Expression of CD45 isoforms lacking exons 7, 8 and 10

\

Molecular Immunology

PERGAMON

Molecular Immunology 24 "0887# 056Ð065

Expression of CD34 isoforms lacking exons 6\ 7 and 09 E[ Virts\ D[ Barritt0\ W[ C[ Raschke Sidney Kimmel Cancer Center\ 09724 Altman Row\ San Die`o\ CA\ 81010\ U[S[A[ Received 8 January 0887^ accepted 11 February 0887

Abstract The CD34 exon usage pattern of various CD7¦ and CD3¦ T cell lines was studied[ By using the reverse transcription!polymerase chain reaction "RT:PCR# and Southern analysis with exon speci_c or exon junction probes\ we showed that all of the cytotoxic T cell lines and the majority of the helper T cells expressed the 678 isoform as a major splice variant[ Expression of the splice product lacking exons 3Ð6 "isoform 78# was not as ubiquitous[ All Th lines produced mRNA encoding this isoform\ but in only three of the Tc lines was the 78 isoform detectable by RT:PCR[ RNase protection assays with RNA isolated from normal CD7¦ splenic cells demonstrated the 78 splice product was present in low abundance[ The relative abundance of the di}erent isoforms in the thymic lymphoma\ BW4036\ was determined through RNase protection analysis[ The 678 isoform predominates\ representing approximately 64) of the CD34 mRNA whereas the 78 form constitutes about 13)[ In addition\ an isoform lacking exons 3Ð7 "isoform 8# also was detected and comprises approximately 0) of the total CD34 mRNA in this cell line[ Finally\ these studies demonstrate that exon 09 is also used as an alternatively spliced exon[ Þ 0887 Elsevier Science Ltd[ All rights reserved[ Keywords] Alternative splicing^ RT:PCR\ RNase Protection

0[ Introduction Leukocyte common antigen CD34 is an abundant cell surface glycoprotein expressed exclusively on cells of hematopoietic origin[ CD34 is structurally heterogeneous consisting of multiple isoforms ranging in size from 079Ð 119 Kd[ This heterogeneity results from di}erences in the size of the extracellular domain and is due to di}erential RNA splicing of multiple exons encoding segments located near the amino terminus of the molecule "Chang et al[\ 0880^ Shen et al[\ 0874^ Zebedee et al[\ 0889#[ The alternative exon splicing is highly regulated by the di}erent leukocyte populations[ The 119 Kd protein is the predominant isoform expressed by B cells and CD34 RNA isolated from these cells contains all of the variable exons "Shen et al[\ 0874^ Thomas et al[\ 0876#[ Following antigen receptor mediated stimulation of mature B cells\ multiple CD34 transcripts are produced as a result of the splicing of one\ two\ or three of the variable exons "Hathcock et al[\ 0881[ Ogimoto et al[\ 0882#[ In contrast\ thymocytes express the lowest molecular weight isoforms\ ½079 Kd\ resulting from splicing of three or four variable exons "Chang et al[\ 0878\ 0880^ Saga et al[\ 0876\ 0889^  Corresponding author[ Tel[] "508# 349!4889^ fax] "508# 349!2140[ 0 Present address] The Burnham Institute 09890 N[ Torrey Pines Road\ La Jolla\ CA 81926\ U[S[A[ Tel[] "508# 344!5379[ 9050!4789:87 ,08[99 Þ 0887 Elsevier Science Ltd[ All rights reserved[ PII] S 9 0 5 0 ! 4 7 8 9 " 8 7 # 9 9 9 1 4 ! X

Shen et al[\ 0874^ Zebedee et al[\ 0889#[ Peripheral T cells exhibit more varied exon splicing patterns expressing di}erent isoforms depending on function\ di}erentiation state\ and prior antigenic experience[ A single cell usually expresses multiple species of CD34 mRNA[ Di}erential RNA splicing of the CD34 transcript was originally shown to involve three exons "Ralph et al[\ 0876^ Streuli et al[\ 0876^ Thomas et al[\ 0876#[ Our studies on the isoforms expressed by di}erent murine T cell popu! lations\ as well as the work of others\ provided the obser! vation of alternative splice forms lacking exons 6 and 7 "Chang et al[\ 0880^ Zebedee et al[\ 0889#[ We have now extended this analysis to determine which hematopoietic lineages express these isoforms\ how prevalent these iso! forms are in particular cells and whether additional exons are involved in the generation of CD34 isoforms[

1[ Materials and methods 1[0[ Cell lines The cell lines and sources of RNA used in this study are listed in Table 0[ PGL!09B has been rendered non! responsive to TCR stimulation by treatment with 099 units:ml IL!1 for 37 h while PGL!09A is the untreated control line[ Non!transformed C46BL:5 CD7¦ splenic

