Expression of Marek's Disease Virus Oncoprotein Meq During Infection in the Natural Host

Virology 503 (2017) 103–113

Contents lists available at ScienceDirect

Virology journal homepage: www.elsevier.com/locate/yviro

Expression of Marek's Disease Virus Oncoprotein Meq During Infection in the Natural Host

MARK

S.-H. Sheldon Taia, Cari Hearnb,c, Sudawapee Umthongb,d, Olga Agafiteia, Hans H. Chengb, John ⁎ R. Dunnb, Masahiro Niikuraa, a

Faculty of Health Sciences, Simon Fraser University, Burnaby, BC, Canada USDA-ARS Avian Disease and Oncology Laboratory, East Lansing, MI, USA c Comparative Medicine and Integrative Biology Program, College of Veterinary Medicine, Michigan State University, East Lansing, MI, USA d Department of Molecular Genetics, Michigan State University, East Lansing, MI, USA b

A R T I C L E I N F O

A BS T RAC T

Keywords: Marek's disease Gallid herpesvirus 2 Meq pathogenesis oncogenesis latent infection bacterial artificial chromosome flow cytometry

Gallid herpesvirus 2 (Marek's disease virus, MDV) causes lymphoproliferative Marek's disease (MD), and is unique among alphaherpesviruses as the viral genome encodes an oncoprotein, Meq. To elucidate the temporal relationship between Meq expression and the development of MD lymphomas in infected chickens, we generated a virulent recombinant MDV that expresses GFP simultaneously with Meq. By using this virus, we monitored the dynamics of Meq expression in vivo throughout the course of infection. In peripheral blood mononuclear cells, the percentage of Meq-expressing cells dramatically increased in the early latent phase but decreased thereafter. Furthermore, we discovered evidences that indicate some of the infected lymphocytes did not express Meq during the latent phase of MDV pathogenesis. These findings provide the first insight into the temporal relationship between Meq expression and MD progression, and new clues to refine the current MD pathogenesis model.

1. Introduction Gallid herpesvirus 2 (GaHV-2), commonly known as serotype 1 Marek's disease virus (MDV), is a highly contagious and highly oncogenic alphaherpesvirus that causes immunosuppression, nerve lesions, T cell lymphomas, and high mortality in susceptible chickens. MDV is among the most potent oncogenic viruses, and induces rapidonset T cell lymphomas in nearly 100% of susceptible, unvaccinated hosts (Nair, 2013). In the currently-held pathogenesis model, MDV infection is initiated by inhalation of virus from shed dander of previously infected birds. Phagocytic cells subsequently transport the virus from the respiratory tract to lymphoid organs, such as the bursa of Fabricius (bursa), thymus, and spleen. Between 3–6 days post infection (p.i.), extensive lytic replication occurs in B cells and spread to T cells, causing bursal and thymic atrophy. Around day 7 p.i. in response to the host immune response, the infection switches from the lytic to latent phase. MDV is believed to establish latent infection primarily in CD4+ T cells. Lethal lymphomas with CD4+ T cell phenotype ensue as early as 2–4 weeks p.i. (Calnek, 2001; Osterrieder et al., 2006). In this hypothesized model, it is largely unknown how the latently infected cells are transformed to lympho-

⁎

mas. For example, it is not known how frequently infected cells proceed to lymphomas, though recent studies revealed the mono- or oligoclonal nature of MD lymphomas (Mwangi et al., 2011; Robinson et al., 2010). It is also not known how many cells are latently infected in an infected chicken. What is known is that Meq, the only known oncoprotein encoded by an alphaherpesvirus, is necessary and plays an essential role for the transformation at the individual cell level. Meq is a 339-amino acid protein that has been identified as the principle oncoprotein of MDV (Levy et al., 2005; Lupiani et al., 2004). The basic leucine zipper (bZIP) regions of Meq are closely related to the Jun/Fos oncoproteins (Jones et al., 1992). The gene is encoded in the repeat regions (IRL and TRL), thus, two copies of meq gene are present in each MDV genome (Fig. 1A). Deletion of meq in virulent MDV completely abolishes its oncogenicity (Lee et al., 2008; Lupiani et al., 2004; Silva et al., 2010). Previous in vitro studies have established that Meq protein is consistently expressed in productively infected fibroblasts, as well as lymphoblastoid cell lines derived from MD tumors such as MSB1 (Jones et al., 1992; Kung et al., 2001). Additionally, it was previously demonstrated in MSB1 cells that Meq expression was not sensitive to cycloheximide or phosphonoacetic acid treatments, indicating that it follows herpesvirus immediate early expression

Corresponding author. E-mail address: [email protected] (M. Niikura).

http://dx.doi.org/10.1016/j.virol.2017.01.011 Received 23 August 2016; Received in revised form 10 January 2017; Accepted 18 January 2017 Available online 01 February 2017 0042-6822/ © 2017 Elsevier Inc. All rights reserved.

Virology 503 (2017) 103–113

S.-H.S. Tai et al.

Fig. 1. Construction of the Md5B40BAC-2xGFP-2A-Meq (G2M) recombinant MDV. (A) Structure of the MDV genome (in linear form), as well as the G2M construct and its parental BAC clone Md5B40BAC (B40). Both copies of the open reading frame encoding Meq were replaced with EGFP-2A-Meq in the G2M construct. (B) The sequence encoding GFP and 2A peptide was inserted at the original start codon of Meq in the MDV genome, while internal start and stop codons were deleted (strikethrough nucleotides). When “self-cleaved”, first 21 amino acids of the 2A peptide remain associated to the C-terminal of GFP and 1 amino acid is linked to the N-terminal of Meq.

kinetics (Parcells et al., 2001). However, fibroblasts are not the cell type MDV infects in vivo and MD tumor cell lines are highly selected following the many in vitro passages required for establishment. Thus, they may not accurately represent MDV infected lymphocytes in vivo. Furthermore, the expression pattern of Meq in latently infected but not yet transformed lymphocytes has never been explored. This deficiency is mainly because of the inability to clearly identify such latently infected but not transformed cells. To understand these important early MD pathogenesis events at the host level, it is crucial to quantitatively identify host cells latently infected by MDV. However, hurdles exist due to the nature of herpesvirus latency. Active transcription from the MDV genome is limited during its latency, of which only Meq protein is consistently translated (Jones et al., 1992). Meq is an intracellular protein and not accessible by specific antibodies without permeabilization of cellular membranes, thus, making quantitative identification of cells by a flow cytometer difficult. Expression of a fluorescent protein in infected cells by a genetically modified virus is a potential alternate to overcome this difficulty (Jarosinski et al., 2012; Schermuly et al., 2015). However, fusing Meq to a fluorescent protein is likely to hamper the functions of Meq that are critical for MD pathogenesis. In this report, we constructed the first virulent MDV in which Meq is tagged with a fluorescent protein as the first step for the quantitative identification of latently infected cells in vivo. To minimize any impact on Meq functions caused by a protein fusion, the fluorescent protein and Meq were separated by a “self-cleaving” 2A peptide derived from porcine teschovirus-1 (Fig. 1B). The 2A peptide consists of 22 amino acids, and when “self-cleaved,” its first 21 amino acids are covalently linked to the N-terminal peptide while the last amino acid is bonded to the C-terminal peptide (Kim et al., 2011). Highly efficient functionality of this peptide has been demonstrated in human, mouse, zebrafish, as well as chicken cells (Dong et al., 2015; Harmache, 2014; Kim et al., 2011; Verrier et al., 2011). Using this recombinant MDV, we investigated the in vivo expression of Meq throughout the course of infection in the natural host of MDV.

