mPRβ (PAQR8), mPRγ (PAQR5), mPRδ (PAQR6) and mPRε (PAQR9), all of them belonging to class II PAQRs [25,26]. In humans, mPRα is the predominant subtype in testis, ovary and placenta; mPRβ was found to be mainly expressed in neuronal tissues, while mPRγ is present in kidney, lung and gastrointestinal tract [22,24]. Regarding mPRδ and mPRε, a recent study showed that both receptors are expressed in different regions of the human brain, and interestingly, mPRβ and mPRδ were the predominant subtypes [25]. In rodents, mPRs have a similar tissue distribution, however, mPRα has also been identified in different brain regions and the spinal cord, and mPRγ has been localized within the 4
ovary, fallopian tube, lung and liver, with a low expression in the spinal cord [27,28]. Recent studies suggest that mPRs participate in the development of cancer by regulating processes such as cell proliferation and apoptosis. Expression of mPRα, mPRβ and mPRγ has been confirmed in several breast and ovary cancer cell lines and tissues [29–33]. However, it is still unknown whether mPRs are expressed in astrocytoma cells, thus we aimed to investigate mPRs expression and regulation in U251 and U87 cells derived from human astrocytomas grades III and IV, respectively.
2. Experimental procedures 2.1 Cell culture U251 and U87 astrocytoma cell lines (ATCC, VA, USA) derived from human astrocytomas grade IV, respectively, were used. Cells were plated in 10 cm dishes and maintained in DMEM medium (In vitro, Mexico City, MEX), supplemented with 10% fetal bovine serum (FBS), 1 mM pyruvate, 2 mM glutamine, 0.1 mM nonessential amino acids (GIBCO, NY, USA) at 37°C under a 95% air and 5% CO2. DMEM medium was changed every 48 hours until reaching 70-80 % cellular confluence. 2.2 Treatments Cells were grown as described above and 24 hours before any treatment, the medium was changed for DMEM phenol red free medium supplemented with 10% fetal bovine serum without steroid hormones. In order to study the hormonal regulation of mPRs expression in U87 cells, the following treatments were applied for 12 and 24 h: (a) vehicle (V; 0.02% cyclodextrin in sterile water); (b) P-water soluble (P coupled to cyclodextrin; 10, 100 and 1000 nM in sterile water); (c) Ewater soluble (E coupled to cyclodextrin E; 10, 100 and 1000 nM in sterile water). Cyclodextrin, P coupled to cyclodextrin and E coupled to cyclodextrin were purchased from Sigma-Aldrich (St. Louis, MO). 5
2.3 Total RNA extraction and RT-qPCR Total RNA was isolated from U251 and U87 cells by the single-step method based on guanidine isothiocyanate/phenol/chloroform extraction according to the TRIzol reagent manufacturer’s protocol (Invi-trogen, CA, USA). RNA was quantified using the spectrophotometer NanoDrop 2000 (Thermo Scientific, MA, USA). The firststrand cDNA was synthesized from 2 μg of total RNA by using SuperScript II reverse transcription (Invitrogen, CA, USA) and oligo (dT)12–18 primers (Sigma– Aldrich, MO, USA) according to its protocol. 1 μL of cDNA was subjected to qPCR in order to simultaneously amplify a gene fragment of mPRα, mPRβ mPRγ and 18S ribosomal RNA. The sequences of the specific primers for mPRα amplification fragment were 5´- AACTGTCAAGGGAGGTGCTG -3´ in the sense primer and 5´ATTGCATCCAGGCCATAATC -3´ in the antisense; for mPRβ amplification fragment were 5´- AGGACACAGCAAACAGGACA -3´ in the sense and 5´GGCAACACAGGCAGGAATAA in the antisense; for the mPRγ amplification fragment were 5´- CTGAGGTAGGTGCGGTGTAGT -3´in the sense and 5´AGGAGGCTGAGGTGGAAAG -3´in the antisense; and for 18S amplification region were 5´-CGCGGTTCTATTTTGTTGGT -3´ in the sense and 5´- AGTCGGCATCGTTTATGGTC -3´ in the antisense (Sigma–Aldrich, MO, USA). SYBR Green qPCR Master Mix and the thermocycler LightCyclerR Roche FastStart (Roche Molecular
Biochemicals,
Manheim,
Germany)
were
used
according
to
manufacturer’s protocol version 18. The results were analyzed by the method of ΔCt [34,35] . The 18S ribosomal gene was used as an expression constitutive control and data obtained were normalized to this gene. As a negative control for all reactions, preparations lacking RNA were used. Three independent experiments were performed by duplicate for each sample.
