Expression mapping of 5-HT1 serotonin receptor subtypes during fetal and early postnatal mouse forebrain development

Neuroscience 141 (2006) 781–794

EXPRESSION MAPPING OF 5-HT1 SEROTONIN RECEPTOR SUBTYPES DURING FETAL AND EARLY POSTNATAL MOUSE FOREBRAIN DEVELOPMENT A. BONNIN,a,c W. PENG,b W. HEWLETTb,c AND P. LEVITTa,c*

receptor transcripts. Overall, the 5-HT1 subfamily of Gi/ocoupled 5-HT receptors displays specific and dynamic expression patterns during embryonic forebrain development. Moreover, all members of the 5-HT1 receptor class are strongly and transiently expressed in the embryonic dorsal thalamus, which suggests a potential role for serotonin in early thalamic development. © 2006 IBRO. Published by Elsevier Ltd. All rights reserved.

a Department of Pharmacology, Vanderbilt University, 8114 MRBIII, 465 21st Avenue South, Nashville, TN 37232-8548, USA b Department of Psychiatry, Vanderbilt School of Medicine, 1601 23rd Avenue South, Nashville, TN 37232-8645, USA c

Vanderbilt Kennedy Center for Research on Human Development, Vanderbilt University, Box 40 Peabody, 230 Appleton Place, Nashville, TN 37203, USA

Key words: serotonin receptors, forebrain development, dorsal thalamus.

Abstract—Serotonin (5-HT) is implicated in several aspects of brain development, yet the ontogenetic expression patterns of 5-HT receptors responsible for transducing specific effects have largely not been characterized. Fifteen different 5-HT receptor genes have been cloned; therefore any spatial and/or temporal combination of their developmental expression could mediate a wide array of 5-HT effects. We undertook a detailed analysis of expression mapping of the Gi/ocoupled 5-HT1 (5-HT1A, 1B, 1D and 1F) receptor subtypes in the fetal and early postnatal mouse forebrain. Using receptor subtype-specific riboprobes and in situ hybridization, we observed that all 5-HT1 receptor subtypes are expressed as early as embryonic day (E) 14.5 in the forebrain, typically in gradients within specific structures. Among 5-HT1 receptors, the 5-HT1A receptor transcript is expressed densely in E14.5–16.5 thalamus, in hippocampus, and in a medial to lateral gradient in cortex, whereas the 5-HT1B receptor mRNA is expressed in more lateral parts of the dorsal thalamus and in the striatum at these ages. The 5-HT1D receptor transcript, which also is expressed heavily in E14.5–E16.5 thalamus, appears to be down-regulated at birth. The 5-HT1F receptor transcript is present in proliferative regions such as the cortical ventricular zone, ganglionic eminences, and medial aspects of the thalamus at E14.5–16.5, and otherwise presents similarities to the expression patterns of 5-HT1B and 1D

Serotonin (5-HT) is a monoaminergic neuromodulator of neurotransmission. The early expression of 5-HT (Levitt and Moore, 1978; Lidov and Molliver, 1982; Aitken and Tork, 1988; Dori et al., 1996; Dinopoulos et al., 1997) (for review see Rubenstein, 1998) and other monoamines has led, over the years, to speculation of a role for 5-HT in mediating specific aspects of neural development. 5-HT actions on craniofacial morphogenesis are well described (Moiseiwitsch and Lauder, 1995; Buznikov et al., 2001), but in general, actions on the developing prenatal CNS typically are described as minimal to modest. For example, small but significant effects have been measured that relate to neuronal growth, survival and maturation of the developing 5-HT system itself and of other neurotransmitter systems (for reviews see Lauder, 1993; Whitaker-Azmitia et al., 1996; Luo et al., 2003), as well as maturation of the cerebral cortex and proliferation of progenitor cells in the developing brain (Lauder and Krebs, 1978; Rakic and Lidow, 1995; Janusonis et al., 2004). In vitro studies showed that 5-HT can affect neurite outgrowth (Haydon et al., 1984; McCobb et al., 1988a,b; Lieske et al., 1999; Lotto et al., 1999; Kondoh et al., 2004), while in vivo, genetic manipulation of 5-HT receptors, even selectively during development, is sufficient to disrupt specific functions in the adult (Gross et al., 2002). Perhaps the most robust impact of modulating 5-HT on brain development has been demonstrated in the postnatal refinement of thalamocortical (TCA) connections during late phases of barrel field formation in the somatosensory cortex (Blue et al., 1991; Bennett-Clarke et al., 1993; Cases et al., 1996; Young-Davies et al., 2000; Persico et al., 2001; Salichon et al., 2001; Laurent et al., 2002). The mechanisms through which 5-HT displays such a wide array of developmental and functional effects are not well understood. It is likely, however, that 5-HT is able to activate a number of different receptor subtypes during development, paralleling the wide spectrum of 5-HT functions mediated by multiple receptors in the adult brain.

*Correspondence to: P. Levitt, Vanderbilt Kennedy Center for Research on Human Development, Vanderbilt University, Box 40 Peabody, 230 Appleton Place, Nashville, TN 37203, USA. Tel: ⫹1-615322-8242; fax: ⫹1-615-322-5910. E-mail address: [email protected] (P. Levitt). Abbreviations: AA, amygdala; Ad, anterodorsal thalamic nucleus; CP, caudate putamen; CxP, cortical plate; DEPC, diethylpyrocarbonate; d-H2O, distilled water; DIG, digoxigenin; DLG, dorsal lateral geniculate nucleus; DTh, dorsal thalamus; E, embryonic day; GE, ganglionic eminences; GP, globus pallidus; LHb, lateral habenula; LOT, lateral olfactory tract; MHb, medial habenula; P, postnatal day; PBS, phosphate-buffered saline; PFA, paraformaldehyde; Po, posterior thalamic nucleus; Pvh, paraventricular hypothalamic nucleus; Pvt, paraventricular thalamic nucleus; RE, reuniens nucleus; RT, room temperature; Rt, reticular thalamic nucleus; RT-PCR, reverse transcription– polymerase chain reaction; Spt, septum; TCAs, thalamocortical axons; VL, ventrolateral thalamic nucleus; VLG, ventral lateral geniculate nucleus; Vmt, ventromedial thalamic nucleus; VPl, ventroposterior lateral nucleus; VPm/l, ventral posteromedial/lateral thalamic nucleus; VZ, ventricular zone; Zi, zona incerta; 5-HT, 5-hydroxytryptamine, serotonin.

0306-4522/06$30.00⫹0.00 © 2006 IBRO. Published by Elsevier Ltd. All rights reserved. doi:10.1016/j.neuroscience.2006.04.036