Sigma-Aldrich), heat-inactivated bovine serum (Life Technologies), and antibiotics (100 U/mL penicillin and 100 μg/mL streptomycin; Life Technologies). Concentration of the serum was 4% for growth medium and 1% for maintenance medium. Two chicken CD4 T cell lines, MDV-transformed MDCC-MSB1 and retrovirus-transformed, MDV-free RP-9 cells were obtained from USDA-ARS Avian Disease and Oncology Laboratory (ADOL) and cultured in RPMI-1640 medium (Sigma-Aldrich) supplemented with 10% heat-inactivated fetal bovine serum (FBS; Life Technologies) and antibiotics. Viruses were reconstituted from bacterial artificial chromosome (BAC) clones by transfecting CEFs with BAC DNAs using Basic Primary Fibroblasts Nucleofector Kit (Lonza) and Amaxa Nucleofector II program O-008. Low passage viruses (less than 10 passages) were used in subsequent experiments. 2.2. PCR PCRs were performed using the Expand High Fidelity PCR Kit (Roche Applied Science). Primers (Table 1) were synthesized by Integrated DNA Technologies (IDT). Reactions consisted of 1x PCR Buffer, 200 μM dNTPs, 600 nM of each forward and reverse primer, 0.0525 unit/µL Enzyme mix, and up to 5 ng/µL of template DNA. Following an initial denaturation at 95 °C for 4 min, the reactions were cycled up to 40 times at 95 °C for 1 min, 60 °C for 1 min, and 68 °C for 1.5 min, before a final extension at 68 °C for 10 min. 2.3. Modification of MDV BAC Md5B40BAC-2xGFP-2A-Meq (G2M) was generated using Md5B40BAC (B40), an infectious MDV BAC clone derived from very virulent MDV strain Md5 (Niikura et al., 2011), by scarless two-step Red-mediated recombination as previously described (Tischer et al., 2006). A plasmid based on pGEM-T Easy vector (Promega) was constructed as a template for the generation of inserting fragments (Fig. S1A). First, a PCR fragment generated with primers TSH201 and TSH202 (Table 1) and pEPkan-S as template, was cloned into pGEM-T Easy via TA cloning. This PCR fragment contained an upstream homologous recombination sequence, an I-SceI site, and a kanamycin resistance gene. The second PCR fragment, generated with primers TSH203 and TSH204 (Table 1), and pEGFP-N1 (Clontech) as template, was also cloned into a pGEM-T Easy vector, and its insert was subsequently transferred to the first pGEM-T Easy clone using restriction endonucleases BamHI and NcoI. The second PCR fragment contained an internal homologous recombination sequence, egfp, 2A, and downstream homologous recombination sequences (5’ end of

2. Materials And Methods 2.1. Cells and viruses Chicken embryo fibroblasts (CEFs) were prepared from 11-day-old specific-pathogen-free (SPF) embryos obtained from the Canadian Food Inspection Agency (CFIA) and used as secondary culture. CEFs were cultured in Eagle's minimal essential medium (EMEM; SigmaAldrich) supplemented with 10% tryptose phosphate broth (TPB; 104

Virology 503 (2017) 103–113

S.-H.S. Tai et al.

Table 1 PCR Primers and probes used in this study. Sequence (5’ – 3’)

Name

Use

TSH201 TSH202 TSH203 TSH204

BAC BAC BAC BAC

TSH295 TSH296 EGFP1-23F EGFP355-332R Meq_F Meq_R Meq_probe iNOS_F a iNOS_R a iNOS_probe a

meq differentiation meq differentiation Southern blot probe Southern blot probe qPCR qPCR qPCR qPCR qPCR qPCR

modification modification modification modification

cttgcaggtgtataccagggagaaggcgggcacggtacaggtgtaaagagAGGATGACGACGATAAGTAGGG ctctttacacctgtaccgtgcccgccttctccctggtatacacctgcaaggatc CAACCAATTAACCAATTCTGATTAG ttaattggttggatccttgcaggtgtataccagggagaaggcgggcacggtacaggtgtaaagag ATGGTGAGCAAGGGCGAGGAGCTG ggatcgtcagcgggactgtagggcatagcgcccggctctggctcctgaga aggtccagggttctcctccacgtctccagcctgcttcagcaggctgaagttagtagctccgcttcc CTTGTACAGCTCGTCCATGCCGAG TGACAGGTGAATTGTGACCGTTCG CTCAGATAGGCCGTCAGGGAAGG ATGGTGAGCAAGGGCGAGGAGCTG TGTCGCCCTCGAACTTCACCTCG TTGTCATGAGCCAGTTTGCCCTAT TGAGGGAGGTGGAGGAGTGCAAAT FAM−TTACGGTGA−ZEN−CCCTTGGACTGCTTACCA−IBFQ GAGTGGTTTAAGGAGTTGGATCTGA TTCCAGACCTCCCACCTCAA TAMRA−CTCTGCCTGCTGTTGCCAACATGC−IBRQ

Sequences in lower case indicate hanging nucleotides. FAM, ZEN, IBFQ, TAMRA and IBRQ in the sequences indicate 6-carboxyfluorescein, ZEN internal quencher, Iowa Black FQ quencher, 6-carboxytetramethylrhodamine, and Iowa Black RQ quencher, respectively. a Adopted from Jarosinski et al., 2002.

(n=6). On days 3, 7, and 14 p.i., 3 birds in the G2M group and 1 bird in the mock infection group were euthanized. Peripheral blood, thymus, spleen, and bursa were collected for lymphocyte isolation. At the same time points, blood samples were collected from the B40 group. The remaining birds were monitored until euthanized or the end of the experiment, and used to construct a survival curve. In Experiment #2, two-day-old SPF chicks obtained from CFIA were inoculated with 2,500 pfu of G2M (n=10), B40 (n=10), or mock infected (n=5). Peripheral blood samples were collected from the birds on days 3, 7, 14, 21, 28, or before euthanasia. Birds that died of nonspecific causes (e.g., accident in handling) were excluded from analyses. In Experiment #3, viruses were inoculated into ADOL line 15I5 × 71 white leghorn chickens, an F1 hybrid cross of MD susceptible 15I5 males and 71 females (Bacon et al., 2000). Both maternal antibody positive (Ab+) and maternal antibody negative (Ab−) chickens were used in this experiment. Ab+ chickens were reared from breeder hens vaccinated with all three serotypes. Ab− chickens were reared from a SPF breeding flock housed in isolators that have received no MD vaccinations or exposure. The flock was negative for MDV antibodies by routine surveillance tests. Both flocks were also negative for exogenous avian leukosis virus and reticuloendotheliosis virus by routine surveillance testing. Chickens of each type were inoculated with 500 pfu of G2M or B40 at day of hatch, for the comparison of MD incidence. Experiment #4 was carried out by inoculating three-day-old SPF chicks, obtained from CFIA, with 2,500 pfu of G2M virus (n=8). Blood samples were collected for fluorescence in situ hybridization (FISH).