2.4 Protein extraction and Western blotting 6
After treatments, cells were homogenized in RIPA lysis buffer with protease inhibitors (1mM EDTA, 2 µg/ml leupeptin, 2 µg/ml aprotinin, 1 mM PMSF). Proteins were obtained by centrifugation at 12,500 rpm, at 4°C for 15 min and quantified by using the Protein A280 method in a NanoDrop 2000 Spectrophotometer (Thermo Scientific, MA, USA). Proteins (100 µg) were separated by electrophoresis on 12% SDS-PAGE at 20mA. Colored markers (Bio-Rad, CA, USA) were included for molecular size determination. Gels were transferred to nitrocellulose membranes (Millipore, MA, USA) for 1 h (45 mA, at room temperature in semi-dry conditions). Membranes were blocked with 3% non-fat dry milk and 2% bovine serum albumin at room temperature for 2 h and then incubated with 1 µg/ml of one of the following antibodies: anti-mPRα (sc-50111, Santa Cruz Biotechnology, TX, USA), anti-mPRβ (sc-50109, Santa Cruz Biotechnology, TX, USA) and anti-mPRγ (sc-28019, Santa Cruz Biotechnology, TX, USA) at 4°C overnight. Blots were then incubated with a 1:35000 dilution of donkey anti-goat secondary antibody conjugated to horseradish peroxidase (Santa Cruz Biotechnology, TX, USA) for 1 h at room temperature. The specificity of the immunoreactions was confirmed by using the peptides employed (sc-50111P and sc-50109P Santa Cruz Biotechnology, TX, USA) to generate the antibodies in order to block mPR-antibody binding. For correcting differences in the total amount of protein loaded, mPR content was normalized to that of α-tubulin. Blots were stripped with glycine (0.1 M, pH 2.5, 0.5% SDS) at room temperature for 30 min, and incubated with 0.2 µg/ml of mouse anti-α-tubulin monoclonal antibody (sc-5286, Santa Cruz Biotechnology, TX, USA) at 4°C overnight. Blots were incubated with a 1:5000 dilution of a goat anti-mouse IgG coupled to horseradish peroxidase (Santa Cruz Biotechnology, TX, USA) at room temperature for 1 h. Bands were detected using a manual setting by enhanced chemiluminescence (ECL). Signals were detected exposing membranes to Kodak Biomax Light Film (Sigma-Aldrich, MO, USA) using Supersignal West Femto as peroxidase substrate (Thermo Scientific, MA, USA) with an exposure time of 5 min for mPRs and 2 min for α- tubulin. Exposure times yielded bands in the linear range. The antigen-antibody complex was detected as the area under 7
the peak corresponding to a band density (the area is given in inches with a default scale of 72 pixels/inch) using an HP Scanjet G3110 apparatus (Hewlett-Packard Company, CA, USA) and the ImageJ 1.45S software (National Institutes of Health, WA, USA). Four independent cultures for each experiment were done.
2.5 mPR localization by immunofluorescence U251and U87 cells were fixed for 20 min in 4% paraformaldehyde solution at room temperature. For intracellular localization, cells were permeabilized with 100% methanol at -20°C for 6 min, and for cell surface detection, non-permeabilized cells were used. Next, all samples were blocked with 1% Bovine Serum Albumin (BSA) in PBS at 37°C for 1 h and incubated at 4°C for 24 h with 4 µg/ml of goat antibodies against mPRα, mPRβ, or mPRγ (sc-50111, sc-50109, sc- 28019, respectively; Santa Cruz Biotechnology, TX, USA) in PBS with 0.5% BSA. Samples were rinsed three times in PBS for 5 min each and incubated in the dark with a 1:100 dilution of donkey anti-goat IgG-FITC secondary antibody (sc-2024, Santa Cruz Biotechnology, TX, USA) for 40 min at room temperature. Nuclei were stained with 1 µg/ml Hoechst 33342 solution (Thermo Scientific, IL, USA), and cells were coverslipped with a fluorescence-mounting medium (Biocare Medical, CA, USA). Samples were visualized in an Olympus Bx43 microscope (Olympus, PA, USA). Negative controls consisted of cells in which the primary antibody was omitted. 2.6 Flow cytometry mPRs protein expression in U251 and U87 cells was analyzed using specific antibodies for each receptor. 1x105 cells were scraped from culture plates, and washed with PBS. After low-speed centrifugation (250 g) to remove cellular debris and damaged cells, cells were resuspended in 200 µL PBS with 4% of FBS (P4F) and fixed in 4% paraformaldehyde solution at 37 °C f or 10 min. Next, cells were permeabilized or not with 100% methanol at 4°C for 30 min. After 4 min cold 8
centrifugation at 250 X g, samples were rinsed in P4F and were centrifuged again. Cells were resuspended in P4F and incubated with 4 µg/ml of goat antibodies against mPRα, mPRβ or mPRγ (sc-50111, sc-50109, sc-28019, respectively; Santa Cruz Biotechnology, TX, USA) for 30 min. Samples were rinsed in P4F for 5 min, centrifuged and incubated in the dark with donkey anti-goat IgG-FITC secondary antibody (sc-2024, Santa Cruz Biotechnology, TX, USA) for 20 min at 4°C. Cells were washed twice with P4F solution, resuspended in 200 µL P4F, and stored at 4°C for a maximum of 48 h before analysis on a FACS A ria III flow cytometer (BD Biosciences, NJ, USA). Autofluorescence of U251 and U87 cells and fluorescence of samples in which the primary antibody was omitted were analyzed for each independent experiment and used as negative controls. Data were analyzed with the FlowJo version 7.6.2 software (TreeStar, Inc., OR, USA), exported to Excel spreadsheets and subsequently analyzed using GraphPad Prism 5.0 (GraphPad Software, CA, USA).