057

E[ Virts et al[:Molecular Immunology 24 "0887# 056Ð065

Table 0 Characteristics and sources of the cell lines Cell line

Cell type

Source

PGL!09Aa PGL!09Ba D0[0 M153[26 OI5 OI06 CDC!24 D09 4E6 OH1 OH3 OH5 OH7 OL2 F3 07Ð70 A19

Th0 Th0 Th0 Th0 Th0 Th0 Th1 Th1 Tc Tc Tc Tc Tc Tc pre!B pre!B pre!B

F[ Fritch and P[ Fields F[ Fritch and P[ Fields R[ Co}man R[ Co}man O[ Kanagawa O[ Kanagawa R[ Co}man R[ Co}man F[ Fitch O[ Kanagawa O[ Kanagawa O[ Kanagawa O[ Kanagawa O[ Kanagawa E[ Siden E[ Siden R[ Maki

line composite gel ð0) Seakem LE Agarose\ 1) NuSieve "FMC Corporation\ Rockland\ ME\ U[S[A[#Ł prepared in a solution consisting of 49 mM NaCl and 0 mM EDTA[ The gel was equilibrated for 29 min in alkaline electrophoresis bu}er "29 mM NaOH\ 0 mM EDTA# and run under alkaline conditions as described "Maniatis et al[\ 0871#[ 1[3[ Southern analysis The PCR products were transferred to Zetaprobe "BioRad\ Hercules\ CA\ U[S[A[# using the alkaline trans! fer conditions provided by the manufacturer[ The mem! branes were prehybridized at 26>C in 4×SSPE\ 0×BP ð9[4) w:v bovine serum albumin\ 9[4) poly! vinylpyrrolidone 25\999Ð39\999 "Sigma\ St Louis\ MO\ U[S[A[#Ł and 0) SDS for 0Ð1 h[ Radiolabeled oli! gonucleotide was generated using T3 polynucleotide kin! ase by standard procedures "Maniatis et al[\ 0871#[

a

See Materials and methods for a description of the growth conditions of these cell lines[

T cells "CD7¦ Sp# were selected by panning and then expanded by one round of stimulation in vitro in mixed lymphocyte culture with BALB:c spleen cells[ After two days the resulting cell population was greater than 87) CD7¦[ 1[1[ RNA Isolation Total RNA was puri_ed from the cell pellets with guanidine thiocyanate using the protocol provided in the RNAgents total RNA isolation system "Promega\ Madi! son\ WI\ U[S[A[#[ RNA was resuspended in water pre! viously treated with diethylpyrocarbonate[ 1[2[ Reverse transcription and polymerase chain reactions cDNA was prepared in a 09 ml reaction containing 4 ml total RNA\ l× reverse transcription bu}er "Promega#\ 4 units RNasin "Promega#\ 0 mg BSA\ 149 ng antisense oligonucleotide primer "Table 1# and 199 units M!MLV reverse transcriptase "Promega#[ The mixture was incu! bated for 89 min at 31>C followed by 1 min at 099>C[ Three microliters of the resulting cDNA was ampli_ed in a 099 ml reaction mixture containing 0×Taq DNA polymerase bu}er "09 mM Tris!HCl\ pH 7[2\ 49 mM KCl\ 0[4 mM MgCl1\ 9[0) w:v gelatin#\ 199 mM dNTP|s\ 149 ng each sense and antisense oligonucleotide primers "Table 1# and 0 unit Taq DNA polymerase "Perkin!Elmer Cetus\ Foster City\ CA\ U[S[A[#[ The samples were sub! jected to 23 PCR cycles[ The _rst cycle consisted of 2 min at 83>C\ 0 min at 49>C and 2 min at 61>C[ The remaining cycles were 0 min at 83>C\ 0 min at 49>C and 2 min at 61>C[ The ampli_ed products were analysed on an alka!

1[4[ RNase protection analysis RNase protection assays were carried out using a modi_cation of the protocol described by Winter et al[ "0874#[ The Riboprobe Gemini System II "Promega# was used to synthesize a 21P!labelled antisense RNA transcript in vitro from the transcription vector pGEM00Z"¦# "Promega# with an insert consisting of a PCR fragment containing the last 58 bp of exon 1\ exons 2Ð7 and the last 022 bp of exon 8[ The labelled antisense RNA was hybridized overnight at 34>C to 09 mg total cellular RNA in bu}er "39 mM Pipes\ pH 5[3\ 0 mM EDTA\ 399 mM NaCl\ and 49) formamide#[ The hybridization mixtures were digested with a combination of RNase A "89\ 29\ 7\ 2[2\ or 0[0 mg:ml# and RNase T0 "1 U:ml# at 23>C for 0 h[ The digestion products were analysed on a 5) poly! acrylamide\ 7M urea gel[ As a positive control\ sense RNA was transcribed from the same vector as the anti! sense probe and hybridized to the labelled antisense RNA[ 2[ Results 2[0[ RT:PCR To further evaluate the CD34 exon usage of particular hematopoietic cell types\ RT:PCR was used to analyse mRNA from a variety of hematopoietic cell populations[ The two PCR primers\ oligonucleotides 07 and 08 "Table 1\ Fig[ 0#\ located in exon 1 and 8 respectively\ ~ank the region of alternative exon usage[ The PCR products were characterized on the basis of size and hybridization to oligonucleotide probes speci_c for the individual exons or for the exon junction regions "Table 1\ Fig[ 0#[ It should be noted that all the PCR fragments will contain

058

E[ Virts et al[:Molecular Immunology 24 "0887# 056Ð065 Table 1 Sequences and location of the RT:PCR primers and probes Primers

Sequence 4? to 2?