meq). Plasmid constructs were verified by sequencing. Two successive two-step Red-mediated recombinations were carried out to obtain Md5B40BAC-2xGFP-2A-Meq (G2M), in which egfp gene was fused to 5’ of both copies of the meq gene with a 2A sequence in between (Fig. 1). 2.4. Growth kinetics Monolayers of CEFs were inoculated with 100 plaque forming units (pfu) of viruses in 6-well plates and incubated at 37 °C. At indicated time points, the infected monolayers were washed with phosphate buffered saline, pH 7.4 (PBS), trypsinized and temporarily preserved in 200 μL of freezing medium (50% heat-inactivated bovine serum, 40% EMEM, and 10% DMSO) at −80 °C, until titrated on fresh CEF monolayers in triplicate. 2.5. Western blots CEFs heavily infected either with G2M or B40 were analyzed by Western blotting. Proteins were separated in a 12% SDS-PAGE gel and transferred to an Immobilon membrane (Millipore). Proteins on the membrane were probed by a rabbit anti-GFP antibody (Abcam, #ab290) followed by horseradish peroxidase-conjugated anti-rabbit IgG (H+L) antibody (Jackson ImmunoResearch Laboratories) and visualized with Western Lighting Plus-ECL Enhanced Chemiluminescence Substrate (PerkinElmer) following the manufacturer's instructions. The membrane was stripped and re-probed for an MDV protein, pp38 with a specific mouse monoclonal antibody (H19; Cui et al., 1991, Lee et al., 1983) followed by horseradish peroxidaseconjugated goat anti-mouse IgG+IgM antibody (Jackson ImmunoResearch Laboratories) and visualized with the chemiluminescence substrate.

2.7. Processing of cell samples collected from infected animals 2.6. Animal experiments To isolate peripheral blood mononuclear cells (PBMC) from blood for flow cytometry and cell sorting, whole blood collected in EDTA or heparin coated tubes (Sarstedt) were loaded on top of Histopaque 1077 (Sigma-Aldrich) and centrifuged at 400 × g for 30 min. Tissues and tumor nodules were divided into two portions, one preserved in OCT compound (Sakura Finetech) at −80 °C and the other homogenized to single cell suspension in EMEM containing TPB and antibiotics before loaded on top of Histopaque to isolate lymphocytes. Gradient separated lymphocytes were subsequently washed twice in PBS and preserved in freezing medium (50% FBS, 40% EMEM, and 10% DMSO) in liquid N2 until further analysis.

All animal experiments were reviewed and approved by the respective governing Institutional Animal Care and Use Committee at either Simon Fraser University (protocol #1101HS-09) or ADOL (approval number r15.14). SPF chicks were housed in negativepressure Horsfall-Bauer isolators with controlled temperature, humidity, and lighting. After virus inoculation, the animals were monitored daily for clinical signs, and euthanized when they developed progressive disorder according to the approved animal care protocol. In Experiment #1, six-day-old SPF chicks obtained from CFIA were inoculated with 500 pfu of G2M (n=19), B40 (n=10), or mock infected 105

Virology 503 (2017) 103–113

S.-H.S. Tai et al.

DAPI (Life Technologies), slides were washed once in 4T buffer (4x SSC, 0.5% Tween-20), twice in TNT buffer (100 mM Tris-HCl, 150 mM NaCl, 0.05% Tween-20, pH 7.5), and once in PBS for 5 min each at room temperature.

2.8. Flow cytometry To stain CD4 markers on the cell surface, cells were thawed and washed in cell staining buffer (PBS containing 2.5% FBS) before incubation with Lc-6 mouse monoclonal anti-chicken CD4 antibody (Kon-Ogura et al., 1993) at room temperature for 30 min. After the incubation, cells were washed twice in cell staining buffer, and incubated with allophycocyanin (APC)-conjugated goat anti-mouse IgG+IgM antibody (Jackson ImmunoResearch Laboratories) at room temperature for 30 min. After the incubation with secondary antibody, cells were washed twice in cell staining buffer, and resuspended in cell staining buffer containing 0.5 μg/mL of 7-aminoactinomycin D (7AAD; BioLegend). Cells were analyzed or sorted immediately after staining. For intracellular staining, cells were thawed and washed in cell staining buffer. After incubation with Zombie NIR fixable viability dye (BioLegend), cells were fixed and permeablized using the BD Cytofix/Cytoperm kit (BD Biosciences) following the manufacturer's instructions. MDV pp38 was stained using mouse monoclonal antibody H19 and APC-conjugated goat anti-mouse IgG+IgM antibody. Flow cytometry acquisitions and cell sortings were carried out on a FACSJazz (BD Biosciences) equipped with 488 nm and 640 nm lasers and the following filters: 530/30 nm (GFP), 585/29 nm (autofluorescence), 692/40 nm (7-AAD), 670/30 nm (APC), and 750 nm long-pass (Zombie NIR).

3. Results 3.1. Modification of MDV BAC clone The nucleotide sequences encoding GFP and the 2A peptide were inserted immediately after the original start codon of Meq in Md5B40BAC-2xGFP-2A-Meq (G2M), which allowed the meq promoter to drive the transcription of GFP-2A-Meq and translation initiated at the same codon as wild-type Meq (Fig. 1). The G2M construct was verified by PCR analysis, DNA sequencing (data not shown), restriction enzyme digestion patterns, and Southern blotting (Fig. S1). 3.2. In vitro characteristics of the G2M virus The B40 and G2M viruses were reconstituted by transfecting the respective BAC DNAs into CEFs followed by amplification with additional cell passages. Upon infection, G2M produced plaques similar to B40 (Fig. 2A). Expression of GFP in G2M-infected cells was evident under a fluorescent microscope. Although the signal was not very intense, this may reflect the level of meq promoter activity. The expression of both GFP and Meq in G2M infected CEF was further confirmed by immunofluorescent staining with respective specific antibodies (Fig. S2). High efficiency of 2A peptide's “self-cleavage” has been demonstrated in chicken cells including CEF and MSB1 cells (Dong et al., 2015; Harmache, 2014; Verrier et al., 2011). A Western blot analysis of G2M virus infected CEF cells using anti-GFP antibody detected no GFP-Meq fusion protein but only the “cleaved” form of GFP protein, which migrated to the position of approximately 27 kDa in the SDS-PAGE (Fig. 2B). This suggests that the 2A peptide functioned properly in the GFP-2A-Meq context. Multi-step growth curves of the G2M and parental B40 viruses demonstrated similar growth kinetics (Fig. 2C). Fold increase of titers from day 0 to day 7 were not statistically significant between the two viruses (Student's t test p=0.081). These results indicate that the addition of GFP-2A at the N-terminal of Meq allowed the expression of both GFP and Meq, and did not significantly interfere with in vitro growth.

