Expression of Peste des petits ruminants virus nucleocapsid protein in prokaryotic system and its potential use as a diagnostic antigen or immunogen

Journal of Virological Methods 162 (2009) 56–63

Contents lists available at ScienceDirect

Journal of Virological Methods journal homepage: www.elsevier.com/locate/jviromet

Expression of Peste des petits ruminants virus nucleocapsid protein in prokaryotic system and its potential use as a diagnostic antigen or immunogen V. Yadav, V. Balamurugan, V. Bhanuprakash, A. Sen, V. Bhanot, G. Venkatesan, T. Riyesh, R.K. Singh ∗ Division of Virology, Indian Veterinary Research Institute, Mukteswar, Nainital District, Uttarakhand 263 138, India

a b s t r a c t Article history: Received 6 March 2009 Received in revised form 10 July 2009 Accepted 21 July 2009 Available online 29 July 2009 Keywords: PPR virus Nucleocapsid protein Prokaryotic system ELISA Diagnosis

In this study, both partial and full-length nucleocapsid (N) gene of Peste des petits ruminants virus (PPRV) were cloned into pET33b vector and expressed in Escherichia coli (BL21) with the objective of replacing live PPRV antigen with recombinant protein in ELISA. The expressed proteins were characterized by sodium dodecyl sulphate-polyacrylamide gel electrophoresis and Western blot by using a PPRV N protein specific monoclonal antibody. The expressed histidine-tagged fusion proteins were purified using affinity Ni-NTA column and were assessed for their conformation in terms of reactivity by ELISA. The immunogenicity of recombinant proteins was also assessed in rabbits and anti-N antibody response against PPRV was observed in all the immunized rabbits, when tested by competitive and indirect ELISAs. In sandwich ELISA, a mean OD492 nm of 1.4 and 0.90 was obtained for crude lysate having expressed the N protein and the PPRV antigen, respectively. Further, the N protein was tested as a coating antigen in competitive ELISA instead of PPRV antigen for serological diagnosis of PPR infection. This indicates the diagnostic potential of the PPRV recombinant N proteins, which are safe and better alternatives to live PPRV antigen in ELISA for clinical or sero-surveillance of PPR in enzootic or non-enzootic countries. © 2009 Elsevier B.V. All rights reserved.

1. Introduction Peste des petits ruminants (PPR) is an acute highly contagious viral disease of sheep and goats. The occurrence of the disease is associated with high morbidity and mortality in susceptible animals. It is one of the rapidly spreading-transboundary diseases and is notifiable to the Office International des Epizooties (OIE) (Diallo et al., 2007). Clinically, it resembles rinderpest (RP) in cattle and is characterized by pyrexia, necrotic stomatitis, catarrhal inflammation of the ocular and nasal mucosa, enteritis and bronchopneumonia (Gargadennec and Lalanne, 1942), which leads to either recovery or death of the affected animal. The disease was first described in the Ivory Coast, West Africa and later from sub-Saharan Africa, the Arabian Peninsula, the Middle East, southwest Asia, India and other countries (Gibbs et al., 1979; Shaila et al., 1996). In India, PPR was first reported from Arasur, Villupuram district (Tamilnadu State) during 1987 (Shaila et al., 1989). PPR is enzootic in India with significant economic losses and therefore, the infection is a major constraint for small animal production (Singh et al., 2004c). The causative agent, PPR virus (PPRV) is a member of the genus Morbillivirus of the family Paramyxoviridae. The genome is a single-

∗ Corresponding author. Present address: National Research Centre on Equines, Sirsa Road, Hisar 125001, Haryana, India. Tel.: +91 01662 275787; fax: +91 01662 276217. E-mail address: rks [email protected] (R.K. Singh). 0166-0934/$ – see front matter © 2009 Elsevier B.V. All rights reserved. doi:10.1016/j.jviromet.2009.07.014