781

782

A. Bonnin et al. / Neuroscience 141 (2006) 781–794

Therefore, it is somewhat surprising that the precise regional patterns of expression of 5-HT receptors during prenatal development are so poorly documented (Gaspar et al., 2003). To date, 15 genes encoding 15 different 5-HT receptor proteins have been cloned (Hoyer et al., 2002). These receptors can be classified based on their structural and signal transduction characteristics. Receptors belonging to the 5-HT1 class (i.e., 5-HT1A, 1B, 1D and 1F subtypes in the mouse) inhibit cAMP formation through negative coupling to adenylate cyclase, preferentially via Gi/oprotein. The 5-HT2 class includes 5-HT2A, 2B and 2C receptors subtypes, which couple to Gq/11-protein and stimulate phospholipase C to increase the hydrolysis of inositol phosphates and elevate intracellular Ca2⫹. 5-HT4, 5-HT6 and 5-HT7 receptors constitute a third class of receptors positively coupled to the adenylate cyclase via Gs-protein. 5-HT3 receptors (5-HT3A and 5-HT3B, Davies et al., 1999) belong to the ligand-gated ion channel receptor superfamily. Finally, several receptors remain “orphan” (i.e., 5-ht5A and 5-ht5B), in that their functional coupling is unknown. Expression of 5-HT receptors during fetal development has been studied using molecular, in situ hybridization, immunohistochemistry, or receptor binding methods (Hellendall et al., 1993; Hillion et al., 1993; Johnson and Heinemann, 1995; Tecott et al., 1995; Bolanos-Jimenez et al., 1997; Choi et al., 1997; Grimaldi et al., 1998; Lauder et al., 2000; Gross et al., 2002; Andrews et al., 2004; Garcia-Alcocer et al., 2005). It is noteworthy, however, that detailed spatial and temporal patterns have not been reported. Given the widely accepted importance of this neurotransmitter system during CNS development, we undertook a detailed expression mapping for 5-HT1 receptor class mRNAs during fetal development, when neuronal production, migration and initial axon guidance occur in the forebrain. We demonstrate that all of 5-HT1 receptor subtypes are expressed in the developing mouse forebrain as

early as E14.5, and exhibit overlapping, though unique, expression patterns that change developmentally.

EXPERIMENTAL PROCEDURES Animals Timed-pregnant C57BL/6J mice were purchased from the Jackson Laboratory (Bar Harbor, ME, USA). All research procedures using mice were approved by the Institutional Animal Care and Use Committee at Vanderbilt University and conformed to NIH guidelines. Unless otherwise noted, all reagents were purchased from Sigma (St. Louis, MO, USA). All efforts were made to minimize animal suffering and to reduce the number of animals used.

Tissue processing Brains from embryonic day (E) 12.5, E14.5, E16.5 (the date of vaginal plug was considered E0.5) and postnatal day 0 (P0) C57BL/6J mice were rapidly dissected in ice-cold phosphatebuffered saline (PBS) and fixed for 24 h by immersion in 4% paraformaldehyde (PFA) dissolved in PBS (pH 7.2) at 4 °C. Fixed brains were frozen in embedding medium (O.C.T. compound, Tissue-Tek, Hatfield, PA, USA) in the vapor phase of liquid nitrogen and stored at ⫺80 °C until sectioned. Brains were cut on a cryostat in three series of 25-␮m-thick coronal sections that were collected on Superfrost Plus glass slides (Fisher, Hampton, NH, USA), dehydrated at room temperature (RT) for 2 h and stored at ⫺80 °C until processed. Preliminary studies with brains collected from other ages (E13.5, 15.5) were done and expression patterns were found to be identical to the next oldest age. Analyses at these ages were not pursued further.

Probes synthesis 5-HT receptors sequences were obtained from the “Ensembl” mouse genome database (www.ensembl.org) using the following accession numbers: 5-HT1A (htr1A): ENSMUST00000022235; 5-HT1B (htr1B): ENSMUST00000051005; 5-HT1D (htr1D): OTTMUSG00000009699 (formerly: ENSMUST00000046982); 5-HT1F (htr1F): ENSMUST00000063076. For each receptor, two probes of different lengths (in the range of 400 bp and 700 bp; see Table 1) were

Table 1. Primers for cDNA templates used to generate riboprobes to localize 5-HT receptor mRNA Receptor (GenBank acc. no.)

Primer position

Primer sequence (5=⬎3=)

Starting position in cDNA sequence (bp)

Product size

5-HT1A exon 1 (NM_008308)

Forward Reverse Forward Reverse Forward Reverse Forward Reverse Forward Reverse Forward Reverse Forward Reverse Forward Reverse

TCTATATTCCGCTGCTGCTC TTGAGTGAACAGGAAGGGTC TGACCTTCAGCTACCAAGTG GGATGGAGATGAGAAAGCCA ACGGCTACATTTACCAGGAC TCTGAGACTCGCACTTTGAC CGAGCCCAGTTGATAACAGA CTGCGCACTTAAAGCGTATC TGTGACATCTGGGTGTCTTC AACACAGTGTAGATGACGGG TGTGACATCTGGGTGTCTTC AGAGCCTGTGATAAGCTGTG TCTGGTATCCCTCACTCTGT CGCTCTCCAAGAAGACTTGA TTCTTGTAGCTGTCCTGGTG CGCTCTCCAAGAAGACTTGA

1103 1841 584 981 95 856 745 1137 1293 2019 1293 1687 451 1060 588 1060

758

5-HT1B exon 1 (NM_010482)

5-HT1D exon 1 (NM_008309)

5-HT1F exon 3 (NM_008310)

417 781 412 746 414 629 452

For each receptor, two sets of primers were used to create cDNA templates spanning ⬃400 bp and ⬃700 bp of the published receptors cDNA sequences. When possible, templates for a given receptor were designed to span different parts of the published cDNA in order to assess signal specificity by comparing patterns observed with probes hybridizing to different parts of the same target mRNA.

A. Bonnin et al. / Neuroscience 141 (2006) 781–794 designed to target unique sequences (verified using the NCBI BLAST server) within exonic regions of receptor sequences. For each receptor, a set of primers (Integrated DNA Technologies Inc., Coralville, IA, USA) spanning regions reported in Table 1 was designed and used to amplify PCR fragments from mouse tail genomic DNA extracted from C57BL/6J mice. PCR fragments were purified and sub-cloned into pST-Blue1 plasmids using the Acceptor Vector kit according to manufacturer instructions (Novagen, San Diego, CA, USA). The identity and orientation of the inserts were assessed by direct sequencing of the vectors using SP6 and T7 sequencing primers. Depending on the orientation of the inserts, sense and anti-sense digoxigenin (DIG)-labeled probes were transcribed in vitro using either SP6 or T7 RNA polymerase following manufacturer instructions provided in the DIG RNA labeling kit (Roche, Indianapolis, IN, USA). Probes were stored at ⫺80 °C until use. The specificity of hybridization was confirmed by comparing expression patterns obtained with two different riboprobes targeting the same mRNA species on adjacent forebrain sections; hybridization was considered specific when the regional labeling observed with both probes was identical. Furthermore, specificity was confirmed by performing in situ hybridization on adjacent sections with the corresponding sense probes. In order to maximize staining intensity and sensitivity for each receptor, the longest of two riboprobes (659 –781 bp; see Table 1) generally was used in subsequent procedures.

In situ hybridization A protocol modified from that of Torii and Levitt (2005) was used. Slides were dried at RT and at 55 °C for 15 min each. After an initial fixation step in PFA–PBS (15 min, RT), slides were washed 3⫻5 min in diethylpyrocarbonate (DEPC)-treated phosphate buffer (1⫻ DEPC–PBS) and then incubated twice in detergent solution (1% Igepal CA-630, 1% SDS, 0.5% sodium deoxycholate, 50 mM Tris–HCl pH 8.0, 1 mM EDTA, pH 8.0, 150 mM NaCl, in DEPC-H2O) for 15 min (RT). After a 10-min wash in DPEC–PBS, slides were incubated for 30 min (RT) in DEPC–PBS with proteinase-K (1 ␮g/ml; Roche), then washed for 5 min in DEPC–PBS and postfixed for 15 min (RT) in 4% PFA. After a rinse of 5 min in DEPC–PBS and 5 min in DEPC–H2O, acetylation was performed by incubating slides under agitation for 10 min in triethanolamine (TEA–HCl pH 8.0) after drop-by-drop addition of acetic anhydrate