2.9. Quantitative real-time PCR (qPCR) Sorted CD4+, CD4+GFP−, CD4+GFP+, or MSB1 cells were stored at −80 °C before DNA templates were isolated using DNeasy Blood & Tissue Kit (Qiagen). Primers and TaqMan probes (Table 1) were synthesized by IDT. Reactions consisted of 1x KAPA PROBE qPCR Master Mix (Kapa Biosystems), 400 nM of each forward and reverse primer, 200 nM of TaqMan probe, and 0.5 ng/μL of template DNA. In a StepOnePlus Real-Time PCR System (Applied Biosystems), an initial denaturation was carried out at 95 °C for 3 min, followed by 45 cycles of 95 °C for 3 sec and 60 °C for 30 sec. 2.10. Fluorescence in situ hybridization (FISH) Cells were prepared and FISH was carried out as previously described with minor modifications (McPherson et al., 2014; Robinson et al., 2010). Briefly, freshly isolated PBMC from whole blood were stained and sorted for CD4+GFP+ and CD4+GFP− populations. Sorted CD4+GFP+ and CD4+GFP− T cells and RP-9 and MSB1 line cells were incubated in RPMI-1640 medium containing 10% FBS and 0.1 μg/mL colcemid (Life Technologies) for 1 hour at 37 °C, followed by hypotonic solution (0.56% KCl) for 30 min at room temperature. After three rounds of fixation in fresh 3:1 methanol and glacial acetic acid fixative, cells were dropped on glass slides and stored at −20 °C. The MDV-specific digoxigenin (DIG)-labeled probe was generated using DpnI-linearized Md5B40BAC DNA as template, and DIG High Prime DNA Labeling and Detection Starter Kit II (Roche Applied Science) following the manufacturer's protocol. After thawing, slides were treated with PBS containing 1 mg/mL RNase A (SigmaAldrich) before dehydrated in ethanol series. The slides were then denatured in 70% formamide at 66 °C for 1 min, and washed in ethanol series at 4 °C. Hybridization buffer containing the DIG-labeled MDV probe and unlabeled telomere probe (McPherson et al., 2014; Robinson et al., 2010) were applied to the slides and incubated at 37 °C overnight. Post-hybridization wash was carried out twice in 0.2x SSC containing 0.5% Tween-20 at 57 °C for 15 min, followed by twice in 0.2x SSC at room temperature for 5 min. After blocking with TNB buffer (100 mM Tris-HCl, 150 mM NaCl, 0.5% blocking reagent, pH 7.5) for 30 min at room temperature, hybridized probes were detected with rhodamine-conjugated sheep anti-DIG antibody (Roche Applied Science) at 37 °C for 1 h. Before mounting with ProLong Gold with

3.3. Pathogenicity of the G2M virus To test whether the G2M recombinant virus retained virulence, we performed three animal experiments. For the first experiment, 23 sixday-old SPF chicks were inoculated with 500 pfu of either G2M (n=10) or B40 (n=10), or mock infected (n=3), and monitored for disease symptoms (Fig. 3A). At 5 weeks p.i., 50% (5 out of 10) of G2M-infected birds and 60% (6 out of 10) of B40-infected birds reached the experimental endpoint. When the experiment was terminated at 8 weeks p.i., only 10% (1 out of 10) of B40-infected birds survived, while 50% survived among the G2M virus-infected birds. Necropsy revealed that all the birds that reached the experimental endpoint had developed gross tumors indicative of MD (Fig. S3). In the second animal experiment, two-day-old SPF chicks were inoculated with 2,500 pfu of G2M (n=7) or B40 (n=8), or mock infected (n=4) and monitored daily for disease progress (Fig. 3B). At 5 weeks p.i., similar to the first experiment, 50% (4 out of 8) of B40-infected birds reached the endpoint. In this experiment, all (7 out of 7) G2M-infected birds developed MD and reached the endpoint prior to 5 weeks p.i. Although the second experiment showed more MD incidence in G2M-infected birds, the difference between the G2M and B40 group was not statistically significant in either experiment (Fisher's exact test p > 0.05). To further test the virulence of G2M and rule out the effect of genetic variation in chickens on virulence, genetically defined 15I5 × 71 106

Virology 503 (2017) 103–113

S.-H.S. Tai et al.

Fig. 3. Survival curves of parental B40 virus, G2M virus, or mock infected chickens. (A and B) Non-genetically defined SPF chicks were infected with 500 pfu (A) or 2,500 pfu (B) of B40, G2M, or mock infected. (C and D) Genetically defined MDV-sensitive, maternal antibody negative (C) and positive (D) SPF chicks were infected with 500 pfu of B40 or G2M viruses.

Fig. 2. In vitro characterization of the G2M recombinant virus. (A) Plaques on CEF monolayers generated by parental B40 and recombinant G2M viruses. Both viruses produced plaques, and expression of GFP was observed in G2M-infected cells. Pictures were taken under a 10× objective lens. (B) Western blotting of uninfected CEF cells (lane 1) and CEF cell infected with B40 (lane 2) or G2M virus (lane 3) using anti-GFP antibody is shown in the right panel. The same membrane was stripped and re-probed by antipp38 antibody in the left panel as a loading control. (C) Growth kinetics of parental B40 and recombinant G2M viruses. Error bars represent ± 1 standard deviation.

Ab− birds were inoculated with 500 pfu of either G2M (n=13) or B40 (n=15). The survival curves of these birds (Fig. 3C) were similar to those obtained from the genetically undefined birds (Fig. 3A and B), and 100% of birds in both groups developed MD tumor by pathological examination. Again, the difference between the G2M and B40 group was not statistically significant (Fisher's exact test p > 0.05). In addi107

Virology 503 (2017) 103–113

S.-H.S. Tai et al.

reaching over 70% (Fig. 6F). After peaking on 14 days p.i. the percentage of CD4+ cells that were GFP+ declined by the third and fourth weeks p.i. In some G2M-infected animals, CD4+GFP− cell percentages also declined as the disease progressed near the end point (Fig. 6E). When more than two representative samples obtained on day 14, 3 weeks, and 4 weeks p.i. were examined by specific monoclonal antibody staining, PBMC analyzed in Fig. 6 did not contain significant numbers of pp38 expressing cells (Fig. S5 and data not shown), indicating that the majority of these cells were latently infected.

tion, we tested the effect of maternal antibody on the virulence of G2M virus in the same genetically defined birds. Ab+ 15I5 × 71 birds derived from MD vaccinated hens were challenged with 500 pfu of either G2M (n=17) or B40 (n=17) (Fig. 3D). Only one bird in the B40 group reached the endpoint before the experiment was terminated on day 60 p.i. When these birds were pathologically examined, 35% (6 out of 17) of birds inoculated with G2M developed MD tumors, compared to 76% (13 out of 17) of birds in the B40 group, suggesting a difference in virulence in these maternal antibody positive birds (Fisher's exact test p=0.037). In all experiments, none of the mock-infected birds showed any sign of MDV infection. Taken together, these results suggest that the G2M recombinant virus is highly oncogenic in unvaccinated birds, though it showed a slightly attenuated virulence in maternal antibody positive birds.