stranded negative sense RNA and it is approximately 16 kb long. The genome possesses six transcriptional units encoding eight proteins in the order of 3 N-P/V/C-M-F-H-L 5 and each gene is separated by inter-genic regions. PPRV is classified into four lineages (I, II, III, and IV) based on partial F gene sequence analysis (Shaila et al., 1996; Dhar et al., 2002). Currently in India, sero-surveillance and/or sero-monitoring and clinical diagnosis of PPR are carried out by using indigenous monoclonal antibody (MAb) based competitive enzyme-linked immunosorbent assay (c-ELISA) (Singh et al., 2004a) and sandwich ELISA (s-ELISA) (Singh et al., 2004b) kits, respectively. In these assays, cell culture attenuated live PPRV is used as antigen. The bulk production of such antigen requires expertise and elaborate infrastructure. There is also possible batchto-batch variation in antigen production. The risk of handling live virus and accidental release into the environment limits the export and handling of these kits. Therefore, a recombinant antigen based diagnostic assay will be a better alternative not only for disease control and eradication but also in the post-eradication phase where there could be restriction in handling of the live virus. Recombinant antigen based diagnostic methods have been developed for the detection of several morbilliviruses such as rinderpest virus (RPV) (Kamata et al., 1993), PPRV (Ismail et al., 1995; Libeau et al., 1995; Choi et al., 2005b; Dechamma et al., 2006; Balamurugan et al., 2006), canine distemper virus (CDV) (Latha et al., 2007) and Nipah virus (Yu et al., 2006). A prokaryotic system such as E. coli, is used most commonly since the expression is easy and it is possible to express the protein in bulk without

V. Yadav et al. / Journal of Virological Methods 162 (2009) 56–63

post-translational modifications. The nucleocapsid (N) protein was selected since it is the most abundant and variable immunogenic protein among morbilliviruses (Diallo, 1990; Bodjo et al., 2007). The epitopes on the amino-terminal half of the N protein stimulates a humoral immune response more rapidly than that present on Cterminal region (Choi et al., 2005a). Hence, in the present study, partial and full-length coding open reading frame (ORF) of N gene sequences were cloned into pET33b vector, expressed in Escherichia coli and their diagnostic potential was evaluated in order to replace the live PPRV with recombinant PPRV N protein as a candidate diagnostic reagent in ELISA. 2. Materials and methods 2.1. Construction of expression cassette in pET33b The viral RNA was extracted from partially purified PPR vaccine virus (Sungri 96 isolate) by using RNeasy Mini kit (Qiagen GmbH, Hilden, Germany) as per the manufacturer’s recommendations. The extracted RNA served as a template for reverse-transcription by using random hexamer (MBI, Fermentas, MD, USA) and 200 U of MMuLV reverse transcriptase (Promega, Madison, USA). The N gene fragment was amplified from the generated cDNA, by PCR using Pfu DNA polymerase (MBI, Fermentas, MD, USA) and PPRV N gene specific primers {PPRNF (EcoRI): 5 ATCTGAATTCATGGCTACTCTCCTTAAAAGC 3 and PPRNR 262M (NotI) (His): 5 ATGGCGGCCGCATGGTGATGGTGATGGTGGAGTC CGGCTTCGACAATATA 3 -modified from earlier reported primer (Choi et al., 2005a) and PPRNR (NotI) (His): 5 CCTGGCGGCCGCATGGTGATGGTGATGGTGGCCGAGGAGATCCTTGTCG 3 }, which were designed based on published sequence (Accession # AY560591). The cycling conditions followed were: preheating at 95 ◦ C for 2 min, 35 cycles of 94 ◦ C for 1 min, 60 ◦ C for 1 min and 72 ◦ C for 4 min (full-length)/2 min (partial) with a final extension of 72 ◦ C for 10 min. The PCR products were analyzed by electrophoresis in 1% agarose gel stained with ethidium bromide. The amplicons were purified using AuPrepTM GELX kit (Life Technologies India Pvt. Ltd., New Delhi, India) and were cloned directionally into pET33b vector (Novagen, Madison, WI, USA, kindly provided by Prof. Dr. M.S. Shaila, Department of Microbiology and Cell Biology, Indian Institute of Science, Bangalore, India) at the EcoRI and NotI restriction sites. The recombinant clones were selected on LB agar plates containing kanamycin (50 ␮g/ml). Later, the recombinant plasmid containing the target gene sequences were verified by colony PCR, restriction enzyme analysis and sequencing. The partial and full-length ORF N gene sequences on the backbone of the vector were designated as pETN(262) and pETN, respectively. 2.2. Expression of truncated or complete N protein E. coli BL21 cells were transformed with pETN(262) and pETN recombinant plasmids and grown at 37 ◦ C overnight, on LB agar plates containing kanamycin (50 ␮g/ml). The transformed BL21 colonies were then screened for the presence of PPRV N gene specific sequences by PCR. The positive individual colonies were grown at 37 ◦ C till the culture reached mid-log phase (OD600 nm of 0.4–0.5). The expression was induced at 30 ◦ C by using 1 mM isopropyl-␤-d-thiogalactoside (IPTG). Samples were collected at 0, 4, 5, 6, 7, 8 and 9 h post-induction (hpi) and were analyzed by sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDSPAGE) and immunoblot as per standard procedures. 2.3. Purification of recombinant N proteins Fifty microlitres of induced bacterial culture was harvested at 7 hpi, centrifuged at 6000 × g for 10 min and the cell pellet was