Nucleotide position

07 08 57 70

GCACAGCTGATCTCCAGATATGACCATGGGT GAGGATTGTGAAAACGTGTTAAATAATCTAGAAGAATGCTC CGTGTTAAATAATCTAGAAGAATGCTCAC GTCAGTTGGACAACCTTCGTGCC

10Ð40 of Ex[ 1 041Ð091 of Ex[ 8 "antisense# 005Ð033 of Ex[ 8 60Ð37 of Ex[ 00 "antisense#

Probes

Sequence 4? to 2?

Nucleotide position

Exon 1 Exon 3 Exon 4 Exon 5 Exon 6 Exon 8 Exon 09 Junction 2Ð4 Junction 2Ð6 Junction 2Ð7 Junction 2Ð8

TTTGCCCTTCTGGACACAGAAGT CAACAGAGAATGCCCTTCTTCTGCC GACTCGCAGACGCCCTCTGC CACACCTCCAATGTCAGCACCACAG GGGCCTTGCAAGCACTGACCCTCCAAGCAC GTGTCTAATGACTCATGTGCTCC GCAACAGTGACAATATTTCATATGTACTCCAC GTGATGGTGTGTTAT GTGATGGTGCCAGCC CAGTGATGCTACCACA CAGTGATGCTGCCATG

68Ð090 of Ex[ 1 09Ð23 of Ex[ 3 31Ð50 of Ex[ 4 094Ð018 of Ex[ 5 04Ð33 of Ex[ 6 072Ð050 of Ex[ 8 "antisense# 099Ð020 of Ex[ 09 08Ð14 of Ex[ 2¦0Ð8 of Ex[ 4 08Ð14 of Ex[ 2¦0Ð8 of Ex[ 6 06Ð14 of Ex[ 2¦0Ð7 of Ex[ 7 06Ð14 of Ex[ 2¦0Ð7 of Ex[ 8

a portion of exons 1 and 8 and all of exon 2\ but the designation of each isoform will only include exons 3\ 4\ 5\ 6\ 7 and 8\ e[g[ isoform 345678\ isoform 678 "lacking exons 3\ 4 and 5#\ etc[ as described previously "E[ Virts et al[\ Molecular Immunology\ in press#[ The RT:PCR ampli_cation of RNA from these various cell types resulted in the production of multiple frag! ments[ Five of these PCR products were isolated\ cloned and sequenced to con_rm the exons present[ The 660 bp product includes all exons "designated the 345678 isoform#[ The 531 bp ampli_cation fragment lacks exon 3 "isoform 45678#[ The 490 bp product consists of alter! native exons 4\ 6 and 7 "isoform 4678# and the 243 bp fragment is made up of variable exons 6 and 7 "isoform 678#[ Finally\ splicing of exons 3Ð6 produces a 171 bp fragment "isoform 78#[ 2[1[ Expression of the 78 CD34 isoform Thymocytes express a low molecular weight CD34 iso! form and cDNA clones corresponding to an isoform lacking exons 3\ 4 and 5 have been commonly observed and isolated "Trowbridge and Thomas\ 0883^ Zebedee et al[\ 0889#[ RT:PCR analysis of the RNA isolated from the thymic lymphoma BW4036 exempli_es these results "Fig[ 1#[ A 243 bp fragment resulting from the ampli! _cation of mRNA encoding the characteristic thymocyte CD34 isoform lacking exons 3\ 4 and 5 "isoform 678# was detected[ In addition\ a second major fragment approxi! mately equal in abundance to the 678 isoform fragment was observed[ This product of 171 bp is consistent with the 78 isoform resulting from a splice from exon 2 to exon 7 "Fig[ 1#[ No other ampli_cation products were detected in this cell line[

RT:PCR experiments were carried out using six cyto! toxic T cell lines and non!transformed CD7¦ spleen cells[ The results of the Southern analysis shown in Figs 1 and 2 are summarized in Table 2[ Three of these cell lines\ OH5\ OH7 "Fig[ 1# and 4E6 "Fig[ 2\ panel d\ lane A#\ produced low but readily detectable levels of mRNA for the 78 isoform[ However\ using this detection procedure\ the 78 splice variant is marginally detectable\ if at all\ in CD7¦ spleen cells and the remaining Tc lines[ With respect to the other CD34 isoforms\ the cytotoxic T cells exhibited similar CD34 expression patterns[ mRNA encoding the 4678 and 678 forms predominated[ The 45678 isoform was present at low levels[ Cell line 4E6 was unique in expressing the 345678 splice product[ The CD34 mRNAs from seven di}erent Th lines were ampli_ed using RT:PCR "Figs 1 and 2\ Table 2#[ Although the pattern of exon combinations in these cell lines di}er dramatically\ all express mRNA encoding the 78 isoform[ However\ a common expression pattern of the other iso! forms in these cell lines was not observed[ PGL!09A was unique in expressing _ve isoforms "Fig[ 2\ panels aÐh\ lane E#[ The remaining helper T cells encoded heterogeneous subsets of these splice forms[ Comparison of the CD34 isoforms produced by PGL!09A with those detected in PGL!09B shows that treatment with IL!1 has no e}ect on the expression of the 678 or 78 forms but does result in loss of both the 45678 and 4678 splice products[ 2[2[ RNase protection assays To con_rm the exon usage patterns determined with the RT:PCR and hybridization analysis and to assess more quantitatively the relative levels of expression of the mRNAs for the isoforms lacking exons 6 and 7\