3.5. Presence of MDV genome in T cell subsets MDV viral genome load in CD4+, or CD4+GFP− and CD4+GFP+ T cell subsets sorted from blood samples and a gonad tumor nodule obtained at 2 or 4 weeks p.i. were determined by a real-time qPCR assay. To minimize cross contamination between cell populations, cell sortings were carried out using stricter gating criteria (Fig. S6A). Sorted CD4+GFP− and CD4+GFP+ cells were re-analyzed by flow cytometry after an overnight incubation in medium, and minimal cross-contamination was confirmed in the CD4+GFP− population (Fig. S6B). The qPCR results showed that in the CD4+GFP+ cells isolated from PBMC, there were 2,167 copies on average of MDV genome per 1,000 cells on day 14 p.i. (Fig. 7A and Table 2). On 27 days p.i., viral genome copy number in this population was slightly lower, averaging 1,486 copies per 1,000 cells. Similar copy number of MDV genomes was detected in CD4+GFP+ cells isolated from a tumor nodule. Unexpectedly, viral genomes were also detected in the CD4+GFP− population. In CD4+GFP− PBMC, there were 218 copies on average per 1,000 cells on day 14 p.i., and 49 copies per 1,000 cells on day 27 p.i. In addition, in CD4+GFP− cells sorted from a tumor nodule, a high copy number of MDV genomes were detected, similar to that found in CD4+GFP+ cells. As a control for the assay, MDV genome copies in MSB1 cells were quantified and the number was 8,933 copies per 1,000 cells (Fig. 7B and Table 2), which is in the same order as previously reported copy numbers for MSB1 of 3.7 copies/cell (Baigent et al., 2005). No MDV genome was detected in sorted CD4+ cells from mock-infected birds (Fig. 7B and Table 2), suggesting that MDV genomes detected in CD4+GFP− cells were genuine. To further validate the presence of MDV genomes in CD4+GFP− cells, FISH was carried out on CD4+GFP− and CD4+GFP+ cells isolated from G2M infected birds 18 days p.i. (Fig. 8 and Table 3). MDV genomes were detected in approximately 90% of MDV-transformed MSB1 cells but not in MDV-free RP-9 cells, demonstrating reasonable sensitivity and specificity of the assay. In one G2M-infected bird, MDV genomes were detected in 5.3% of CD4+GFP− cells (Table 3). Although the sensitivity of this assay in sorted CD4+ cells was lower than in MSB1 cells, these results confirmed the presence of MDV genome in some CD4+GFP− cells, as shown by the qPCR.

3.4. Dynamics of Meq expression in the lymphocytes of infected natural host To investigate expression of Meq in blood lymphocytes and lymphoid organs during MDV infection, thymus, spleen, bursa, and blood were collected from G2M-infected birds and analyzed for GFP and CD4 expression by flow cytometry. Clearly distinguishable CD4+GFP− and CD4+GFP+ populations in G2M-infected birds were evident on and after day 7 p.i. (Figs. 4 and 5); three G2M-infected birds were surveyed at each time point. Although percentages of each population varied from one individual to another, an overall trend was noted. First, no GFP+ cells were present on day 3 p.i., suggesting that no or very few viable lymphocytes were expressing Meq early after viral infection. Second, GFP+ cells appeared on day 7 p.i. in all tissues and blood, and GFP+ cells were present in both CD4+ and CD4− populations (Fig. 5A-D). Third, on day 7 p.i., the majority of GFP+ cells were CD4−, but this trend inverted by day 14 p.i. (Fig. 5E). And finally, from day 7 to day 14 p.i., CD4+GFP+ cells in the CD4+ population increased in PBMC and thymus, but decreased in spleen (Fig. 5F). There was no apparent trend in bursa, probably due to low number of T cells present. These dynamics were similar in the genetically defined animals (data not shown). To track Meq expressing cells in blood over the course of MDV infection in the same animal, two-day-old SPF chicks were inoculated with 2,500 pfu of G2M or B40, or mock infected, and PBMC were sampled on days 3, 7, 14, 21, 28 p.i., or before euthanasia (Fig. 6A-E). Flow cytometry analysis showed again that no GFP+ cells were detected on day 3 p.i., but appeared on 7 days p.i. The GFP-expressing CD4+ cell population expanded between 7 and 14 days p.i., while the CD4+GFP− cell population did not. Analysis of cellular DNA content showed that more CD4+GFP+ cells were dividing, compared to CD4+GFP− cells (Fig. S4). On day 14 p.i., more than 50% of CD4+ T cells were expressing GFP, and the ratio was even higher in some animals,

Fig. 4. Representative flow cytograms of PBMC from G2M, B40, or mock-infected birds showing quadrant gates. Distinct populations of GFP expressing cells were noted on and after day 7 p.i. in G2M infected birds.

108

Virology 503 (2017) 103–113

S.-H.S. Tai et al.

Fig. 5. Percentage of lymphocyte subsets in PBMC (A), thymus (B), spleen (C), and bursa (D) at different stages of MDV infection. (E) Percentage of CD4+GFP+ cells in all GFP+ cells. (F) Percentage of CD4+GFP+ cells in all CD4+ cells. Six-day-old SPF chicks were infected with 500 pfu of B40, G2M, or mock infected (indicated by +, E, and −, respectively in the parentheses after bird id numbers). Lymphocytes were isolated on days 3, 7, and 14 p.i. and analyzed by flow cytometry. Numbers on the X-axis indicate bird id numbers.

CD4+GFP− cells from two birds at 27 days p.i. (Table 1, Fig. S7). Because wild-type meq is shorter than egfp-2A-meq, this PCR would preferentially amplify wild-type meq. Amplicons corresponding to the size of egfp-2A-meq were amplified in CD4+GFP− as well as CD4+GFP

To rule out the minute possibility that the lack of GFP expression in certain CD4+ T cells was resulted from egfp gene mutation in the viral genome, a PCR assay that can distinguish egfp-2A-meq and wild-type meq was carried out using DNA extracted from CD4+GFP+ and

109

Virology 503 (2017) 103–113

S.-H.S. Tai et al.

Fig. 6. Percentage of PBMC subsets during the course of MDV infection (A-E). Two-day-old SPF chicks were infected with 2,500 pfu of B40, G2M, or mock infected. PBMC isolated from blood sampled on days 3, 7, 14, third week, and fourth week p.i. were analyzed by flow cytometry (A-E). Numbers on the X-axis indicate bird id numbers. Blue, red and green portions of the bars represent CD4+GFP−, CD4-GFP+ and CD4+GFP+ cell populations, respectively. A diamond mark (♦) indicates sample not collected, and a cross (†) denotes bird euthanized prior to indicated time point. Percentage of CD4+GFP+ cells in all CD4+ cells were plotted in panel F. Blue, red, and green dots represent mock, G2M, and B40-infected birds, respectively.