(0.25% of TEA volume). After a rinse of 5 min in DEPC–PBS, slides were pre-hybridized for at least 2 h at 55– 65 °C in hybridization solution (50% deionized formamide, 5⫻ SSC, pH 4.5, 1% SDS, 500 ␮g/ml yeast t-RNA, 50 ␮g/ml heparin in DEPC–H2O). The hybridization step was carried out for 16 h at 55– 65 °C in hybridization solution containing approximately 400 ng/ml of DIGlabeled riboprobe. Slides were then washed 3⫻45 min at 60 – 70 °C in washing solution (2⫻ SSC, 50% formamide, 1% SDS in distilled water [d-H2O]), then 2⫻15 min and 1⫻5 min in TBST (25 mM Tris–HCl, pH 7.5, 136 mM NaCl, 2.68 mM KCl, 1% Tween-20 in distilled water) with light agitation at RT. Slides were then blocked for 1 h at RT in blocking reagent (100 mM Tris–HCl, pH 7.5, 150 mM NaCl containing 1.5% blocking reagent in d-H2O; Roche), and incubated 2 h at RT or overnight at 4 °C in the same buffer containing alkaline phosphatase-conjugated anti-DIG Fab fragments diluted 1:2000 (Roche). After three 10-min washes in TBST and one 10-min wash in NTMT (100 mM NaCl, 100 mM Tris–HCl, pH 9.5, 50 mM MgCl2, 1% Tween-20, 2 mM Levamisole in d-H2O), color development was carried out at RT in NTMT solution containing 0.2 mM 5-bromo-4-chloro-3-indolyl phosphate (BCIP) and 0.2 mM nitroblue tetrazolium (NBT) (Roche). Color formation was monitored visually (usually 2–24 h at RT) and when satisfactory was stopped by rinsing the slides in d-H2O. After overnight fixation in 4% PFA, pH 7.2, slides were dehydrated through a graded series of ethanol (70-95-100%) and xylene baths and coverslipped with DPX mounting medium.

Image collection Images were acquired on a Zeiss AxoPhot microscope coupled to a Zeiss AxoCam HRc camera (Zeiss, Jena, Germany) using Axiovision 4.1 software (Zeiss). All images required minor adjustment of contrast and brightness for optimal display of staining patterns. Figures were prepared digitally using Adobe Photoshop 7.0 (Adobe Systems Incorporated, San Jose, CA, USA). DIGlabeled in situ hybridization does not allow a strict quantitative measure of the target mRNA abundance. However, to facilitate comparisons of different receptors, we rated the expression level as strong, moderate or weak according to a qualitative evaluation of staining intensity in different structures across different ages. Embryonic brain structures were labeled according to the chemoarchitec-

Abbreviations used in the figures AA Ad ATN CC CL CP CxP DLG DTh GE GP H Hy IZ LD LHb LOT LP MG MHb ML MP OT

amygdala anterodorsal nucleus anterior thalamic nucleus cingulate cortex centrolateral nucleus caudate putamen cortical plate dorsal lateral geniculate nucleus dorsal thalamus ganglionic eminences globus pallidus hippocampus hypothalamus intermediate zone laterodorsal nucleus lateral habenula lateral olfactory tract lateral preoptic area medial geniculate nucleus medial habenula mediolateral thalamic nucleus medial preoptic area olfactory tubercle

783

Pf Pir Po Pvh Pvt RE Rt Si Son Spt SVZ TE V–VI VL VLG Vmt VPl VPm VZ WM Zi

parafascicular nucleus piriform cortex posterior complex paraventricular hypothalamic nucleus paraventricular thalamic nucleus reuniens nucleus reticular thalamic nucleus substantia innominata supraoptic nucleus septum subventricular zone (cortical) thalamic eminence cortical layers V–VI ventrolateral thalamic nucleus ventral lateral geniculate nucleus ventromedial thalamic nucleus ventroposterior lateral nucleus ventroposterior medial nucleus ventricular zone white matter (cortical) zona incerta

784

A. Bonnin et al. / Neuroscience 141 (2006) 781–794

Fig. 1. Distribution of 5-HT1A mRNA in the developing mouse forebrain. Series of coronal sections through the rostro-caudal extent of E14.5 (A–D) and E16.5 (E–H) fetal and P0 (I–L) postnatal brains hybridized with DIG-labeled riboprobes to the 5-HT1A receptor. Expression of 5-HT1A transcript progressively increases from E14.5 to P0 in several structures such as the CP, hippocampus, DTh and cortex; in contrast 5-HT1A expression appears transient in other sub-cortical structures such as Spt, preoptic areas, VLG and MHb during this time. Dorsal is to the top and medial is to the left. Scale bars⫽50 ␮m.

tonic atlas of the developing mouse brain (Jacobowitz and Abbott, 1997) and the atlas by Paxinos et al. (1994) for postnatal pups.

RESULTS Using DIG-labeled complementary RNA probes (Table 1), we analyzed the mRNA expression patterns for four different 5-HT receptors (5-HT1A, 1B, 1D, and 1F) at four different developmental stages in the mouse forebrain. For each receptor, similar staining patterns in three different brains at each age were observed with two riboprobes of different lengths (in some cases targeting two different regions of the transcripts; see Experimental Procedures for details); furthermore, hybridizations conducted with corresponding sense probes did not produce any specific staining pattern at any age tested, consistent with hybridization specificity of anti-sense probes (data not shown). We ex-

amined all receptor transcripts in the developing forebrain at E12.5, but there was little or no detectable expression for any of the transcripts at this age (data not shown). In situ hybridization patterns in a rostral to caudal series of sections through the forebrain at E14.5, E16.5 and P0 are shown in Figs. 1– 4. A comprehensive list of forebrain structures in which 5-HT1A, B, D and 1F receptors are expressed at these developmental time-points is provided in Table 2. In the following sections, we focus on structures in which we observed the most notable changes of receptor expression patterns during this period of development. 5-HT1A 5-HT1A receptor expression was previously shown to peak in intensity around E15-16 in the developing rat brain by reverse transcription–polymerase chain reaction (RT-PCR) (Hillion et

A. Bonnin et al. / Neuroscience 141 (2006) 781–794

785

Fig. 2. Distribution of 5-HT1B mRNA in the developing mouse forebrain. Series of coronal sections through the rostro-caudal extent of E14.5 (A–D) and E16.5 (E–H) fetal and P0 (I–L) postnatal brains hybridized with DIG-labeled riboprobes to the 5-HT1B receptor. Expression of 5-HT1B transcript is strongly up-regulated in the DTh between E14.5 and E16.5 and becomes restricted to VPm/l and Vmt thalamic nuclei by birth. Expression of 5-HT1B also progressively increases in the hippocampus and cortex, whereas it appears transient in the DLG during the developmental period examined. Dorsal is to the top and medial is to the left. Scale bars⫽50 ␮m.

al., 1993). However, with the exception of a study showing expression of 5-HT1A receptor in the hippocampus of gestational day 40 guinea pig (Andrews et al., 2004), earlier studies have not provided information regarding the detailed distribution pattern of 5-HT1A mRNA in the developing rodent brain. Like most receptors examined in the present study, there was no detectable expression of 5-HT1A at E12.5 in the mouse brain (data not shown). However, by E14.5, expression of 5-HT1A transcript is observed in specific regions of the mouse forebrain. In the rostral forebrain, there is strong 5-HT1A expression in the developing septum (Spt), in a lateral-high to medial-low gradient, as well as in the striatum (globus pallidus [GP] and caudate putamen [CP]), and in medial and lateral preoptic areas (L/MP) (Fig. 1A, B). 5-HT1A expression in the Spt and preoptic areas appears to be transient, because the staining intensity in these structures

decreases at later ages (E16.5 and P0; Fig. 1E, F and I, J). In contrast, high expression of 5-HT1A mRNA is maintained in the striatum throughout fetal development (compare Fig. 1A, E and I). Similarly, the developing hippocampus shows weak staining at E14.5, but progressively gains intensity as development proceeds (compare Fig. 1C, G and K and see marked expression in CA1/CA3 region at E16.5, Fig. 6A). Expression in the dorsal thalamus (DTh) is moderate at E14.5 (Fig. 1C, D), increases at E16.5 (Fig. 1G, H) and increases further at birth (Fig. 1L). Patterns of expression in the E16.5 DTh are shown in more detail in Fig. 6A. At this age, 5-HT1A mRNA is present throughout the developing DTh in a medial–low to lateral– high gradient. However, the most lateral aspects of DTh including the dorsal lateral geniculate nucleus (DLG) show little staining. Highest levels of staining are observed in the ventrolateral (VL) and ventropos-