2.7 Statistical analysis All data were analyzed and plotted using the GraphPad Prism 5.0 software (GraphPad Software, CA, USA). Statistical analysis between comparable groups was performed using a one-way ANOVA with a Dunnett post-test. A value of P<0.05 was considered statistically significant as stated in figure legends.
3. Results 3.1 Determination of mPRs mRNA and protein expression in human astrocytoma cell lines Using RT-qPCR technique, we established for the first time that human astrocytoma cells express mPRα and mPRβ. Interestingly, mPRα expression was higher in U251 and U87 cells as compared to that of mPRβ, being 4.5 times higher 9
in U251 cells and 3.2 times higher in U87 cells (Fig. 1A). In our conditions, it was not possible to amplify mPRγ cDNA which may indicate that there is a very low amount of this transcript in astrocytoma grade IV cells. Western blot analysis demonstrated the presence of main bands of 40 kD corresponding to mPRα, mPRβ and mPRγ in both U251 and U87 cells (Figs. B and C). We observed a similar protein expression pattern of all receptors in U251 and U87 cells; mPRβ and mPRα were the predominant subtypes in both cell lines, while mPRγ was barely detected in these cells. In some experiments, a band of 80 kD was also observed (data not shown), probably representing dimers, which have been described in other cell lines. Because of the polyclonal nature of antibodies used in Western blot experiments, we could observed unspecific bands, however, the specificity of 40 kD bands (arrows) were confirmed using blocking peptides for both mPRα and mPRβ (Supplemental Fig. 1).
3.2 mPRs localization in astrocytoma cells Cellular localization of mPRs in U251 (Fig. 2) and U87 (Fig. 3) cells was analyzed by immunofluorescence using specific antibodies against the N-terminal region of each receptor subtype. Immunofluorescence analysis of permeabilized cells showed positive staining of mPRα and mPRβ both in cytoplasm and nucleus, while staining of non-permeabilized cells resulted in a positive mark of both receptors in the surface of U251 and U87 cells (Figs. 2A/B and Figs. 3 A/B). Interestingly, in U251
and
U87
non-permeabilized
cells,
we
observed
punctated
immunofluorescence marks in cell surface compared with permeabilized cells that exhibited a more homogeneous staining. Both U251 and U87 cells showed a weak positive staining for mPRγ (Supplemental Fig. 2A) when compared with the negative controls. Negative controls were cells only incubated with the secondary antibody alone (Supplemental Fig. 2B).
10
3.3 mPRs expression and cell surface localization in astrocytoma cells Expression and cell surface localization of mPRs was confirmed by flow cytometry (Figs. 4A and 4B). Both permeabilized and non-permeabilized U251 and U87 cells incubated with N-terminal antibodies that recognize mPRα and mPRβ presented an increase in fluorescence compared with the negative control (cells not incubated with the primary antibody). Lower percentages of cells expressing mPRα (3% of U251 and 6% of U87 cells) or mPRβ (20% in U251 and 40% in U87 cells) were detected in non-permeabilized cells as compared with permeabilized ones (20% and 10 % for mPRα in U251 and U87 cells, respectively, and almost 100% for mPRβ in both cell lines). In contrast, mPRγ did not show a positive mark compared with control in any cell line. These results indicate the presence of mPRα and mPRβ proteins on the cytoplasm and surface of astrocytoma cells with an extracellular N-terminal orientation, and confirm our immunofluorescence results.
3.4 Hormonal regulation of mPRα and mPRβ in U87 cells To study P and E regulation of mPRα and mPRβ expression in U87 cells, Western blot assays were performed using total proteins extracted from cells treated with vehicle (V) or different concentrations of P (10 nM, 100 nM and 1 µM) or E (10 nM, 100 nM and 1 µM) for 12 or 24 h. mPRα protein content was reduced by E or P at 12 h independently of the concentration (Fig. 5A, left panel). This reduction was maintained after 24 h of E (100 nM and 1 μM) treatment (Fig. 5A, right panel). On the contrary, mPRβ protein content was increased after P (100 nM and 1 μM) and E (10 and 100 nM) treatments at 12 h, whereas neither E nor P significantly modified mPRβ content at 24 h (Fig. 5B). These results indicate a differential regulation of mPRα and mPRβ expression in U87 astrocytoma cells.
11
3.5 Prediction of PRE and ERE in mPRs promoters by an in silico analysis mPRα, mPRβ and mPRγ promoter sequences (1000 bp upstream of the transcription start site) were obtained by the Eukaryotic Promoter Database (EPD) [31] and were confirmed by BLAST analysis (http://www.ncbi.nlm.nih.gov/BLAST/). Some promoter characteristics as TATA-box, CG-box and CCAAT-box were also predicted by EPD (Fig. 6). By using JASPAR database, Genomatix-MatInspector and NUBIscan software [36–38]; we identified in silico that all mPRs promoters in study have potential progesterone response elements (PRE) and estrogen response elements (ERE): mPRα contains 5 PRE and 5 ERE, mPRβ contains 3 PRE and 1 ERE, and mPRγ contains 6 PRE and 3 ERE (Fig. 6). All PRE and ERE identified, present a relative score of 0.8 or higher which indicate the similitude with the PRE or ERE consensus sequences (Suppl. Fig. 3). In all cases, we established as potential PRE or ERE, those sequences found in two or more of the three databases and software used.