069

E[ Virts et al[:Molecular Immunology 24 "0887# 056Ð065

Fig[ 0[ Strategy for RT:PCR ampli_cation and probing of the region of alternate exon usage in CD34[ "A# The CD34 cDNA containing the alternative exons "3Ð7# and the ~anking exons "1\ 2 and 8# are shown[ The position and orientation of the primers\ 07 and 08\ are shown with arrows[ The locations of the probes for speci_c exons and exon junctions used in the Southern analysis are also indicated[ "B# The expected ampli_cation products and their corresponding sizes are given[ The dark and hatched boxes indicate the regions within exons 1 and 8\ respectively\ which will be common to all fragments[ Isoform Mr indicates the approximate molecular weight of the full length protein isoform[

Table 2 Principle exon usage by individual leucocyte cell lines Exons present

Cytotoxic T cells CD7¦SP OH1 OL2 OH3

345678 45678 4678 678 78

¦ ¦ ¦ W

¦ ¦ ¦

Th0 OH5 OH7

¦ ¦ ¦

W  band appears after prolonged exposure[

4E6

OI5 D0[0 OI06 PGL!09B M153!26

PGL!09A

¦ ¦ ¦ ¦ ¦

¦

¦ ¦ ¦ ¦ ¦

¦ ¦

¦ W ¦ ¦

Th1

B

Thymocyte

CDC!24 D09

A19

BW4036

¦ W ¦

¦ W ¦ ¦ ¦

¦ ¦

E[ Virts et al[:Molecular Immunology 24 "0887# 056Ð065

060

Fig[ 1[ Southern analysis of RT:PCR fragments from di}erent leukocyte cell lines[ The cell lines used for RNA isolation are at the top[ CD7¦ splenic lymphocytes "CD7¦Sp# were selected as described in Materials and methods[ The ampli_cation primers were 07 and 08 "Fig[ 0 and Table 1#[ The probe was in exon 1 "Fig[ 0 and Table 1#[ The exons present in each fragment and their corresponding sizes are indicated[ Five cloned and sequenced PCR fragments containing the exons indicated were ampli_ed from the plasmids and served as size standards[

Fig[ 2[ RT:PCR ampli_cation of RNA isolated from various T cell populations[ The cell lines used and their corresponding lane designations are given in Panel a[ One microgram of the 099 bp ladder "Life Technologies# was loaded[ The exons present in each ampli_cation product and their sizes are indicated at the right and left\ respectively\ of each panel[ The ampli_cation primers were 07 and 08 as described in Fig[ 0 and Table 1[ The probes "Fig[ 0 and Table 1# are given below each panel[ The smallest visible band from the 099 bp ladder is 199 bp[

RNase protection assays were performed[ In these assays\ a 21P!labelled antisense transcript was synthesized in vitro from a cloned PCR fragment encoding exons 2Ð7 plus portions of exon 1 and exon 8 "Fig[ 3\ top#[ The transcript was annealed with total RNA from the test cell popu! lation and duplexes were digested with a mixture of RNase A and RNase T0[ The digestion products were analysed on a polyacrylamide sequencing gel and the

sizes of the protected fragments used to identify exon usage patterns[ The RNase protection assay is also useful for quantitating relative expression of the di}erent iso! forms and various concentrations of RNase A were used to determine the optimal quantitation conditions which limit RNase A overdigestion[ Digestion with RNase A at a concentration of 89 mg:ml resulted in overdigestion with the generation of smaller fragments "Fig[ 3\ lane A#[

061

E[ Virts et al[:Molecular Immunology 24 "0887# 056Ð065

Fig[ 3[ Determination of CD34 splice variants in BW4036 by RNase protection assays[ The riboprobe was generated as described in Materials and methods and is shown at the top[ The sizes and exon composition of the protected fragments are also given[ The following amounts of the BW4036 mRNA were used] lanes AÐE and H\ 09 mg^ lane G\ 19 mg^ lane 0\ 4 mg[ Lane F represents the fragment fully protected by the riboprobe[ Two separate experiments are shown\ lanes AÐF and GÐI[ A longer exposure of GÐI was used to show the presence of minor bands[ The individual lanes vary in amounts of RNase A and RNase T0[ RNase A was added at the following concentrations] Lane A\ 89 mg:ml^ Lane B\ 29 mg:ml^ Lane C\ 2[2 mg:ml^ Lane D\ 0[0 mg:ml^ Lane E\ 9 mg:ml^ Lane F\ 2[2 mg:ml^ Lanes G\ H and I\ 7 mg:ml[ RNase T0 was present at 1 U:ml except in Lane E where it was 099 U:ml[