786

A. Bonnin et al. / Neuroscience 141 (2006) 781–794

Fig. 3. Distribution of 5-HT1D mRNA in the developing mouse forebrain. Series of coronal sections through the rostro-caudal extent of E14.5 (A–D) and E16.5 (E–H) fetal and P0 (I–L) postnatal brains hybridized with DIG-labeled riboprobes to the 5-HT1D receptor. Expression of 5-HT1D transcripts appears transient in most brain regions during development; in structures such as the DTh, M/LHb, GE, CxP and AA, 5-HT1D expression is strong prenatally and reduced at birth. In contrast, 5-HT1D transcripts are expressed throughout the developmental period examined in the CP and hippocampus. Dorsal is to the top and medial is to the left. Scale bars⫽50 ␮m.

terior lateral thalamic nuclei (VPl). Fig. 6A also illustrates that 5-HT1A receptor mRNA is expressed strongly in the medial habenula (MHb), zona incerta (Zi) and the reticular thalamic nucleus (Rt). Interestingly, 5-HT1A expression in the ventral lateral geniculate nucleus (VLG) and the MHb also appears to be transient, because the moderate to strong staining observed at E14.5 and E16.5 (Figs. 1C, G and 6A) is decreased substantially at birth in these structures (Fig. 1K, L). In the amygdala (AA), weak staining is observed throughout the developmental period examined (Fig. 1C–D, G–H and L). In the cerebral wall, expression of 5-HT1A is limited to the developing cortical plate (CxP) at E14.5, and appears to increase progressively during development. A medial– high to lateral–low gradient at E16.5 is evident in the posterior part of the cortex (Fig. 1G, H), which is opposite to the gradient of

neurogenesis (Bayer and Altman, 1991). At birth, 5-HT1A expression presents a caudal– high to rostral–low gradient in the CxP (compare Fig. 1I to K) and extends to deeper layers (V–VI) throughout the cortex (Fig. 1I to L). 5-HT1B Previous receptor-binding studies suggested that 5-HT1B expression was very low prenatally and increased to detectable levels during postnatal development (Pranzatelli and Galvan, 1994; Bolanos-Jimenez et al., 1997). Nonetheless, in the present study, examination of the spatial distribution of 5-HT1B receptor mRNA illustrates high levels of embryonic expression of the transcript, though in restricted forebrain regions.

A. Bonnin et al. / Neuroscience 141 (2006) 781–794

787

Fig. 4. Distribution of 5-HT1F mRNA in the developing mouse forebrain. Series of coronal sections through the rostro-caudal extent of E14.5 (A–D) and E16.5 (E–H) fetal and P0 (I–L) postnatal brains hybridized with DIG-labeled riboprobes to the 5-HT1F receptor. 5-HT1F transcripts are expressed transiently in several proliferative zones of the embryonic brain such as the GE (at E14.5), the cortical VZ (at E14.5 and E16.5) and medial part of the DTh (at E16.5). In contrast, expression of 5-HT1F progressively increases in the CxP, AA and hippocampus from E14.5 to P0. Dorsal is to the top and medial is to the left. Scale bars⫽50 ␮m.

5-HT1B mRNA is present at a very low level at E12.5, and only in the developing hypothalamus (data not shown). The transcript expression in the forebrain expands dramatically two days later at E14.5 when moderate levels of 5-HT1B expression are observed in the striatum (GP and CP; Fig. 2A, B). Expression of 5-HT1B in all of these structures is maintained throughout the prenatal periods examined, with a modest increase in intensity at P0 in the CP (Fig. 2I, J). 5-HT1B expression is also observed in the nucleus of the lateral olfactory tract (LOT) at E16.5 (Fig. 2F, J). Expression in the developing hypothalamus appears to gradually decrease in intensity from E14.5 over the prenatal periods examined (compare Fig. 2D, H and L), except for expression in the paraventricular hypothalamic nucleus

(Pvh), which appears weak at E14.5 (Fig. 2C), then increases at E16.5 (Fig. 2G) and decreases at birth (Fig. 2K). Similarly, expression of 5-HT1B transcripts in the developing AA appears to gradually decrease in intensity from E14.5 to P0 (compare Fig. 2C–D, G–H and L). Expression of 5-HT1B in the cortex is weak at E14.5 and E16.5, located mostly in the mesocortical perirhinal and insular regions in the lateral cerebral wall. Expression increases at birth in the superficial CxP. It maintains highest expression levels in the lateral mesocortical areas including the mid- and posterior insular and perirhinal regions (Fig. 2J). Expression of 5-HT1B in the hippocampus is weak at E14.5 but increases significantly in the CA1/CA3 region at E16.5 and then again at P0 (Fig. 2G, H and J to L). In the DTh, weak 5-HT1B transcript

788

A. Bonnin et al. / Neuroscience 141 (2006) 781–794

Table 2. Presence of 5-HT1A, 1B, 1D, and 1F receptor transcripts in the mouse forebrain at E14.5, E16.5 and P0

Forebrain Structure

Telencephalon Amygdala (AA) Septum (Spt) Olfactory tubercle (OT) Striatum Globus pallidus (GP) Caudate putamen (CP) Ganglionic eminence (GE) Hippocampus (H) Dentate gyrus (DG) Cortex Cortical ventricular zone (VZ/SVZ) Piriform (Pir) Layers V-VI (V-VI) Cortical plate (CxP) Diencephalon Dorsal thalamus (DTh) DLG VLG Paraventricular nucleus (Pvt) VL, VPm/l, Po, Vmt Zona incerta/reticular thalamic nucleus (Zi/Rt) Hypothalamus (Hy) Paraventricular hypothalamic nucleus (Pvh) Lateral/medial preoptic area (L/MP) Nucleus of lateral olfactory tract (LOT) Medial/lateral habenula (M/LHb) expression is detected at E14.5 (Fig. 2C, D), but appears to be strongly up-regulated at E16.5 (Fig. 2H), especially in the most lateral regions where nuclei such as the VPl, VL, ventral posteromedial (VPm) and posterior (Po) thalamic nuclei form (Fig. 6B). Expression in the DLG dramatically increases from E14.5 to E16.5, and then decreases at birth (compare Fig. 2D, H, L). There is no obvious rostro-caudal gradient of expression as there is for 5-HT1D (see below). By birth, 5-HT1B expression remains intense in the reuniens (RE), anterodorsal (Ad), paraventricular thalamic nucleus (Pvt), ventromedial (Vmt) and VPl/m thalamic nuclei (Fig. 2L and Fig. 6B for high magnification at E16.5). Expression in the Rt and Zi increases from E16.5 to P0 (Fig. 2H, L). 5-HT1D The early expression of 5-HT1D transcripts in whole rat embryonic brain previously has been demonstrated at E8-13 using RT-PCR by Bolanos-Jimenez et al. (1997),