Fig. 7. Mean viral load in sorted CD4+ T cell subsets of infected animals and MSB1 cells determined by triplicate qPCR. Assay detection limit is 1.15 copies of MDV genome per 1,000 cells. dpi, days post inoculation. Bird id numbers, origin of cells and days post inoculation (dpi) are indicated.

110

Virology 503 (2017) 103–113

S.-H.S. Tai et al.

Table 2 Viral load (mean copies of MDV genome per 1,000 cells of triplicate ± 1 standard deviation) in T cell subsets of infected animals, determined by quantitative real-time PCR. Sample

a

936(-) blood 28dpi 940(-) blood 28dpi 942 blood 14dpi 943 blood 14dpi 946 blood 14dpi 947 blood 14dpi 948 blood 14dpi 949 blood 14dpi 955 blood 14dpi 942 blood 27dpi 955 blood 27dpi 943 gonad tumor MSB-1

CD4+

CD4+GFP−

CD4+GFP+

0 0 n/a n/a n/a n/a n/a n/a n/a n/a n/a n/a 8,933 ± 302

n/ab n/a 156 ± 2 142 ± 10 132 ± 12 99 ± 5 487 ± 2 388 ± 59 110 ± 2 37 ± 2 61 ± 4 3,494 ± 148 n/a

n/a n/a 2,673 ± 115 2,305 ± 36 2,313 ± 25 1,765 ± 48 1,949 ± 117 2,776 ± 209 1,387 ± 23 1,926 ± 97 1,045 ± 9 2,794 ± 41 n/a

Table 3 Number of cells that were positive for MDV genome by fluorescence in situ hybridization (FISH). Sample

Number of positive cells / total cells

Percentage of positive cells

MSB1 974 PBMC 18dpi CD4+GFP+ 974 PBMC 18dpi CD4+GFP− RP-9

47 / 52 21 / 97

90.4% 21.6%

7 / 133

5.3%

0 / 65

0%

4. Discussion Rapid onset of malignant lymphomas is a hallmark of MDV pathogenesis. It is well accepted that latent infection in CD4+ T cells is a prerequisite for their transformation, and Meq plays a critical role during this process. However, many aspects of MDV oncogenesis remain unclear, including the in vivo expression pattern of Meq, and why MD tumors in any given individual are mono- or oligoclonal (Mwangi et al., 2011; Robinson et al., 2010). The early onset and very high tumor incidence in MD indicates that transformation easily occurs in infected susceptible birds. However, this observation is contradictory to the mono- or oligoclonal nature of tumors found in birds, which suggests that multiple transformation events do not readily occur, at least to the gross tumor stage.

Assay detection limit is 1.15 copies of MDV genome per 1,000 cells. a Bird ID number, sample origin and days post infection (dpi). (-) indicates mockinfected bird. b n/a, not applicable.

+ cells from both birds (Fig. S7). The intact egfp genes were further confirmed by sequencing these amplicons. This result provided further evidence that Meq was not expressed in some MDV-infected CD4+ T cells.

Fig. 8. Detection of MDV genome in CD4+ cells by fluorescence in situ hybridization (FISH). MDV genomes were detected in positive control MSB1 cells (A), but not in negative control RP-9 cells (B). In CD4+ T cell subsets isolated from the blood of infected animals, MDV genomes were detected in CD4+GFP+ cells (C), and some CD4+GFP− cells (D). Pictures were taken under a 100× objective lens.

111

Virology 503 (2017) 103–113

S.-H.S. Tai et al.

a role of T cell activation in MDV pathogenesis. If the CD4+GFP+ cells that were actively dividing between day 7 and 14 p.i. consisted of mainly transformed cells, it is possible that the host immune system was able to eliminate the majority of infected and Meq expressing CD4+ T cells, though a few infected and transformed cells survived and ended up in MD tumors. We present the first evidence of a population of MDV-infected CD4+ T cells that do not produce Meq protein at a detectable level during the latent phase of MDV infection (Figs. 7–8 and Tables 2–3). Assuming that both Meq-expressing (GFP+) and non-expressing (GFP−) MDV-infected CD4+ T cells in the latent phase contain similar copies of MDV genome per cell, approximately 10% of CD4+GFP− cells on day 14 p.i. were infected by MDV, and 2.5% on day 27 p.i. (Table 2). During the preparation of FISH slides, sorted fresh CD4+GFP+ and CD4+GFP− cells were both treated with colcemid to arrest the cell cycle in metaphase. However, unlike CD4+GFP+ cells, we were unable to find any CD4+GFP− cell in metaphase (Fig. 8). Staining of cellular DNA also showed that CD4+GFP− cells divided much less actively than CD4+GFP+ cells (Fig. S4). This suggests that CD4+GFP− cells were quiescent and not transformed. It would be of profound interest to investigate these cells for factors that can suppress or induce Meq expression, which could lead to novel means of controlling the disease. It could be hypothesized that these CD4+GFP− cells with MDV genomes were recently infected but had not yet expressed sufficient GFP for detection. However, we believe this possibility is low because of the following reasons. (i) GFP+ and GFP− cell populations were clearly distinctive in flow cytograms (Fig. 4). This does not support the hypothesis, which implies a gradual increase of fluorescence by the accumulation of GFP around this time point. (ii) After day 14 p.i., when this CD4+GFP− cell population with MDV genome was identified, there was no increase of CD4+GFP+ cells towards 3rd week p.i. (Fig. 6). In addition, there was no significant lytic infection between day 14 and 3rd week p.i. (Fig. S5). These results are contradictory to what the hypothesis predicts. We also performed qRT-PCR and found that compared to CD4+GFP+ cells, there were 33 to 113 fold less meq RNA (birds 955 and 942, respectively on day 27 p.i.) in the same number of CD4+GFP− cells. The interpretation of this result is difficult, however, because the CD4+GFP− cells were a mixture of infected and uninfected cells while the CD4+GFP+ cells were all infected cells. Therefore, direct comparisons of these estimates by RT-PCR do not provide information about the relative RNA levels in each CD4+GFP− cell. Also, there are perhaps read-through RNA products in very tightly packed herpesvirus genome. Thus, we do not think RT-PCR is a reliable method to compare Meq expression in these CD4+GFP+ and CD4+GFP– cell populations. The mono- or oligoclonality of MD tumors should be a result of bottleneck at one or more of the following stages of pathogenesis. (i) The number of CD4+ T cells in which MDV successfully establishes latency after initial lytic infection, (ii) the number of latently infected CD4+ T cells that express Meq, (iii) the number of Meq-expressing CD4+ T cells that become transformed, and (iv) the number of transformed cells that successfully develop into tumor nodules. The finding of infected CD4+ T cells that do not express Meq during the latent phase implies a restriction at stage (ii). The decline of Meqexpressing cell population after 2 weeks p.i. implies restrictions at stages (iii) and/or (iv), as well. Further studies using the G2M virus may elucidate the mechanisms involved. In summary, we generated the first recombinant MDV that coexpresses Meq and a fluorescent protein in latently infected cells with almost full virulence. Using this virus, we characterized the dynamics of Meq expression during the infection in chickens. We further identified two populations of infected CD4+ T cells during the latent phase of MDV pathogenesis: one expresses Meq and the other does not. Future studies using the G2M virus could shed light not only on the MD oncogenesis but also the mechanisms responsible for vaccine-induced tumor prevention.