4. Discussion In this study we demonstrated for the first time the expression, cellular localization and hormonal regulation of mPRs subtypes in astrocytoma cells. By RT-qPCR we established that mPRα and mPRβ are expressed in U251 and U87 cells being mPRα the predominant subtype in both cell lines at mRNA level. Western blot using specific mPRα, mPRβ and mPRγ antibodies confirmed the expression of the three mPRs subtypes in U251 and U87 cells with molecular masses of approximately 40 kD as it has been reported in other cell types [39,40]. Using an immunofluorescence approach we showed that in permeabilized cells, mPRα and mPRβ proteins are widely expressed in the cytoplasm and nucleus of U251 and U87 cells. This result is not unexpected, since mPR synthesis involves several organelles including endoplasmic reticulum, Golgi apparatus and secretory vesicles. Therefore, a high fluorescent mark in cytoplasm may be due to the 12
synthesis or degradation pathway of membrane receptors. Importantly, in nonpermeabilized U251 and U87 cells, a positive fluorescence signal was detected in the cell surface, indicating that mPRα and mPRβ are expressed in the membrane of astrocytoma cells as it has been widely reported in other models such as human myometrium, mouse spinal cord and breast cancer cells [30,39,41]. Interestingly, a recent study showed that in several breast cancer cell lines, mPRα and progesterone receptor membrane component 1 (PGRMC1) are closely associated, suggesting that PGRMC1 acts like an adaptor protein that transports mPRα to the cell surface and that mPRα and PGRMC1 are components of a membrane progesterone receptor protein complex [42]. Due to the above, it is possible that PGRMC1 contributes to plasma membrane expression of mPRs in astrocytoma cells, which is an interesting topic for further research. By flow cytometry we determined that mPRβ was present in a higher number of U251 and U87 cells as compared with mPRα both at intracellular and membrane levels. mPRα also exhibited a higher expression when compared to the negative control, while mPRγ expression was extremely low. A comparison between mPRs expression in human normal astrocytes and in astrocytoma cells could be important to determine if the expression pattern of these receptors is different depending on the cancer or the physiological status. Above results agree with other reports in which mPRβ is the predominant mPR in different human and rodent brain regions such as cerebral cortex, cerebellum, pituitary, thalamus, hypothalamus and caudate nucleus [22,43]. In contrast, mPRα is predominantly expressed in human reproductive tissues, though some recent studies have reported its expression in cerebral cortex, hippocampus, thalamus, hypothalamus and cerebellum of rat and mouse [41,44,45]. Another study shows that in a mouse neuroblastoma cell line, mPRα and mPRβ are expressed at mRNA level [44]. Besides, an interesting report suggests that mPRα is expressed in some neurons of the frontal and pyriform cortex, different hypothalamic nuclei, hippocampus and striatum of male rats, but neither in oligodendrocytes nor in astrocytes, however, after a traumatic brain injury, mPRα expression is induced in 13
oligodendrocytes, astrocytes and the reactive glia [41]. Similarly, it has been reported that mPRα and mPRβ proteins are expressed in mouse spinal cord, and interestingly, double immunofluorescence staining showed that mPRα is expressed in neurons, astrocytes and oligodendrocytes, while mPRβ is expressed in neurons but not in glia cells [28]. In addition, mPRα, mPRβ and mPRγ expression has been reported in human breast cancer and in several cancer cell lines, including PR-positive MCF-7 cells, and PR-negative SKBR3, MDA-MB-231 and MDA-Mb-468 as well as in ovarian cancer cells and tumors [29,30,33,46]. Importantly, mPRα expression is elevated in ovarian and breast tumors compared with normal tissues, suggesting that mPRs should have an important participation in cancer [33,46]. Sex hormones have a key role in the regulation of different processes including gene expression of their own receptors. Previous reports of our laboratory shown that in astrocytoma cell lines, E increases PR expression at protein level and P is able to decrease E-induced PR expression [17]. Our findings are the first to show that female sex steroids regulate mPRα and mPRβ expression in astrocytoma cells. In the present work we demonstrate that in U87 cells, mPRα and mPRβ proteins are differentially regulated by E and P, mPRα was downregulated by E and P at 12 and 24 h, whereas mPRβ was upregulated by both hormones at 12 h. These results suggest that despite their structural similarities, mPRα and mPRβ have distinct roles in astrocytomas, and that sex hormones regulate their function by differently modifying their expression. It is important to note that both PR and estrogen receptor (ER) expression in U251 and U87 astrocytoma cells has been previously reported, and the in silico analysis performed by our group showed for the first time that human mPRα and mPRβ promoter regions contain putative estrogen response elements (ERE) and progesterone response elements (PRE) (Fig. 6 and Supplemental Fig. 2), however, further studies are required to elucidate the functional relevance of these regulatory elements. In fact, ERE and PRE have been reported in promoter regions of mPRα, mPRβ and mPRγ of catfish [47].