Initially\ CD34 mRNAs from BW4036 were analysed "Fig[ 3#[ The RT:PCR analysis of this cell line indicated the approximately equal presence of the 678 and the 78 isoforms "Fig[ 1#[ Four cleavage products were generated by RNase treatment of the duplexes between the anti! sense probe and the CD34 mRNAs present[ A 097 bp fragment was protected from digestion by RNA con! taining exons 1 and 2[ RNA encoding exons 6\ 7 and 8 protected a 118 bp fragment and a 046 bp product resulted from protection of exons 7 and 8 only "Fig[ 3\ lanes AÐE#[ The fourth fragment\ 022 bp\ was produced by pro!

tection of the antisense probe by RNA encoding the 8 isoform[ This isoform was not detected by RT:PCR! Southern analysis[ However\ this splice variant was shown to exist in this line through the cloning and sequ! encing of the cloned RT:PCR fragments and the isolation of one cloned fragment lacking exons 3 through 7[ There! fore\ BW4036 expresses a low amount of the 8 splice variant[ The relative levels of the 118 bp\ 046 bp and 022 bp cleavage products in Fig[ 3\ lane D were determined through densitometry and together with the known per! centage of cytosines "the labeled nucleotide# in the frag!

E[ Virts et al[:Molecular Immunology 24 "0887# 056Ð065

ment were used to quantitate relative amounts of the isoform mRNAs[ The 678 isoform is predominant\ rep! resenting approximately 64) of the BW4036 CD34 mRNA whereas the 78 and 8 forms comprise approxi! mately 13) and 0)\ respectively[ Similar RNase protection assays were performed using RNA from normal splenic CD7¦ T cells and from CD7¦ cell line\ OH3\ and the mastocytoma\ P704[ As controls\ sense RNA was synthesized in vitro from the cloned PCR fragments containing all variably spliced exons "Fig[ 4\ lane A19# or exons 4\ 6 and 7 "Fig[ 4\ lane 09P01#[ Each of these cloned fragments also contain exon 2 and por! tions of exons 1 and 8 as diagrammed in Fig[ 0[ As expected\ the sense probe carrying the complete comp! lement of variable exons protected the full length probe "643 bp# "Fig[ 4\ lane A19#[ RNase digestion of the duplex between the in vitro synthesized sense RNA lacking exons 3 and 5 and the antisense probe generated three protected products[ The 118 bp product resulted from protection

Fig[ 4[ RNase protection assays of di}erent leukocyte cell lines[ The riboprobe was generated as described in Materials and methods[ The cell lines used are indicated at the top[ The lanes for BW4036 are a shorter exposure of lanes G\ H\ and I in Fig[ 3[ For A19 and 09P01 assays\ 09 mg:ml RNase A and 1 U:ml RNase T0 were used[ The three lanes for each of the other cell lines di}er in the amount of RNase A used\ left to right] 09 mg:ml^ 2[2 mg:ml^ and 0[0 mg:ml[ RNase T0 was used at 1 U:ml[ The sizes of the protected fragments and the exons present are indicated[

062

by exons 6\ 7 and 8^ the 036 bp fragment was protected by exon 4 alone and RNA encoding exons 1 and 2 pro! tected the 097 bp fragment[ Based on RT:PCR analysis "Fig[ 1# the cytotoxic T cell line OH3 and the CD7¦ splenic T cells expressed similar CD34 splice forms\ the 45678\ the 4678 and the 678 isoforms[ The RNase protection assays support this _nd! ing[ A 406 bp fragment characteristic of protection of the antisense probe by RNA containing exons 4\ 5\ 6\ 7 and 8 and a 118 bp digestion product indicative of protection by RNA encoding exons 6\ 7 and 8 clearly con_rm the expression of the 45678 and the 678 splice forms\ respec! tively[ The 036 bp fragment is diagnostic for the presence of the 4678 isoform[ In addition\ a 046 bp fragment resulting from the protection of the probe by 78 isoform mRNA was present in low abundance[ The RT:PCR analysis of CD34 isoform expression in mast cells demonstrated the predominant CD34 mRNA in these cells contains variable exons 6 and 7\ although the 4678 form also was easily detected "E[ Virts et al[\ Molecular Immunology\ in press#[ The RNase protection experiments support the RT:PCR results[ As expected\ in the mastocytoma\ P704\ the mRNA encoding variable exons 6 and 7 protected the 118 bp fragment from cleav! age "Fig[ 4#[ The 036 bp product\ diagnostic of the 4678 isoform\ also is detectable on longer exposures than shown in Fig[ 4[ In agreement with the RT:PCR results\ 78 isoform mRNA is not present in these cells even at the low level detectable by RNase protection as no 046 bp fragment is seen[ The relative amounts of these RNase protected frag! ments did not necessarily re~ect the abundance of the PCR ampli_ed products[ For instance\ the RT:PCR analysis of BW4036 suggested that the 678 and 78 iso! forms were present at nearly equal levels^ however\ the quantitation of the RNase protection fragments clearly showed that the 678 form predominated[ In addition\ in normal CD7¦ splenic cells\ the 406 bp protected fragment indicative of the 45678 isoform was present at a higher level than would be predicted from the amount of the 531 bp RT:PCR ampli_cation product from this mRNA "Fig[ 1#[ These discrepancies are probably due to pref! erential ampli_cation of the smaller PCR fragments "Diaco\ 0884^ Saiki et al[\ 0874#[ Finally\ in the OH3\ P704 and CD7¦ spleen cell populations\ the large amount of the 490 bp RT:PCR ampli_cation product suggests that the 4678 isoform is a predominant mRNA species\ but the level of protection of the 036 bp exon 4 fragment indicative of this isoform is much lower than expected[ Preferential ampli_cation of the larger 490 bp fragment over the 243 bp product would be unusual and therefore is not an attractive explanation[ However\ the 036 bp protected fragment in the RNase protection assay may be more susceptable to RNase degradation since exon 4 in this mRNA is surrounded by two non!protected regions[