E14.5

E16.5

P0

1A1B1D1F 1A

1A1B1D1F 1A 1A

1A1B1D 1F 1A 1A

1A1B1D1F 1A1B1D1F 1F 1A 1F 1A

1A1B1D1F 1A1B1D1F 1D 1A1B1D1F 1A1B1D

1A1B1D 1F 1A1B1D 1F

1F 1A1B1D1F

1D1F 1A1B1D1F

1A1B1D1F

1A1B1D1F

1A1B1D 1F 1A1B1D 1F 1A1B1D 1F

1A1B1D 1A 1D1F 1D1F 1A1B1D1F 1A 1D1F

1A1B1D 1A 1D1F 1A1B1D1F 1A1B1D1F 1A 1D1F

1A1B1D 1A 1D 1F 1B1D 1F 1A1B1D 1F 1A1B1D 1F

1A1B1D1F 1A1B1D1F

1A1B1D1F 1D1F 1B 1A1B1D1F

1B1D 1D 1B1D 1A1B1D

1A1B1D1F

1A1B1D 1F 1A1B1D

but no anatomical data were provided. Here, we observe that 5-HT1D mRNA is detectable as early as E14.5 in the developing forebrain and exhibits a spatial distribution very similar to that of 5-HT1B in several structures. For example, like 5-HT1B, there is abundant expression of 5-HT1D mRNA in the DTh, which peaks in intensity at E16.5. However, the detailed expression patterns for the two receptors differ in the DTh. There is a very slight medial–low to lateral– high gradient of 5-HT1D, with staining particularly intense in the VL and VPl thalamic nuclei (Fig. 6C) but moderate in the DLG (Fig. 3H). Throughout the DTh, 5-HT1D expression presents a more evident rostral–low to caudal– high gradient compared with 5-HT1B (note the absence of 5-HT1D expression in the anterior thalamic nucleus [Fig. 3F] compared with the intense staining observed in the posterior DTh [Fig. 3G, H]). At birth, the 5-HT1D and 5-HT1B expression patterns are similar, restricted to individual thalamic nuclei that include the RE, Pvt and Ad nucleus (Fig. 3K, L). Expression of 5-HT1D in

A. Bonnin et al. / Neuroscience 141 (2006) 781–794

789

Fig. 5. Comparative distribution of 5-HT1D (A, C, E) and 5-HT1F (B, D, F) receptor transcripts in the developing cortex. Coronal sections through the parietal cortex of E14.5 (A, B) and E16.5 (C, D) fetal and P0 (E, F) postnatal brains were hybridized with DIG-labeled riboprobes to the 5-HT1D and 5-HT1F receptor. Both receptors are expressed in the CxP from E14.5 to P0; 5-HT1F transcripts are also detected in the cortical VZ at E14.5 and E16.5 and in deeper cortical layers (V–VI) at P0. Dorsal is to the top and lateral is to the left. Scale bars⫽100 ␮m.

the striatum (CP and GP; Fig. 3A, E, I) and in the AA (Fig. 3C–D, G–H and K–L) is similar to that of 5-HT1B throughout the developmental period examined. Like 5-HT1B, 5-HT1D expression is dense in the MHb and moderate in the lateral habenula (LHb) at earlier time-points (E14.5– E16.5) (see Fig. 6C at E16.5), with down-regulation at birth (compare Fig. 3C, G, L). Like 5-HT1B, 5-HT1D expression is also detected in the LOT at P0 (Fig. 3K). There are several structures in which 5-HT1D and 5-HT1B expression patterns differ. For instance, low 5-HT1D expression is detected in the caudal ganglionic eminence (GE) at E16.5 (Fig. 3G), whereas 5-HT1B transcript is not detected in this structure at any age tested. In the CxP, in contrast to 5-HT1B, 5-HT1D transcript is expressed at E14.5 throughout the antero-posterior and medio-lateral axes (Fig. 3A to D and high magnification view in Fig. 5A). Staining intensity in the CxP is decreased at E16.5 (Fig. 3E to H and high magnification in Fig. 5C) and expands to deeper cortical layers (V–VI; Fig. 5E and Fig. 3I to L) at P0, whereas 5-HT1B expression increases to even greater levels in the lateral CxP compared with prenatal ages (see above). Similarly, whereas expression of 5-HT1B is maintained in specific nuclei of the DTh at P0,

5-HT1D expression is greatly reduced at this age (compare Figs. 2K, L and 3K, L). 5-HT1F Expression of the transcript encoding the 5-HT1F receptor during development has not been reported previously with any method. We found that the level of expression and the pattern of mRNA distribution of this receptor in the embryonic forebrain are similar to those of 5-HT1B and 1D receptor subtypes described above, but also exhibit some unique features. For example, 5-HT1F is expressed at a low level in the proliferative zone of the caudal GE at E14.5 (Fig. 4B, C, D), but not at later stages. Detectable expression of 5-HT1D receptor in the GE also is observed, although not until E16.5. The hippocampus exhibits overlapping, but not identical, patterns of 5-HT1F and 5-HT1D expression at E16.5, with the CA3 region expressing the most robust level of 5-HT1F, compared with the entire Ammon’s horn for 5-HT1D (compare Fig. 3G, H to 4G, H). At P0, 5-HT1F expression, like 5-HT1D, extends throughout the hippocampus (H; Fig. 4K, L). In the developing CxP at E14.5, 5-HT1F is expressed in a medial– high to lateral– low gradient (Fig. 4A–D). Interestingly, 5-HT1F expression

790

A. Bonnin et al. / Neuroscience 141 (2006) 781–794

Fig. 6. Comparative distribution of 5-HT1 receptor subtype transcripts in the E16.5 mouse DTh. Coronal sections of E16.5 fetal brains were hybridized with DIG-labeled riboprobes to the (A) 5-HT1A, (B) 5-HT1B, (C) 5-1D and (D) 5-HT1F receptor. At this age, boundaries between thalamic nuclei are not yet clearly defined; however, each receptor already displays a somewhat unique expression pattern within developing “putative” dorsal thalamic nuclei. Dorsal is to the top and medial is to the left. Scale bars⫽20 ␮m.

is detected in the cortical ventricular zone (VZ) at E14.5 and E16.5 (Fig. 5B, D) whereas 5-HT1D is not detected until E16.5 (compare Fig. 5A–B at E14.5 and Fig. 5C–D at E16.5). At birth, 5-HT1F expression in the rostral part of the cortex becomes prominent in deeper cortical layers (V, VI; Fig. 4I, J and high magnification view in Fig. 5F). 5-HT1F expression in the AA is evident at E14.5 and is maintained at that level through birth (Fig. 4C, H, L), similar to the pattern for other 5-HT1 receptor subtypes. 5-HT1F also is expressed in the MHb at E14.5, but unlike 5-HT1D, its expression appears to be down-regulated at E16.5 and P0. In contrast to these similarities, expression in the DTh and epithalamus appears different from that of other 5-HT1 class receptors. At E14.5, 5-HT1F is expressed in the most medial regions of the DTh, exhibiting a medial-high to lateral-low gradient (Fig. 4C, D). A similar graded distribution is observed at E16.5 (Fig. 4G, H). Dense expression of 5-HT1F in the Pvt and Vmt and its absence in the MHb are evident at E16.5 (Fig. 6D; compare with Fig. 6A, B, C). In contrast to other 5-HT1 receptors, no expression is detected in the DLG (Fig. 4C, H, K). Thus, expression of 5-HT1F receptor mRNA is more restricted to medial re-

gions when compared with other 5-HT1 receptor subtypes, and is generally more prevalent in proliferative cells along the ventricles (cortical VZ, DTh, caudal GE).