In order to better understand the in vivo mechanisms of MDV transformation of latently infected lymphocytes, we generated a new virulent recombinant MDV that allows us to track Meq expressing cells by fluorescence. We inserted the sequences encoding GFP and 2A at the 5’-end of meq to ensure that there is minimal change to the amino acid sequence of Meq (Fig. 1). The design of this construct also ensures that transcription of egfp-2A-meq is driven by the authentic meq promoter(s), and translation is initiated at the same start codon as in the wildtype meq. Although meq has various patterns of splicing, its major splicing donor site is located in the sequence encoding for the bZIP region, well downstream of the 5’ egfp, and there is no known splicing acceptor site inside the meq ORF (Coupeau et al., 2012; Okada et al., 2007). Therefore, it is unlikely that any part of the meq gene is translated without translation of the 5’ egfp gene. The G2M recombinant virus replicated in vitro indistinguishably from the parent Md5 strain, and its virulence was also comparable to that of the BAC-cloned Md5 parental strain in unvaccinated birds (Figs. 2 and 3). Nonetheless, MD tumor incidence caused by G2M dropped more in Ab+ birds than by parental Md5, suggesting a possibility that the recombinant virus was slightly attenuated. This difference might be a result of a point mutation(s) or minor modification in viral genome, though we did not detect any major deletion or insertion in the genome (Fig. S1). Using the virulent G2M virus, we were able to obtain the first insights into the temporal relationship between Meq expression and MDV-induced transformation by monitoring the fluorescence tag in vivo throughout the course of infection. Previously, it was thought that oncoprotein Meq is expressed during lytic and latent phases, as well as in transformed cells based on in vitro studies (Gennart et al., 2015; Kung et al., 2001). When lymphoid tissues collected on day 2 and day 5 p.i. from G2M and B40-infected birds were examined by immunofluorescence staining, we found that indeed there were a few clusters of Meq-expressing cells in lymphoid organs (data not shown). On the other hand, we did not detect any viable GFP+ cells in PBMC and lymphocytes collected from lymphoid organs during the lytic phase of infection on day 3 p.i. by flow cytometry (Fig. 4, Fig. 5A-D, and Fig. 6A). This might suggest that Meq is expressed minimally during lytic infection in vivo in PBMC. It is also possible that lytically infected Meq-expressing cells, because they were dying very quickly, were lost during sample preparation or gated out on flow cytometer. MDV infection transitions from the lytic to latent phase around day 7 p.i. (Calnek, 2001). In G2M recombinant virus infected chickens, CD4+GFP+ cells can be readily detected by flow cytometry on day 7 p.i. and thereafter (Figs. 4, 5, and 6), suggesting that Meq expression in latently infected viable cells began around this time. The percentage of CD4+GFP+ cells expanded rapidly from day 7 to day 14 p.i. (Fig. 6). Considering the minimal lytic infection detected during this period (Fig. S5), it is unlikely that the expansion of CD4+GFP+ cells was caused by de novo infection of previously uninfected cells. Instead, these Meq-expressing CD4+ cells were most likely actively dividing, which is supported by the DNA content analysis (Fig. S4). Further studies are needed to determine whether this active division was a consequence of T cell activation or MDV-induced transformation. Since oligoclonal MD tumors can develop as early as 2 weeks p.i., it is highly likely that at least some of these cells had already been transformed. It has been reported that in MDV-infected animals, the proportion of CD4+ T cells in PBMC rapidly decreases between 2–3 weeks p.i. after an earlier expansion (Morimura et al., 1995). Our results indicated that Meq-expressing CD4+GFP+ T cells, not CD4+GFP− cells, were mainly responsible for the increase and decrease of the CD4+ population (Fig. 6). Mechanisms responsible for the decline of CD4+GFP+ population are not yet understood. If a majority of the CD4+GFP+ cells that were actively dividing between day 7 and 14 p.i. consisted of activated T cells and a few transformed cells, it is possible that activated but not transformed CD4+ T cells eventually perished, due to either the infection itself, or senescence. All MDV transformed cell lines are known to be activated T cells (Schat et al., 1991), implying 112

Virology 503 (2017) 103–113

S.-H.S. Tai et al.