063

E[ Virts et al[:Molecular Immunology 24 "0887# 056Ð065

2[3[ Other alternative exons With the expansion of the alternatively spliced exons to 4\ we sought to determine if other exons were involved in generating additional isoforms[ Since each of the exons 3Ð02 are multiples of 2 nucleotides in length\ deletion of any of these could be tolerated without shifting the read! ing frame[ Further RT:PCR analysis was carried out on various T and B cell lines to determine if any CD34 isoforms lacked exons 09Ð02[ The antisense primers located in exons 03 or 05 were used with primer 57 within exon 8 "Table 1#[ The PCR products were characterized on the basis of hybridization to an oligonucleotide probe in exon 8 "Table 1# located downstream of primer 57[ The major fragment was the size expected from ampli! _cation of mRNA encoding all exons[ The second prod! uct\ detected only after prolonged exposure of the blot\ was consistent with a product missing one of the down! stream exons[ The size of the fragment and the use of additional oligonucleotide probes showed that this spliced isoform did not contain exon 09[ To con_rm this conclusion\ the RT:PCR analysis was repeated using pri! mers 70 and 57 "lying within exons 00 and 8\ respectively^ Table 1#[ Two products were detected\ a 202 bp fragment containing exon 09 and a 062 bp product lacking exon 09 "Fig[ 5#[ This analysis suggests that only exon 09 is additionally involved in alternative splicing[ 3[ Discussion These studies show that exon 09 may be used as a variable exon in the generation of di}erent CD34 isoforms[ In addition to detecting a new CD34 isoform lacking exon 09\ our results veri_ed and quanti_ed the use of exons 6 and 7 as alternative exons in murine leukocytes "Chang et al[\ 0880#[ The hybridization of a 171 bp PCR

fragment with the probe for the junction between exons 2 and 7 con_rmed the presence of mRNA in which spl! icing had removed exons 3Ð6[ Although no RT:PCR product corresponding to a splice variant lacking exons 3Ð7 was visualized by Southern analysis\ this isoform was identi_ed through both RT:PCR fragment cloning "Zebedee et al[\ 0889# and RNase protection analysis[ The isoform lacking exons 3Ð7 is not a principal splice product in any leukocyte population analysed thus far[ The inclusion of exons 6\ 7 and 09 in the splicing patterns increases the possible number of CD34 isoforms dramatically[ However\ alternative splicing is highly regulated through both cis! and trans!acting factors "Horowitz and Krainer\ 0883# and only a limited number of the potential splice products have been detected in our analyses of murine hematopoietic cell populations[ These include the 345678\ the 45678\ the 4678\ the 678\ the 78 and the 8 isoforms[ The combination of exons present in the isoform"s# lacking exon 09 have not been determined[ CD34 mRNA lacking exon 7\ expressed at very low levels in certain cell populations\ was detected using the sen! sitivity a}orded by RNase protection[ The excision of exon 09 by RNA splicing also was detected at very low levels using RT:PCR with primers and probes speci_cally designed to target a narrow region of the CD34 tran! scripts[ Equally sensitive techniques have not been applied to all the cell types nor to narrow segments of the alternative spliced exon region\ and the existence of minor amounts of additional exon combinations is possible[ The existence of CD34 proteins encoded by mRNA species lacking exon 7 or exon 09 has not been demon! strated\ as is the case for many of the other CD34 isoforms[ Since the excision of exon 7 or 09 does not shift the reading frame\ a reasonable assumption is that the mRNAs are translated into protein[ Unlike exons 3Ð6\ exons 7 and 09 encode cysteines\ one in exon 7 and three

Fig[ 5[ Southern analysis of RT:PCR products from mRNA encoding CD34 isoforms missing additional downstream exons[ The ampli_cation primers were 70 and 57 "Table 1# lying within exons 00 and 8\ respectively[ The cell lines used are indicated at the top[ A probe located within exon 8 "Table 1# was used in Panel A and a probe from exon 09 was used in Panel B[ The sizes of the products\ 202 bp and 062 bp\ are given and correspond to fragments containing exon 09 or lacking exon 09\ respectively[