DISCUSSION The present study represents a detailed assessment of the developing expression patterns of mRNAs encoding specific 5-HT1 receptor subtypes prenatally, and the data demonstrate highly selective and dynamic expression patterns. The results provide a developmental canvas for the sequential regulation of 5-HT signaling that may influence neural development and could have important implications relating to the etiology of abnormal adult brain function (see Gross et al., 2002; Gaspar et al., 2003). Relating 5-HT receptor transcript, protein and ligand-binding patterns The present in situ hybridization study reveals the presence of mRNA for 5-HT receptors during prenatal development. A small number of studies indicate that

A. Bonnin et al. / Neuroscience 141 (2006) 781–794

5-HT1 receptors are functional at these ages. During gestation, 5-HT receptor transcripts, 5-HT binding sites and transcripts for intracellular effectors associated with 5-HT receptors are present in overlapping patterns. Previous pharmacological studies have demonstrated the presence of 5-HT1A, 1B and 1D binding sites in whole embryonic rodent brain (Bolanos-Jimenez et al., 1997; Gross et al., 2002), with 5-HT1B binding sites being at least 50% less abundant than the estimated density of 5-HT1D receptors in E13.5 and E15 mouse brain (Bolanos-Jimenez et al., 1997). Interestingly, members of the 5-HT1 receptor class inhibit adenylate cyclase activity via Gi/o-proteins, and a recent study describing the expression patterns of adenylate cyclases type 1 and 8 mRNA at E15.5 in the mouse (Nicol et al., 2005) shows a striking similarity with 5-HT1 receptor expression patterns, especially in the DTh and M/LHb. 5-HT1 receptors and development of the DTh Our in situ hybridization analysis revealed a key feature common to all members of the 5-HT1 receptor class; there is robust and transient expression in the developing DTh; 5-HT1A, 1B, 1D and 1F mRNAs are detected in the early developing DTh during a time period when TCAs and corticothalamic axons grow toward the cortex and DTh respectively (Molnar and Blakemore, 1995; Molnar et al., 1998; Braisted et al., 1999; Torii and Levitt, 2005). Moreover, the expression patterns of certain 5-HT1 receptor transcripts are reminiscent of those of several axon guidance molecules involved in the establishment of TCA projections, including Robo1/2 and DCC/Unc-5, which are receptors for Slit-1/2 and netrin-1 guidance/growth promoting factors, respectively (Serafini et al., 1996; Braisted et al., 2000; Shu et al., 2000; Bagri et al., 2002). For instance, Robo1 is expressed in the medial part of DTh at E14.5 in a pattern reminiscent of 5-HT1F expression at E14.5–16.5. In contrast, at these ages, Robo2 is expressed more broadly throughout the DTh, and also in the CP and CxP (Bagri et al., 2002), in a pattern very similar to that of the 5-HT1D receptor described here. At E14.5, DCC expression is detected in the VZ of the DTh and in the mantle zone corresponding to the future VPm/l thalamic nuclei (Braisted et al., 2000); at this age, 5-HT1F and 5-HT1B/1D receptor transcripts are also expressed in these regions. Interestingly, the high expression level of DCC in the MHb at E14.5 reported by Braisted et al. (2000) also appears to fully overlap with that of the 5-HT1B/1D receptor at E14.5–16.5. Such similarities between the expression patterns of axon guidance molecule receptors and 5-HT receptors raise the possibility that 5-HT could influence TCA circuit formation embryonically, a hypothesis that can be tested empirically. There are some limited data indicating an early role for 5-HT in mediating DTh development. Earlier studies have shown that 5-HT, through 5-HT1B receptor activation, can promote modest axon outgrowth from E15 mouse DTh neurons in vitro (Lotto et al., 1999). Studies from our own laboratory indicate that, in fact, multiple

791

5-HT receptors may contribute directly to the regulation of thalamic axons outgrowth (A. Persico and P. Levitt, unpublished observations). Serotonergic modulation of neurite outgrowth is consistent with cAMP-dependent signaling pathways being activated downstream of 5-HT1 receptors (see Goldberg, 1998). The most consistent evidence that the modification of brain levels of 5-HT during fetal and postnatal development influences DTh development is from the analyses of the postnatal patterning of sensory maps in the rodent neocortex (Bennett-Clarke et al., 1994; Cases et al., 1996). The specific mechanism underlying the alteration of TCA patterning is unknown, but the 5-HT1B receptor has been implicated in the process of finetuning TCA arborization during the final steps of cortical barrel field formation postnatally, through a mechanism dependent on DTh neurons activity (Young-Davies et al., 2000; Salichon et al., 2001; Laurent et al., 2002). An analysis of barrel field formation in the 5-HT1B knock-out mouse failed to reveal any disruption in this process (Salichon et al., 2001), however, raising the question of whether other 5-HT receptors may be able to compensate for the absence of 5-HT1B during critical steps of TCA circuit formation. From the anatomical analysis of receptor expression patterns reported here, this potential compensation might well occur during embryonic development, when 5-HT1B and 5-HT1D receptor expression patterns overlap the most, rather than postnatally when 5-HT1D expression is far less abundant in the DTh. Interestingly, our results indicate that most of the Gi/o-coupled 5-HT1 receptor subtypes are expressed in patterns suitable for influencing the process of TCA maturation and barrel formation. 5-HT1B and 5-HT1D receptors have very similar structural and functional characteristics (see Hoyer et al., 2002), and our data demonstrate for the first time that, in the DTh, 5-HT1D expression overlaps with that of 5-HT1B prenatally. Following the high level of embryonic expression, 5-HT1D transcript is downregulated postnatally rather substantially, and remains only in a few forebrain regions (Bonaventure et al., 1998a,b). This transient expression of 5-HT1D embryonically strengthens the likelihood that this receptor plays a prominent role during development. A corresponding down-regulation of the density of 5-HT1D binding sites in the adult CNS compared with embryonic tissue also has been reported (Bolanos-Jimenez et al., 1997). The transient nature of these expression patterns suggests that thalamic neurons would be responsive to 5-HT via 5-HT1 receptor subtypes only during a limited developmental time-window, when 5-HT may be serving primarily as a growth factor. Possible mechanisms of 5-HT receptor influences on neuronal development In vitro studies have shown that 5-HT induces a modest stimulation of neurite outgrowth (Haydon et al., 1984, 1987; Lieske et al., 1999; Lotto et al., 1999; Vitalis and Parnavelas, 2003). We hypothesize that 5-HT receptor activation may serve an additional function, as a modulator of other biological activities that influence CNS