14
Therefore, it is possible that the hormonal regulation of mPRs involves PR and/or ER actions. Diverse results have been reported regarding the hormonal-regulation of mPRs, depending on the animal model, target organ, dosing schedule or hormone concentrations. Moreover, most research about mPRs hormonal-regulation has been performed in physiological models and to date apart from this work there are no reports about this topic in cancer. In the CNS, one study revealed that in the median septum of ovariectomized rats, 48 h of E treatment increases mPRβ protein level [43]. Similarly, using quantitative PCR, Inteklofer and Petersen reported an upregulation of mPRβ, but no mPRα mRNA in the anteroventral periventricular nucleus (AVPV), ventromedial nucleus and sexually dimorphic nucleus of the preoptic area after implanted E-containing capsules for a longer than 56-h exposure in female rats, while in the same model, P repressed mPRβ gene expression only in AVPV [48]. It has been shown that mRNA levels of mPRα and mPRβ varied during estrous cycle in the mediobasal hypothalamus of cycling rats, being higher on pro-oestrous and decreasing on estrous which is consistent with the up-regulation by E and subsequent down-regulation by P [45]. In this respect, E has also been shown to up-regulate PRα and mPRβ subtypes in the human myometrium [39]. Few reports have analyzed the role of mPRs in cancer progression, however, a recent study suggest that mPRα should mediate P effects on cell death in breast cancer since P or an specific mPR agonist, 10-ethenyl-19-norprogesterone (Org OD 02-0), significantly decreased cell death and apoptosis in response to serum starvation in two breast cancer cell lines, and the knockdown of mPRα in these cells blocked the inhibitory effects of P on cell death [49]. This report concurs with others studies suggesting that apoptosis inhibition produced by P in teleost granulosa cells and Jurkat cells are also mediated through mPRα [50,51]. Interestingly, other mPR subtype, mPRδ, could regulate neuroprotective actions of allopregnanolone and P by exerting antiapoptotic actions in hippocampal neuronal cells [25]. Besides, it has been reported that in breast cancer cells, mPRs are 15
capable to initiate intracellular signaling pathways involved in growth and development of breast cancer such as MAPK/Erk and Akt/PI3K [23,52]. In an interesting study, it has been suggested that in human myometrial cells, activation of an mPR pathway results in an altered PR transactivation, suggesting a crosstalk between both progestin receptors [39], which open an attractive topic for further research about P actions in human astrocytoma cells. Regarding to the functions of mPRs in ovarian cancer, it has been suggested that contrary to breast cancer, mPRα should mediate protective role of P against this disease upregulating the expression of pro-apoptotic markers [29]. In conclusion, our data indicate that human astrocytoma cells express mPRα, mPRβ and mPRγ, showing a high content and a clear membrane localization of mPRα and mPRβ. Besides, in the U87 cell line, mPRβ and mPRα expression is differentially regulated by E and P. These results open a new interesting research field in the study of the mechanisms of P action in human astrocytomas, and the participation of mPRs in cancer events such as cell proliferation, apoptosis and migration. Acknowledgements We want to thank MSc Emiliano Hisaki from Facultad de Medicina, Universidad Nacional Autónoma de México for his technical support. This work was supported by Grant No. 250866 from Consejo Nacional de Ciencia y Tecnología, México.
References [1]
D. Friedmann-Morvinski, E.A. Bushong, E. Ke, Y. Soda, T. Marumoto, O. Singer, et al., Dedifferentiation of neurons and astrocytes by oncogenes can induce gliomas in mice, Science. 338 (2012) 1080–1084.
[2]
S. Alcantara Llaguno, J. Chen, C.H. Kwon, E.L. Jackson, Y. Li, D.K. Burns, et al., Malignant astrocytomas originate from neural stem/progenitor cells in a somatic tumor suppressor mouse model, Cancer Cell. 15 (2009) 45–56. 16
[3]
L. Cheng, S. Bao, J.N. Rich, Potential therapeutic implications of cancer stem cells in glioblastoma, Biochem. Pharmacol. 80 (2010) 654–665.
[4]
H. Ohgaki, P. Kleihues, Epidemiology and etiology of gliomas, Acta Neuropathol. 109 (2005) 93–108.
[5]
C. Daumas-Duport, B. Scheithauer, J. O’Fallon, P. Kelly, Grading of astrocytomas. A simple and reproducible method, Cancer. 62 (1988) 2152– 2165.
[6]
D.N. Louis, Molecular pathology of malignant gliomas, Annu. Rev. Pathol. 1 (2006) 97–117.
[7]
F.B. Furnari, T. Fenton, R.M. Bachoo, A. Mukasa, J.M. Stommel, A. Stegh, et al., Malignant astrocytic glioma: genetics, biology, and paths to treatment, Genes Dev. 21 (2007) 2683–2710.
[8]
E. Cabrera-Muñoz, O.T. Hernández-Hernández, I. Camacho-Arroyo, Role of progesterone in human astrocytomas growth, Curr Top Med Chem. 11 (2011) 1663–1667.