E[ Virts et al[:Molecular Immunology 24 "0887# 056Ð065

in exon 09\ the deletion of which could dramatically alter protein conformation and thereby potentially create greater divergence from other isoforms in functional interactions or even instability as a translation product[ The T cell lines examined have a complex pattern of exon usage[ These cell lines are heterogeneous with respect to CD34 isoform patterns\ expressing various combinations of multiple isoforms[ In these experiments Th0 and Th1 cell lines did not express distinguishing subsets of CD34 isoforms[ These results are in contrast to reports showing Th0 cells as expressing the smallest CD34 isoforms and Th1 cells as expressing the highest molecular weight isoforms "Birkeland et al[\ 0878^ Lee et al[\ 0889[ Powrie et al[\ 0883[ Saga et al[\ 0889#[ These disparate results are possibly due to di}erences in the particular cell lines used or the in vitro culture conditions "Lee and Vitetta\ 0881#[ All the murine T cell lines express substantial levels of the 78 isoform[ Cytotoxic T cells di}er in exon usage from the helper T cells and encode a less heterogeneous set of CD34 isoforms[ The majority of these cells express primarily the 4678 and 678 isoforms and only cell lines OH5 and OH7 produce in addition the 78 splice form at levels readily detectable using RT:PCR[ Since the natural CD7¦ splenic cells express the 78 isoform at much lower abundance\ the OH5 and OH7 lines probably represent a small subpopulation of cytotoxic T cells or have altered expression after prolonged culture[ These experiments demonstrate that T cells express a heterogeneous com! bination of CD34 isoforms with nearly all cells containing RNA encoding the 678 and 78 forms[ In some cases these two isoforms make up as much as 88) of the total CD34 mRNA[ An additional splice form missing exons 3Ð7 also was identi_ed using the RNase protection assay[ With regard to expression of the 78 splice product in other hematopoietic cell types\ all monocyte lines we have tested contain high levels of this mRNA whereas mast cell lines and in vitro expanded normal mast cells do not produce this CD34 isoform "E[ Virts et al[\ Molecular Immunology\ in press#[ Our studies with human leu! kocyte cell lines "monocyte\ CD3¦\ CD7¦# demonstrated that human monocytes\ in contrast to murine monocytes\ did not express the 78 splice form "E[ Virts et al[\ to be published#[ Human CD3¦ and CD7¦ lines also di}ered from their murine counterparts as they produced lower levels of the 78 splice variant relative to other isoforms present\ but produced amounts of the 8 isoform detect! able at low levels by RT:PCR "E[ Virts et al[\ to be published#[ The relationship between CD34 splice variants and cellular function is not understood at present[ Recent studies using a thymoma cell line transfected to express a speci_c T!cell receptor and CD3 in combination with various CD34 isoforms have indicated the cells bearing low molecular weight isoforms of CD34 preferentially associate with CD3 and the T!cell receptor complex and

064

are more e}ective in responding to antigen!speci_c stimu! lation than those expressing the higher molecular weight isoforms "Novak et al[\ 0883[ Leitenberg et al[\ 0885#[ Individual leukocytes rarely express only one isoform[ Since di}erent hematopoietic subpopulations express some CD34 isoforms in common\ some signaling events through CD34 may be similar for those cell types[ However\ the diversity of isoforms made possible by di}erential splicing and the di}erent combinations of isoforms found on the various cell lineages argues that numerous\ unique ligand interactions and signaling properties are possible through the regulated selection of CD34 isoforms expressed[ Acknowledgement The authors wish to thank R[ Co}man\ F[ Fritch\ P[ Fields\ R[ Maki and O[ Kanagawa for their contributions of cell lines[ This work was supported by a grant from the National Institutes of Health "A023909# to W[ C[ Raschke[

References Birkeland\ M[L[\ Johnson\ P[\ Trowbridge\ I[S[\ Pure\ E[\ 0878[ Changes in CD34 isoform expression accompany antigen!induced murine T! cell activation[ Proc[ Natl[ Acad[ Sci[ U[S[A[ 75\ 5623Ð5627[ Chang\ H[!L[\ Zaroukian\ M[H[\ Esselman\ W[J[\ 0878[ T199 alternate exon use in murine lymphoid cells determined by reverse tran! scription!polymerase chain reaction[ J[ Immunol[ 032\ 204Ð210[ Chang\ H!L[\ Lefrancois\ L[\ Zaroukian\ M[H[\ Esselman\ W[J[\ 0880[ Developmental expression of CD34 alternate exons in murine T cells[ J[ Immunol[ 036\ 0576Ð0582[ Diaco\ R[\ 0884[ Practical considerations for the design of quantitative PCR assays\ In Innis\ M[\ Gelfand\ D[H[ and Sninsky\ J[J[ "Eds#[\ PCR Strategies[ Academic Press\ Inc[\ New York\ pp[ 73Ð097[ Hathcock\ K[S[\ Hirano\ H[\ Murakami\ S[\ Hodes\ R[J[\ 0881[ CD34 expression by B cells] Expression of di}erent CD34 isoforms by subpopulations of activated B cells[ J[ Immunol[ 038\ 1175Ð1183[ Horowitz\ D[S[\ Krainer\ A[R[\ 0883[ Mechanisms for selecting 4? splice sites in mammalian pre!mRNA splicing[ TIG 09\ 099Ð095[ Lee\ W[T[\ Yin\ X[!M[\ Vitetta\ E[ S[\ 0889[ Functional and ontogenetic analysis of murine CD340Rhi and CD34Rlo CD3¦ T cells[ J[ Immu! nol[ 033\ 2177Ð2184[ Lee\ W[T[ and Vitetta\ E[S[\ 0881[ Changes in expression of CD34R during the development of Th0 and Th1 cell lines[ Eur[ J[ Immunol[ 11\ 0344Ð0348[ Leitenberg\ D[\ Novak\ T[J[\ Farber\ D[\ Smith\ B[R[\ Bottomly\ K[\ 0885[ The extracellular domain of CD34 controls association with the CD3!T cell receptor complex and the response to antigen!speci_c stimulation[ J Exp[ Med[ 072\ 138Ð148[ Maniatis\ T[\ Fritsch\ E[F[\ Sambrook\ J[\ 0871[ Molecular Cloning] A laboratory manual[ Cold Spring Harbor Lab[\ Cold Spring Harbor\ NY[ Novak\ T[J[\ Farber\ D[\ Leitenberg\ D[\ Hong\ S[!C[\ Johnson\ P[\ Bottomly\ K[\ 0883[ Isoforms of the transmembrane tyrosine phos! phatase CD34 di}erentially a}ect T cell recognition[ Immunity 0\ 098Ð008[ Ogimoto\ M[\ Katagiri\ T[\ Hasegawa\ K[\ Mizuno\ K[\ Yakura\ H[\ 0882[ Induction of CD34 isoform switch in murine B cells by antigen