792

A. Bonnin et al. / Neuroscience 141 (2006) 781–794

development. For example, prenatal disruption of 5-HT levels resulted in normal forebrain GABAergic neuron migration, but the cells were distributed abnormally in the CxP and in some cases displayed abnormal processes (Vitalis and Parnavelas, 2003). We showed here that mRNA encoding some members of the 5-HT1 receptor class, specifically 5-HT1D and 1F, are expressed within the proliferative zones of the thalamus, cortex and basal forebrain (including the caudal GE), and thus are in position to mediate or modulate specific aspects of the development of neuronal or glial progenitors. Conversely, the 5-HT1A receptor is abundant in newly differentiated neurons and is mostly absent from progenitor cell-rich ventricular regions. This expression pattern of 5-HT1A, in fact, is complementary to that of Hes1/5 (bHLH transcription factor “hairy and enhancer of split 1”), a negative regulator of neuronal differentiation specifically expressed in ventricular regions that was recently shown to repress 5-HT1A transcription in vitro (Lemonde et al., 2003; Albert and Lemonde, 2004; see also the BGEM database for a description of Hes1/5 expression patterns at E15.5 in the mouse forebrain). Finally, the present study shows that during prenatal development, members of the 5-HT1 receptor subfamily overlap in some degree in their expression pattern in several developing forebrain structures. We suggest that the lack of severe developmental abnormalities due to the genetic deletion of one specific 5-HT receptor could result from a potential compensatory mechanism, served by the expression of other family members in the same structures at similar developmental stages. During later postnatal development, however, when 5-HT1 receptor expression patterns display less overlap, the absence of one specific receptor subtype may have more significant impact on 5-HT signaling, leading to the wellknown abnormal behavioral phenotypes seen in knockout animals. For example, despite an absence of gross neurodevelopmental alteration, both 5-HT1A and 5-HT1B knockout mice display robust, atypical behavioral phenotypes (increased and decreased anxiety respectively; Gross et al., 2002; El-Khodor et al., 2004). Moreover, the anxious phenotype exhibited by the 5-HT1A knockout mouse was determined during a sensitive period early postnatally (P5–P21; Gross et al., 2002). A decreased anxiety/hyperactivity phenotype is observed as early as P6 in mice lacking the 5-HT1B receptor, indicating the degree to which the absence of this receptor developmentally impacts postnatal CNS function (Brunner et al., 1999; El-Khodor et al., 2004).

CONCLUSION In conclusion, members of the 5-HT1 receptor family are expressed early and in overlapping and unique patterns prenatally in the forebrain, suggesting possible involvement as modulators in the mediation of early histogenic development. Future studies to address this issue, using local alteration of receptor expression (single or in combination) by strategies that include in utero electroporation of

siRNA or antisense viruses, may be valuable both for investigating early receptor function and for avoiding the complication of 5-HT receptor compensation. Acknowledgments—We thank Drs. Kathie L. Eagleson and Masaaki Torii for comments on the manuscript. The work was supported in part by NIMH grant MH65299 and NICHD P30 HD15052 to P.L.

REFERENCES Aitken AR, Tork I (1988) Early development of serotonin-containing neurons and pathways as seen in wholemount preparations of the fetal rat brain. J Comp Neurol 274:32– 47. Albert PR, Lemonde S (2004) 5-HT1A receptors, gene repression, and depression: guilt by association. Neuroscientist 10:575–593. Andrews MH, Kostaki A, Setiawan E, McCabe L, Matthews SG (2004) Developmental regulation of 5-HT1A receptor mRNA in the fetal limbic system: response to antenatal glucocorticoid. Brain Res Dev Brain Res 149:39 – 44. Bagri A, Marin O, Plump AS, Mak J, Pleasure SJ, Rubenstein JL, Tessier-Lavigne M (2002) Slit proteins prevent midline crossing and determine the dorsoventral position of major axonal pathways in the mammalian forebrain. Neuron 33:233–248. Bayer SA, Altman J (1991) Neocortical development. New York: Raven Press. Bennett-Clarke CA, Leslie MJ, Chiaia NL, Rhoades RW (1993) Serotonin 1B receptors in the developing somatosensory and visual cortices are located on thalamocortical axons. Proc Natl Acad Sci U S A 90:153–157. Bennett-Clarke CA, Leslie MJ, Lane RD, Rhoades RW (1994) Effect of serotonin depletion on vibrissa-related patterns of thalamic afferents in the rat’s somatosensory cortex. J Neurosci 14:7594 –7607. Blue ME, Erzurumlu RS, Jhaveri S (1991) A comparison of pattern formation by thalamocortical and serotonergic afferents in the rat barrel field cortex. Cereb Cortex 1:380 –389. Bolanos-Jimenez F, Choi DS, Maroteaux L (1997) Preferential expression of 5-HT1D over 5-HT1B receptors during early embryogenesis. Neuroreport 8:3655–3660. Bonaventure P, Langlois X, Leysen JE (1998a) Co-localization of 5-HT1B- and 5-HT1D receptor mRNA in serotonergic cell bodies in guinea pig dorsal raphe nucleus: a double labeling in situ hybridization histochemistry study. Neurosci Lett 254:113–116. Bonaventure P, Voorn P, Luyten WH, Jurzak M, Schotte A, Leysen JE (1998b) Detailed mapping of serotonin 5-HT1B and 5-HT1D receptor messenger RNA and ligand binding sites in guinea-pig brain and trigeminal ganglion: clues for function. Neuroscience 82: 469 – 484. Braisted JE, Tuttle R, O’Leary DD (1999) Thalamocortical axons are influenced by chemorepellent and chemoattractant activities localized to decision points along their path. Dev Biol 208:430 – 440. Braisted JE, Catalano SM, Stimac R, Kennedy TE, Tessier-Lavigne M, Shatz CJ, O’Leary DD (2000) Netrin-1 promotes thalamic axon growth and is required for proper development of the thalamocortical projection. J Neurosci 20:5792–5801. Brunner D, Buhot MC, Hen R, Hofer M (1999) Anxiety, motor activation, and maternal-infant interactions in 5HT1B knockout mice. Behav Neurosci 113:587– 601. Buznikov GA, Lambert HW, Lauder JM (2001) Serotonin and serotonin-like substances as regulators of early embryogenesis and morphogenesis. Cell Tissue Res 305:177–186. Cases O, Vitalis T, Seif I, De Maeyer E, Sotelo C, Gaspar P (1996) Lack of barrels in the somatosensory cortex of monoamine oxidase A-deficient mice: role of a serotonin excess during the critical period. Neuron 16:297–307. Choi DS, Ward SJ, Messaddeq N, Launay JM, Maroteaux L (1997) 5-HT2B receptor-mediated serotonin morphogenetic functions in