[9]
J.D. Graham, C.L. Clarke, Physiological action of progesterone in target tissues, Endocr Rev. 18 (1997) 502–519.
[10] M. Schumacher, R. Hussain, N. Gago, J.P. Oudinet, C. Mattern, A.M. Ghoumari, Progesterone synthesis in the nervous system: implications for myelination and myelin repair, Front Neurosci. 6 (2012) 10. [11] G. González-Agüero, A.A. Gutiérrez, D. González-Espinosa, J.D. Solano, R. Morales, A. González-Arenas, et al., Progesterone effects on cell growth of U373 and D54 human astrocytoma cell lines, Endocrine. 32 (2007) 129–135. [12] L. Germán-Castelán, J. Manjarrez-Marmolejo, A. González-Arenas, M.G. González-Morán, I. Camacho-Arroyo, Progesterone induces the growth and infiltration of human astrocytoma cells implanted in the cerebral cortex of the rat, Biomed Res. Int. 2014 (2014) 393174. [13] T. Simoncini, A.R. Genazzani, Non-genomic actions of sex steroid hormones, Eur. J. Endocrinol. 148 (2003) 281–292. [14] D.L. Bain, A.F. Heneghan, K.D. Connaghan-Jones, M.T. Miura, Nuclear receptor structure: implications for function, Annu. Rev. Physiol. 69 (2007) 201–220.
17
[15] V. Boonyaratanakornkit, Y. Bi, M. Rudd, D.P. Edwards, The role and mechanism of progesterone receptor activation of extra-nuclear signaling pathways in regulating gene transcription and cell cycle progression, Steroids. 73 (2008) 922–928. [16] A. Wendler, C. Albrecht, M. Wehling, Nongenomic actions of aldosterone and progesterone revisited, Steroids. (2012) 1002–1006. [17] E. Cabrera-Muñoz, A. González-Arenas, M. Saqui-Salces, J. Camacho, F. Larrea, R. García-Becerra, et al., Regulation of progesterone receptor isoforms content in human astrocytoma cell lines, J Steroid Biochem Mol Biol. 113 (2009) 80–84. [18] A. González-Arenas, O. Villamar-Cruz, C. Guerra-Araiza, I. CamachoArroyo, Regulation of progesterone receptor isoforms expression by sex steroids in the rat lung, J Steroid Biochem Mol Biol. 85 (2003) 25–31. [19] G. González-Agüero, R. Ondarza, A. Gamboa-Domónguez, M.A. Cerbón, I. Camacho-Arroyo, Progesterone receptor isoforms expression pattern in human astrocytomas, Brain Res Bull. 56 (2001) 43–48. [20] A. González-Arenas, P. Valadez-Cosmes, C. Jiménez-Arellano, M. LópezSánchez, I. Camacho-Arroyo, Progesterone-induced blocking factor is hormonally regulated in human astrocytoma cells, and increases their growth through the IL-4R/JAK1/STAT6 pathway, J Steroid Biochem Mol Biol. 144 (2014) 463–470. [21] A. González-Arenas, A. Cabrera-Wrooman, N. Fabián Díaz, T.K. GonzálezGarcía, I. Salido-Guadarrama, M. Rodríguez-Dorantes, et al., Progesterone receptor subcellular localization and gene expression profile in human astrocytoma cells are modified by progesterone, Nucl. Recept. Res. 1 (2014) 1–10. [22] Y. Zhu, J. Bond, P. Thomas, Identification, classification, and partial characterization of genes in humans and other vertebrates homologous to a fish membrane progestin receptor, Proc. Natl. Acad. Sci. U. S. A. 100 (2003) 2237–2242. [23] Y. Zhu, C.D. Rice, Y. Pang, M. Pace, P. Thomas, Cloning, expression, and characterization of a membrane progestin receptor and evidence it is an intermediary in meiotic maturation of fish oocytes, Proc. Natl. Acad. Sci. U. S. A. 100 (2003) 2231–2236.