57

suspended in non-denature binding buffer (Invitrogen Corporation, Carlsbad, CA). The cells were later lysed by using lysozyme (2 mg/ml) at 4 ◦ C for 45 min. After a cycle of freeze-thawing, the cells were sonicated for 2 min at an amplitude of 30% with a 9.9 s pulse frequency. The lysate was centrifuged at 10,000 × g for 15 min at 4 ◦ C and the supernatant was collected as a soluble fraction. The last two steps were repeated twice for improved harvesting. The supernatant was then poured on to a purification column and allowed to bind for 60 min with gentle agitation in a rocking platform. The recombinant His-tag proteins were purified according to the manufacturer’s instructions, and, finally, the proteins were eluted with 5 ml of elution buffer (300 and 500 mM imidazole) in 1 ml fractions. The final concentration of purified protein was estimated calorimetrically by using a Micro BCA Protein assay Kit (Pierce, Rockford, IL, USA), at 550 nm using an ELISA reader. 2.4. SDS-PAGE and Western blotting The harvested post-induced samples, mock vector transformed bacteria, host bacteria and eluted fractions were mixed separately with SDS sample buffer and resolved by polyacrylamide gel (5% stacking and 15% resolving). The separated proteins by SDSPAGE were transferred on to a nitrocellulose membrane (NCM) (Hybond-C, Amersham Pharmacia, NJ, USA) following the method described by Burnette (1981) and the membrane was blocked with 5% skimmed milk powder in phosphate buffered saline (PBS) overnight at 4 ◦ C. The expressed recombinant proteins on the blot were detected by incubation with PPRV anti-N MAb followed by an anti-mouse HRPO conjugate (Sigma–Aldrich, St. Louis, MO, USA) with diamino benzidine (DAB) as a chromogen. 2.5. Diagnostic potential of the expressed protein The expressed proteins were tested for their suitability as positive PPRV antigen in s-ELISA. The s-ELISA was carried out according to Singh et al. (2004b) with minor modifications. Fifty microlitres of (1 ␮g/well) purified protein as well as crude supernatant in quadruplicates were used in s-ELISA along with 50 ␮l of PPRV antigen (titre −106.5 TCID50 /ml) as a positive control to compare the reactivity. The expressed partial N protein was also tested for suitability as a coating antigen in c-ELISA instead of PPRV antigen for serological diagnosis of PPR. Initially the PPRV N MAb based c-ELISA was standardized using the partially purified PPRV antigen for serological diagnosis following the earlier described protocols (Singh et al., 2004a) with some modifications. 2.5.1. PPRV antigen Antigen was prepared according to the method used for preparation of the PPRV antigen (Singh et al., 2004a). Briefly, Vero cells infected with PPRV (Sungri-96) showing >80% CPE were harvested and freeze-thawed three times. The cell debris was clarified by centrifugation at 1000 × g for 15 min. The supernatant was precipitated using 8% (w/v) PEG 6000 in the presence of 2.3% (w/v) sodium chloride. The mixture was centrifuged at 8500 × g for 30 min following overnight incubation at 4 ◦ C. The pellet was dissolved in TE buffer (pH 7.4) in 1/10 of the original volume. The suspension was layered over 30–60% sucrose cushion and ultracentrifuged at 100,000 × g for 2 h. The partially purified virus antigen collected in the inter-phase was dissolved in TE buffer and used in ELISA. 2.5.2. Preparation of recombinant antigen After 7 hpi with IPTG, 50 ml culture was centrifuged at 6000 × g for 10 min and the cell pellet was dissolved in non-denature binding purification buffer provided in the ProbondTM purification system (Invitrogen Corporation, Carlsbad, CA). The cell lysate of partial N protein was prepared as described earlier and was stored at −20 ◦ C