A. Bonnin et al. / Neuroscience 141 (2006) 781–794 mouse cranial neural crest and myocardiac cells. Development 124:1745–1755. Davies PA, Pistis M, Hanna MC, Peters JA, Lambert JJ, Hales TG, Kirkness EF (1999) The 5-HT3B subunit is a major determinant of serotonin-receptor function. Nature 397:359 –363. Dinopoulos A, Dori I, Parnavelas JG (1997) The serotonin innervation of the basal forebrain shows a transient phase during development. Brain Res Dev Brain Res 99:38 –52. Dori I, Dinopoulos A, Blue ME, Parnavelas JG (1996) Regional differences in the ontogeny of the serotonergic projection to the cerebral cortex. Exp Neurol 138:1–14. El-Khodor BF, Dimmler MH, Amara DA, Hofer M, Hen R, Brunner D (2004) Juvenile 5HT(1B) receptor knockout mice exhibit reduced pharmacological sensitivity to 5HT(1A) receptor activation. Int J Dev Neurosci 22:405– 413. Garcia-Alcocer G, Sarabia-Altamirano G, Martinez-Torres A, Miledi R (2005) Developmental expression of 5-HT 5A receptor mRNA in the rat brain. Neurosci Lett 379:101–105. Gaspar P, Cases O, Maroteaux L (2003) The developmental role of serotonin: news from mouse molecular genetics. Nat Rev Neurosci 4:1002–1012. Goldberg JI (1998) Serotonin regulation of neurite outgrowth in identified neurons from mature and embryonic Helisoma trivolvis. Perspect Dev Neurobiol 5:373–387. Grimaldi B, Bonnin A, Fillion MP, Ruat M, Traiffort E, Fillion G (1998) Characterization of 5-ht6 receptor and expression of 5-ht6 mRNA in the rat brain during ontogenetic development. Naunyn Schmiedebergs Arch Pharmacol 357:393–400. Gross C, Zhuang X, Stark K, Ramboz S, Oosting R, Kirby L, Santarelli L, Beck S, Hen R (2002) Serotonin1A receptor acts during development to establish normal anxiety-like behaviour in the adult. Nature 416:396 – 400. Haydon PG, McCobb DP, Kater SB (1984) Serotonin selectively inhibits growth cone motility and synaptogenesis of specific identified neurons. Science 226:561–564. Haydon PG, McCobb DP, Kater SB (1987) The regulation of neurite outgrowth, growth cone motility, and electrical synaptogenesis by serotonin. J Neurobiol 18:197–215. Hellendall RP, Schambra UB, Liu JP, Lauder JM (1993) Prenatal expression of 5-HT1C and 5-HT2 receptors in the rat central nervous system. Exp Neurol 120:186 –201. Hillion J, Milne-Edwards JB, Catelon J, de Vitry F, Gros F, Hamon M (1993) Prenatal developmental expression of rat brain 5-HT1A receptor gene followed by PCR. Biochem Biophys Res Commun 191:991–997. Hoyer D, Hannon JP, Martin GR (2002) Molecular, pharmacological and functional diversity of 5-HT receptors. Pharmacol Biochem Behav 71:533–554. Jacobowitz DM, Abbott LC (1997) Chemoarchitectonic atlas of the developing mouse brain. Boca Raton, FL: CRC Press. Janusonis S, Gluncic V, Rakic P (2004) Early serotonergic projections to Cajal-Retzius cells: relevance for cortical development. J Neurosci 24:1652–1659. Johnson DS, Heinemann SF (1995) Embryonic expression of the 5-HT3 receptor subunit, 5-HT3R-A, in the rat: an in situ hybridization study. Mol Cell Neurosci 6:122–138. Kondoh M, Shiga T, Okado N (2004) Regulation of dendrite formation of Purkinje cells by serotonin through serotonin1A and serotonin2A receptors in culture. Neurosci Res 48:101–109. Lauder JM (1993) Neurotransmitters as growth regulatory signals: role of receptors and second messengers. Trends Neurosci 16: 233–240. Lauder JM, Krebs H (1978) Serotonin as a differentiation signal in early neurogenesis. Dev Neurosci 1:15–30. Lauder JM, Wilkie MB, Wu C, Singh S (2000) Expression of 5-HT(2A), 5-HT(2B) and 5-HT(2C) receptors in the mouse embryo. Int J Dev Neurosci 18:653– 662.

793

Laurent A, Goaillard JM, Cases O, Lebrand C, Gaspar P, Ropert N (2002) Activity-dependent presynaptic effect of serotonin 1B receptors on the somatosensory thalamocortical transmission in neonatal mice. J Neurosci 22:886 –900. Lemonde S, Turecki G, Bakish D, Du L, Hrdina PD, Bown CD, Sequeira A, Kushwaha N, Morris SJ, Basak A, Ou XM, Albert PR (2003) Impaired repression at a 5-hydroxytryptamine 1A receptor gene polymorphism associated with major depression and suicide. J Neurosci 23:8788 – 8799. Levitt P, Moore RY (1978) Developmental organization of raphe serotonin neuron groups in the rat. Anat Embryol (Berl) 154:241–251. Lidov HG, Molliver ME (1982) Immunohistochemical study of the development of serotonergic neurons in the rat CNS. Brain Res Bull 9:559 – 604. Lieske V, Bennett-Clarke CA, Rhoades RW (1999) Effects of serotonin on neurite outgrowth from thalamic neurons in vitro. Neuroscience 90:967–974. Lotto B, Upton L, Price DJ, Gaspar P (1999) Serotonin receptor activation enhances neurite outgrowth of thalamic neurones in rodents. Neurosci Lett 269:87–90. Luo X, Persico AM, Lauder JM (2003) Serotonergic regulation of somatosensory cortical development: lessons from genetic mouse models. Dev Neurosci 25:173–183. McCobb DP, Haydon PG, Kater SB (1988a) Dopamine and serotonin inhibition of neurite elongation of different identified neurons. J Neurosci Res 19:19 –26. McCobb DP, Cohan CS, Connor JA, Kater SB (1988b) Interactive effects of serotonin and acetylcholine on neurite elongation. Neuron 1:377–385. Moiseiwitsch JR, Lauder JM (1995) Serotonin regulates mouse cranial neural crest migration. Proc Natl Acad Sci U S A 92:7182–7186. Molnar Z, Blakemore C (1995) How do thalamic axons find their way to the cortex? Trends Neurosci 18:389 –397. Molnar Z, Adams R, Blakemore C (1998) Mechanisms underlying the early establishment of thalamocortical connections in the rat. J Neurosci 18:5723–5745. Nicol X, Muzerelle A, Bachy I, Ravary A, Gaspar P (2005) Spatiotemporal localization of the calcium-stimulated adenylate cyclases, AC1 and AC8, during mouse brain development. J Comp Neurol 486:281–294. Paxinos G, Ashwell K, Tork I (1994) Atlas of the developing rat nervous system. San Diego, CA: Academic Press. Persico AM, Mengual E, Moessner R, Hall FS, Revay RS, Sora I, Arellano J, DeFelipe J, Gimenez-Amaya JM, Conciatori M, Marino R, Baldi A, Cabib S, Pascucci T, Uhl GR, Murphy DL, Lesch KP, Keller F (2001) Barrel pattern formation requires serotonin uptake by thalamocortical afferents, and not vesicular monoamine release. J Neurosci 21:6862– 6873. Pranzatelli MR, Galvan I (1994) Ontogeny of [125I]iodocyanopindolollabelled 5-hydroxytryptamine1B-binding sites in the rat CNS. Neurosci Lett 167:166 –170. Rakic P, Lidow MS (1995) Distribution and density of monoamine receptors in the primate visual cortex devoid of retinal input from early embryonic stages. J Neurosci 15:2561–2574. Rubenstein JL (1998) Development of serotonergic neurons and their projections. Biol Psychiatry 44:145–150. Salichon N, Gaspar P, Upton AL, Picaud S, Hanoun N, Hamon M, De Maeyer E, Murphy DL, Mossner R, Lesch KP, Hen R, Seif I (2001) Excessive activation of serotonin (5-HT) 1B receptors disrupts the formation of sensory maps in monoamine oxidase a and 5-ht transporter knock-out mice. J Neurosci 21:884 – 896. Serafini T, Colamarino SA, Leonardo ED, Wang H, Beddington R, Skarnes WC, Tessier-Lavigne M (1996) Netrin-1 is required for commissural axon guidance in the developing vertebrate nervous system. Cell 87:1001–1014. Shu T, Valentino KM, Seaman C, Cooper HM, Richards LJ (2000) Expression of the netrin-1 receptor, deleted in colorectal cancer

794

A. Bonnin et al. / Neuroscience 141 (2006) 781–794

(DCC), is largely confined to projecting neurons in the developing forebrain. J Comp Neurol 416:201–212. Tecott L, Shtrom S, Julius D (1995) Expression of a serotonin-gated ion channel in embryonic neural and nonneural tissues. Mol Cell Neurosci 6:43–55. Torii M, Levitt P (2005) Dissociation of corticothalamic and thalamocortical axon targeting by an EphA7-mediated mechanism. Neuron 48:563–575.

Vitalis T, Parnavelas JG (2003) The role of serotonin in early cortical development. Dev Neurosci 25:245–256. Whitaker-Azmitia PM, Druse M, Walker P, Lauder JM (1996) Serotonin as a developmental signal. Behav Brain Res 73:19 –29. Young-Davies CL, Bennett-Clarke CA, Lane RD, Rhoades RW (2000) Selective facilitation of the serotonin(1B) receptor causes disorganization of thalamic afferents and barrels in somatosensory cortex of rat. J Comp Neurol 425:130 –138.

(Accepted 5 April 2006) (Available online 7 July 2006)