Kung, H.J., Xia, L., Brunovskis, P., Li, D., Liu, J.L., Lee, L.F., 2001. Meq: an MDVspecific bZIP transactivator with transforming properties. Curr. Top. Microbiol. Immunol. 255, 245–260. Lee, L.F., Liu, X., Witter, R.L., 1983. Monoclonal antibodies with specificity for three different serotypes of Marek's disease viruses in chickens. J. Immunol. 130, 1003–1006. Lee, L.F., Lupiani, B., Silva, R.F., Kung, H.J., Reddy, S.M., 2008. Recombinant Marek's disease virus (MDV) lacking the Meq oncogene confers protection against challenge with a very virulent plus strain of MDV. Vaccine 26, 1887–1892. Levy, A.M., Gilad, O., Xia, L., Izumiya, Y., Choi, J., Tsalenko, A., Yakhini, Z., Witter, R., Lee, L., Cardona, C.J., Kung, H.J., 2005. Marek's disease virus Meq transforms chicken cells via the v-Jun transcriptional cascade: a converging transforming pathway for avian oncoviruses. Proc. Natl. Acad. Sci. USA 102, 14831–14836. Lupiani, B., Lee, L.F., Cui, X., Gimeno, I., Anderson, A., Morgan, R.W., Silva, R.F., Witter, R.L., Kung, H.J., Reddy, S.M., 2004. Marek's disease virus-encoded Meq gene is involved in transformation of lymphocytes but is dispensable for replication. Proc. Natl. Acad. Sci. USA 101, 11815–11820. McPherson, M.C., Robinson, C.M., Gehlen, L.P., Delany, M.E., 2014. Comparative cytogenomics of poultry: mapping of single gene and repeat loci in the Japanese quail (Coturnix japonica). Chromosome Res. 22, 71–83. Morimura, T., Hattori, M., Ohashi, K., Sugimoto, C., Onuma, M., 1995. Immunomodulation of peripheral T cells in chickens infected with Marek's disease virus: involvement in immunosuppression. J. Gen. Virol. 76, 2979–2985. Mwangi, W.N., Smith, L.P., Baigent, S.J., Beal, R.K., Nair, V., Smith, A.L., 2011. Clonal structure of rapid-onset MDV-driven CD4+ lymphomas and responding CD8+ T cells. PLoS Pathog. 7, e1001337. Nair, V., 2013. Latency and tumorigenesis in Marek's disease. Avian Dis. 57, 360–365. Niikura, M., Kim, T., Silva, R.F., Dodgson, J., Cheng, H.H., 2011. Virulent Marek's disease virus generated from infectious bacterial artificial chromosome clones with complete DNA sequence and the implication of viral genetic homogeneity in pathogenesis. J. Gen. Virol. 92, 598–607. Okada, T., Takagi, M., Murata, S., Onuma, M., Ohashi, K., 2007. Identification and characterization of a novel spliced form of the meq transcript in lymphoblastoid cell lines derived from Marek's disease tumours. J. Gen. Virol. 88, 2111–2120. Osterrieder, N., Kamil, J.P., Schumacher, D., Tischer, B.K., Trapp, S., 2006. Marek's disease virus: from miasma to model. Nat. Rev. Microbiol. 4, 283–294. Parcells, M.S., Lin, S.F., Dienglewicz, R.L., Majerciak, V., Robinson, D.R., Chen, H.C., Wu, Z., Dubyak, G.R., Brunovskis, P., Hunt, H.D., Lee, L.F., Kung, H.J., 2001. Marek's disease virus (MDV) encodes an interleukin-8 homolog (vIL-8): characterization of the vIL-8 protein and a vIL-8 deletion mutant MDV. J. Virol. 75, 5159–5173. Robinson, C.M., Hunt, H.D., Cheng, H.H., Delany, M.E., 2010. Chromosomal integration of an avian oncogenic herpesvirus reveals telomeric preferences and evidence for lymphoma clonality. Herpesviridae 1, 5. Schat, K.A., Chen, C.L., Calnek, B.W., Char, D., 1991. Transformation of T-lymphocyte subsets by Marek's disease herpesvirus. J. Virol. 65, 1408–1413. Schermuly, J., Greco, A., Härtle, S., Osterrieder, N., Kaufer, B.B., Kaspers, B., 2015. In vitro model for lytic replication, latency, and transformation of an oncogenic alphaherpesvirus. Proc. Natl. Acad. Sci. USA 112, 7279–7284. Silva, R.F., Dunn, J.R., Cheng, H.H., Niikura, M., 2010. A MEQ-deleted Marek's disease virus cloned as a bacterial artificial chromosome is a highly efficacious vaccine. Avian Dis. 54, 862–869. Tischer, B.K., von Einem, J., Kaufer, B., Osterrieder, N., 2006. Two-step red-mediated recombination for versatile high-efficiency markerless DNA manipulation in Escherichia coli. Biotechniques 40, 191–197. Verrier, J.D., Madorsky, I., Coggin, W.E., Geesey, M., Hochman, M., Walling, E., Daroszewski, D., Eccles, K.S., Ludlow, R., Semple-Rowland, S.L., 2011. Bicistronic lentiviruses containing a viral 2A cleavage sequence reliably co-express two proteins and restore vision to an animal model of LCA1. PLoS One 6, e20553.

Acknowledgements The authors thank Tim Heslip, Lonnie Milam, Laurie Molitor, Nicole Bance, Mary Dearden and the technicians in Animal Care Services at SFU for technical assistance, and Drs. Mary Delany and Marla McPherson for helpful discussion. This work was supported by grants from Natural Science and Engineering Research Council of Canada, Canada Foundation of Innovation, and Simon Fraser University. Appendix A. Supporting information Supplementary data associated with this article can be found in the online version at doi:10.1016/j.virol.2017.01.011. References Bacon, L.D., Hunt, H.D., Cheng, H.H., 2000. A review of the development of chicken lines to resolve genes determining resistance to diseases. Poult. Sci. 79, 1082–1093. Baigent, S.J., Petherbridge, L.J., Howes, K., Smith, L.P., Currie, R.J., Nair, V.K., 2005. Absolute quantitation of Marek's disease virus genome copy number in chicken feather and lymphocyte samples using real-time PCR. J. Virol. Methods 123, 53–64. Calnek, B.W., 2001. Pathogenesis of Marek's disease virus infection. Curr. Top. Microbiol. Immunol. 255, 25–55. Coupeau, D., Dambrine, G., Rasschaert, D., 2012. Kinetic expression analysis of the cluster mdv1-mir-M9-M4, genes meq and vIL-8 differs between the lytic and latent phases of Marek's disease virus infection. J. Gen. Virol. 93, 1519–1529. Cui, Z.Z., Lee, L.F., Liu, J.L., Kung, H.J., 1991. Structural analysis and transcriptional mapping of the Marek's disease virus gene encoding pp38, an antigen associated with transformed cells. J. Virol. 65, 6509–6515. Dong, D., Gao, J., Sun, Y., Long, Y., Li, M., Zhang, D., Gong, J., Xu, L., Li, L., Qin, S., Ma, J., Jin, T., 2015. Adenovirus-mediated co-expression of the TRAIL and HN genes inhibits growth and induces apoptosis in Marek's disease tumor cell line MSB-1. Cancer Cell Int. 15, 20. Gennart, I., Coupeau, D., Pejaković, S., Laurent, S., Rasschaert, D., Muylkens, B., 2015. Marek's disease: Genetic regulation of gallid herpesvirus 2 infection and latency. Vet. J. 205, 339–348. Harmache, A., 2014. A virulent bioluminescent and fluorescent dual-reporter Marek's disease virus unveils an alternative spreading pathway in addition to cell-to-cell contact. J. Virol. 88, 11617–11623. Jarosinski, K.W., Arndt, S., Kaufer, B.B., Osterrieder, N., 2012. Fluorescently tagged pUL47 of Marek's disease virus reveals differential tissue expression of the tegument protein in vivo. J. Virol. 86, 2428–2436. Jarosinski, K.W., Yunis, R., O'Connell, P.H., Markowski-Grimsrud, C.J., Schat, K.A., 2002. Influence of genetic resistance of the chicken and virulence of Marek's disease virus (MDV) on nitric oxide responses after MDV infection. Avian Dis. 46, 636–649. Jones, D., Lee, L., Liu, J.L., Kung, H.J., Tillotson, J.K., 1992. Marek disease virus encodes a basic-leucine zipper gene resembling the fos/jun oncogenes that is highly expressed in lymphoblastoid tumors. Proc. Natl. Acad. Sci. USA 89, 4042–4046. Kim, J.H., Lee, S.R., Li, L.H., Park, H.J., Park, J.H., Lee, K.Y., Kim, M.K., Shin, B.A., Choi, S.Y., 2011. High cleavage efficiency of a 2A peptide derived from porcine teschovirus-1 in human cell lines, zebrafish and mice. PLoS One 6, e18556. Kon-Ogura, T., Kon, Y., Onuma, M., Kondo, T., Hashimoto, Y., Sugimura, M., 1993. Distribution of T cell subsets in chicken lymphoid tissues. J. Vet. Med. Sci. 55, 59–66.

113