18
[24] P. Thomas, Y. Pang, J. Dong, P. Groenen, J. Kelder, J. de Vlieg, et al., Steroid and G protein binding characteristics of the seatrout and human progestin membrane receptor alpha subtypes and their evolutionary origins, Endocrinology. 148 (2007) 705–718. [25] Y. Pang, J. Dong, P. Thomas, Characterization, neurosteroid binding and brain distribution of human membrane progesterone receptors δ and {epsilon} (mPRδ and mPR{epsilon}) and mPRδ involvement in neurosteroid inhibition of apoptosis, Endocrinology. 154 (2013) 283–95. [26] Y.T. Tang, T. Hu, M. Arterburn, B. Boyle, J.M. Bright, P.C. Emtage, et al., PAQR proteins: a novel membrane receptor family defined by an ancient 7transmembrane pass motif, J. Mol. Evol. 61 (2005) 372–380. [27] M. Nutu, B. Weijdegård, P. Thomas, C. Bergh, A. Thurin-Kjellberg, Y. Pang, et al., Membrane progesterone receptor gamma: tissue distribution and expression in ciliated cells in the fallopian tube, Mol. Reprod. Dev. 74 (2007) 843–850. [28] F. Labombarda, D. Meffre, B. Delespierre, S. Krivokapic-Blondiaux, A. Chastre, P. Thomas, et al., Membrane progesterone receptors localization in the mouse spinal cord, Neuroscience. 166 (2010) 94–106. [29] N.J. Charles, P. Thomas, C.A. Lange, Expression of membrane progesterone receptors (mPR/PAQR) in ovarian cancer cells: implications for progesterone-induced signaling events, Horm. Cancer. 1 (2010) 167–176. [30] G.E. Dressing, P. Thomas, Identification of membrane progestin receptors in human breast cancer cell lines and biopsies and their potential involvement in breast cancer, Steroids. 72 (2007) 111–116. [31] Y. Pang, P. Thomas, Progesterone signals through membrane progesterone receptors (mPRs) in MDA-MB-468 and mPR-transfected MDA-MB-231 breast cancer cells which lack full-length and N-terminally truncated isoforms of the nuclear progesterone receptor, Steroids. 76 (2011) 921–928. [32] L. Zuo, W. Li, S. You, Progesterone reverses the mesenchymal phenotypes of basal phenotype breast cancer cells via a membrane progesterone receptor mediated pathway, Breast Cancer Res. 12 (2010) R34. [33] M. Xie, X. Zhu, Z. Liu, M. Shrubsole, V. Varma, I.A. Mayer, et al., Membrane progesterone receptor alpha as a potential prognostic biomarker for breast cancer survival: A retrospective study, PLoS One. 7 (2012) e35198.
19
[34] M.W. Pfaffl, M.W. Pfaffl, A new mathematical model for relative quantification in real-time RT-PCR, Nucleic Acids Res. 29 (2001) e45. [35] T.D. Schmittgen, K.J. Livak, Analyzing real-time PCR data by the comparative C(T) method, Nat. Protoc. 3 (2008) 1101–1108. [36] M. Podvinec, M.R. Kaufmann, C. Handschin, U.A. Meyer, NUBIScan, an in silico approach for prediction of nuclear receptor response elements, Mol. Endocrinol. 16 (2002) 1269–1279. [37] A. Sandelin, W. Alkema, P. Engström, W.W. Wasserman, B. Lenhard, JASPAR: an open-access database for eukaryotic transcription factor binding profiles, Nucleic Acids Res. 32 (2004) D91–D94. [38] K. Cartharius, K. Frech, K. Grote, B. Klocke, M. Haltmeier, A. Klingenhoff, et al., MatInspector and beyond: promoter analysis based on transcription factor binding sites, Bioinformatics. 21 (2005) 2933–2942. [39] E. Karteris, S. Zervou, Y. Pang, J. Dong, E.W. Hillhouse, H.S. Randeva, et al., Progesterone signaling in human myometrium through two novel membrane G protein-coupled receptors: potential role in functional progesterone withdrawal at term, Mol. Endocrinol. 20 (2006) 1519–1534. [40] C. Dosiou, A.E. Hamilton, Y. Pang, M.T. Overgaard, S. Tulac, J. Dong, et al., Expression of membrane progesterone receptors on human T lymphocytes and Jurkat cells and activation of G-proteins by progesterone, J. Endocrinol. 196 (2008) 67–77. [41] D. Meffre, F. Labombarda, B. Delespierre, a Chastre, a F. De Nicola, D.G. Stein, et al., Distribution of membrane progesterone receptor alpha in the male mouse and rat brain and its regulation after traumatic brain injury, Neuroscience. 231 (2012) 111-124. [42] P. Thomas, Y. Pang, J. Dong, Enhancement of cell surface expression and receptor functions of membrane progestin receptor α (mPRα) by progesterone receptor membrane component 1 (PGRMC1): evidence for a role of PGRMC1 as an adaptor protein for steroid receptors, Endocrinology. 155 (2014) 1107–1119. [43] D.G. Zuloaga, S.L. Yahn, Y. Pang, A.M. Quihuis, M.G. Oyola, A. Reyna, et al., Distribution and estrogen regulation of membrane progesterone receptorbeta in the female rat brain, Endocrinology. 153 (2012) 4432–4443.