065

E[ Virts et al[:Molecular Immunology 24 "0887# 056Ð065

receptor stimulation and by phorbol myristate acetate and iono! mycin[ Cell[ Immunol[ 040\ 86Ð098[ Powrie\ F[\ Correa!Oliveira\ R[\ Mauze\ S[\ Co}man\ R[L[\ 0883[ Regu! latory interactions between Cd34RBhigh and CD34RBlow Cd3¦ T cells are important for the balance between protective and patho! genic cell!mediated immunity[ J[ Exp[ Med[ 068\ 478Ð599[ Ralph\ S[J[\ Thomas\ M[L[\ Morton\ C[C[ and Trowbridge\ I[S[\ 0876[ Structural variants of human T199 glycoprotein "leukocyte!com! mon antigen#[ EMBO J[ 5\ 0140Ð0146[ Saga\ Y[ Tung\ J[!S[\ Shen\ F[!W[\ Boyse\ E[A[\ 0876[ Alternative use of 4? exons in the speci_cation of Ly!4 isoforms distinguishing hematopoietic cell lineages[ Proc[ Natl[ Acad[ Sci[ U[S[A[ 73\ 4253Ð 4257[ Saga\ Y[\ Furukawa\ K[\ Rogers\ P[\ Tung\ J[\!S[\ Parker\ D[\ Boyse\ E[A[\ 0889[ Further data on the selective expression of Ly!4 isoforms[ Immunogenetics 20\ 185Ð295[ Saiki\ R[K[\ Scharf\ S[\ Faloona\ F[\ Mullis\ K[B[\ Horn\ G[T[\ Erlich\ H[A[\ Arnheim\ N[\ 0874[ Enzymatic ampli_cation of b!globin gen! omic sequences and restriction site analysis for diagnosis of sickle cell anemia[ Science 129\ 0249Ð0243[ Shen\ F[!W[ Saga\ Y[\ Litman\ G[\ Freeman\ G[\ Tung\ J[!S[\ Cantor\

H[\ Boyse\ E[A[\ 0874[ Cloning of Ly!4 EDNA[ Proc[ Natl[ Acad[ Sci[ U[S[A[ 71\ 6259Ð6252[ Streuli\ M[\ Hall\ L[R[\ Saga\ Y[\ Schlossman\ S[F[\ Saito\ H[\ 0876[ Di}erential usage of three exons generates at least _ve di}erent mRNAs encoding human leukocyte common antigens[ J[ Exp[ Med[ 055\ 0437Ð0455[ Thomas\ M[L[\ Reynolds\ P[J[\ Chain\ A[\ Ben!Neriah\ Y[\ Trowbridge\ I[S[\ 0876[ B!cell variant of mouse T199 "Ly!4#^ Evidence for alter! native mRNA splicing[ Proc[ Natl[ Acad[ Sci[ U[S[A[ 73\ 4259Ð 4252[ Trowbridge\ I[S[\ Thomas\ M[L[\ 0883[ CD34] An emerging role as a protein tyrosine phosphatase required for lymphocyte activation and development[ Annu[ Rev[ Immunol[ 01\ 74Ð005[ Winter\ E[\ Yamamoto\ F[\ Almogueru\ C[\ Perucho\ M[\ 0874[ A method to detect and characterize point mutations in transcribed genes] Ampli_cation and overexpression of the mutant c!ki!ras allele in human tumor cells[ Proc[ Natl[ Acad[ Sci[ U[S[A[ 71\ 6464Ð6468[ Zebedee\ S[L[\ Tseng\ R[\ Kanagawa\ O[\ Raschke\ W[C[\ 0889[ Analysis of alternative splicing in leukocyte common antigen[ J[ Cell Biochem[ 03D\ 121[