20
[44] N. Sleiter, Y. Pang, C. Park, T.H. Horton, J. Dong, P. Thomas, et al., Progesterone receptor A (PRA) and PRB-independent effects of progesterone on gonadotropin-releasing hormone release, Endocrinology. 150 (2009) 3833–3844. [45] B. Liu, L.A. Arbogast, Gene expression profiles of intracellular and membrane progesterone receptor isoforms in the mediobasal hypothalamus during pro-oestrus, J. Neuroendocrinol. 21 (2009) 993–1000. [46] M. Romero-Sánchez, S.C. Peiper, B. Evans, Z. Wang, L. Catasús, A. Ribe, et al., Expression profile of heptahelical putative membrane progesterone receptors in epithelial ovarian tumors, Hum. Pathol. 39 (2008) 1026–1033. [47] Y. Kazeto, R. Goto-Kazeto, P. Thomas, J.M. Trant, Molecular characterization of three forms of putative membrane-bound progestin receptors and their tissue-distribution in channel catfish, Ictalurus punctatus, J. Mol. Endocrinol. 34 (2005) 781–791. [48] K.A. Intlekofer, S.L. Petersen, 17β-estradiol and progesterone regulate multiple progestin signaling molecules in the anteroventral periventricular nucleus, ventromedial nucleus and sexually dimorphic nucleus of the preoptic area in female rats, Neuroscience. 176 (2011) 86–92. [49] G.E. Dressing, P. Thomas, Y. Pang, R. Alyea, Membrane progesterone receptors (mPRs) Mediate progestin induced antimorbidity in breast cancer cells and are expressed in human breast tumors, Horm. Cancer. 3 (2012) 101–112. [50] G.E. Dressing, Y. Pang, J. Dong, P. Thomas, Progestin signaling through mPRα in atlantic croaker granulosa/theca cell cocultures and its involvement in progestin inhibition of apoptosis, Endocrinology. 151 (2010) 5916–5926. [51] A. Kon, B. Yuan, T. Hanazawa, H. Kikuchi, M. Sato, R. Furutani, et al., Contribution of membrane progesterone receptor α to the induction of progesterone-mediated apoptosis associated with mitochondrial membrane disruption and caspase cascade activation in Jurkat cell lines, Oncol. Rep. 30 (2013) 1965–1970. [52] M. Alkhalaf, A.M. El-Mowafy, Overexpression of wild-type p53 gene renders MCF-7 breast cancer cells more sensitive to the antiproliferative effect of progesterone., J. Endocrinol. 179 (2003) 55–62.
21
Figure captions: Fig. 1. mPRs mRNA and protein expression in human astrocytoma cell lines. RNA extraction following by RT-qPCR were carried out in U251 and U87 cells. Three independent experiments were performed by duplicate for each sample. mPRs relative expression (normalized to 18S ribosomal RNA expression) is showed. Results are expressed as the mean ± S.E.M. (∗) p < 0.01 vs mPRβ (A). U251 (B) and U87 (C) cells were lysed and proteins (100 μg) were separated by electrophoresis in 12% SDS-PAGE gel, transferred to a nitrocellulose membrane and incubated with antibodies against mPRα, mPRβ or mPRγ. ECL was used for protein-antibody complex detection. Blots were stripped and incubated with an anti α-tubulin antibody and detected by ECL. Representative Western blots of 3 independent experiments are shown. The bands representing mPRs expression are indicated by arrows.
Fig. 2. mPRs cellular localization in U251 astrocytoma cells. Cells were fixed with paraformaldehyde and permeabilized or not with methanol. Immunofluorescence was performed using specific primary antibodies that recognize the N-terminal region of mPRα (A) or mPRβ (B), and secondary antibodies coupled to FITC. Images for the nuclear staining with Hoechst (left), mPRs positive cells (middle) and merge (right) are shown. All images have an amplification of 600X, and all experiments were done in triplicate.
Fig. 3. mPRs cellular localization in U87 astrocytoma cells. Immunolocalization of mPRα (A) or mPRβ (B) in U87 cells. Hoechst (left), mPRs positive cells (middle) and merge (right) are shown. All images have an amplification of 600X, and all experiments were done in triplicate.
22
Fig. 4. mPRs protein expression and cell surface localization in U251 and U87 astrocytoma cells. U251 (A) and U87 (B) cells were fixed and permeabilized as described in Experimental procedures. Flow cytometry using specific primary antibodies against the N-terminal region of mPRα, mPRβ or mPRγ, and secondary antibodies coupled to FITC was performed. Upper panels: representative histograms of control samples (dotted lines) or mPRs-stained samples, in permeabilized and non-permeabilized cells (solid lines). Lower panels show the relative FITC signal representing mPRs expression after performing four independent
flow
cytometry
experiments
with
permeabilized
and
non-
permeabilized cells. The results are expressed as the mean ± S.E.M. In all panels (∗) p<0.05, (∗∗) p<0.001 and (∗∗∗) p<0.0001 compared with the negative control.
Fig. 5. P and E effects on mPRα and mPRβ protein content in U87 human astrocytoma cells. Cells were lysed after treatments with P or E (10 nM, 100 nM and 1 μM) during 12 or 24 h. Proteins (100 μg) were separated by electrophoresis on 12% SDS-PAGE gel, transferred to a nitrocellulose membrane and incubated with an antibody against mPRα or mPRβ. ECL was used for protein-antibody complex detection. A representative Western blot (upper panels) and the densitometric analysis (lower panels) of mPRα (A) and mPRβ (B) content relative to α-tubulin in U87 cells are shown. Results are expressed as the mean ± S.E.M., n = 4; (∗) p<0.05 and (∗∗) p<0.01 compared with vehicle (V). Fig. 6. In silico analysis of mPRs promoters. Continuous lines represent mPRα, mPRβ and mPRγ promoter sequences. Glucocorticoid/progesterone response elements (GRE/PRE) and estrogen response elements (ERE) are highlighted in grey and black boxes, respectively, if they are above the baseline it means they are located in sense orientation, whereas if they are below the baseline they are located in antisense orientation. Transcription start site (TSS). TATA-box, CG-box and CCAAT-box are also identified in the image.
23
24
25
26
27
28
29