58

V. Yadav et al. / Journal of Virological Methods 162 (2009) 56–63

until further use. The protein crude lysate at 50 ␮l/well was used as coating antigen in ELISA for standardization of the assay. 2.5.3. Serum samples Serum samples collected from goats infected experimentally with PPR challenge virus and vaccinated with live attenuated PPR vaccine (Singh et al., in press) were available in the laboratory and were used as known positive controls. Post-challenge serum from a PPR-vaccinated animal was used as a positive control. The serum samples (n = 70) obtained from apparently healthy goats free of PPR antibodies with no history of either vaccination or natural exposure to PPRV were considered as negative control. The serum samples (n = 101) collected randomly from sheep/goats from different places of the country and having the serum neutralization titre (SNT) in respect of PPRV antibodies (ranged from 1:8 to 1:256) were also included as known samples. Goat serum samples (n = 120) of unknown antibody status from different geographical locations of the country (obtained through various organizations available in the Division of Virology, IVRI, Mukteswar) were included in the investigation for serological surveillance. Serum samples collected periodically from three PPR-vaccinated goats were also included in this study for serological monitoring. 2.5.4. ELISA standardization ELISA was carried out according to Singh et al. (2004a) with some modifications. Briefly, expressed N protein or purified PPRV antigen (1:50) was coated in a flat bottomed 96 well plate (Nalgene Nunc Int., Hamburg, Germany). After incubation at 37 ◦ C for 1 h, the wells were washed three times with 0.002 mol/l PBS. In the next step, all the wells of the plates received 40 ␮l of blocking buffer (PBS with 0.2% PPR-negative serum and 0.1% Tween 20). The test serum samples (20 ␮l) were added to duplicate sets of well followed by addition of 40 ␮l of PPRV N protein MAb in each well (except conjugate control wells) at a final dilution of 1:200. The antigen–antibody reaction was followed by incubation with antimouse HRPO conjugate (1:1000 dilution) and detected by colour development with the chromogen, ortho-phenyl diamine (OPD) and H2 O2 as the substrate. The results were interpreted using the software developed by the Food and Agriculture Organization (FAO) and the International Atomic Energy Agency (IAEA) for rinderpest antibody detection (Jeggo and Anderson, 1992). Samples with percentage inhibition of ≥50% were considered positive for routine testing as described earlier (Libeau et al., 1995) for PPR serological diagnosis using the recombinant PPRV N proteins expressed in baculovirus system. A chequerboard titration was performed for optimization of working dilutions of antigen and antibodies as per standard protocols. The specific dilution of recombinant PPRV N protein or PPRV antigen and standard positive serum that induced approximately 75% absorbance (A492 ) of the plateau was arbitrarily selected. To arrive at it, the antigen, and the reference serum samples from animals of varied immunological status (pre-vaccinated and postvaccinated or challenged animals) was tested in different dilutions. The antigen and serum dilutions that gave maximum difference in absorbance at 492 nm between positive and negative (P/N) were selected.

controls. All the animals were bled on 14th, 21st and 28th day post-inoculation (dpi). The sera were then tested in c-ELISA for the presence of N protein specific antibodies by following the methods described by Singh et al. (2004a) with slight modifications. A PPRV N specific MAb (1:100) was used as the competitive antibody. Further, the presence of PPRV specific antibodies was also confirmed in polyclonal antibody (PAb) based indirect ELISA (Balamurugan et al., 2007).

3. Results 3.1. Cloning of N gene sequences in to pET33b vector The full-length and partial 5 end of PPRV N gene sequences were amplified by RT-PCR, which resulted in specific products of 1615 and 838 bp for full-length and partial N gene sequences, respectively (Fig. 1). The amplified PCR products were ligated into the pET33b vector at the EcoRI and NotI sites. The E. coli TOP 10F cells were transformed with the ligated mixture and the transformants were screened by kanamycin selection. The efficiency of transformation was 2 × 104 /␮g of ligated DNA products. The presence of the insert in the recombinant clone was confirmed by colony PCR and restriction enzyme analysis. Amplification of the gene specific products with virus specific primers, confirmed the presence of the insert in five out of seven (for full-length) and seven out of eight (for partial) colonies screened. The positive colonies were grown, plasmid DNA was purified and subjected to EcoRI and NotI digestion followed by agarose gel electrophoresis. The release of gene specific fragment could be seen in clones with insert. The sequence of the insert in the recombinant clone was confirmed by sequence analysis. In order to express the N protein, the cloned DNA was transformed into BL21 strain of E. coli by the heat-stock method. The pET33b vector was used as a control for transformation. The BL21 clones were screened for confirming the presence of the target insert by PCR using insert specific primers, which resulted in amplification of five out of eight (for partial) and five out of six (for full-length).

2.6. Immunogenicity of recombinant PPRV N proteins The presence of conformational epitopes on the expressed recombinant N proteins was assessed in terms of immune response in rabbits. Sixty micrograms of purified protein was dissolved in 500 ␮l of PBS and emulsified with an equal volume of Montanide ISA-206 (Seppic S.A., Paris La Défense, France). Two rabbits were inoculated with emulsified antigen (1 ml/rabbit), intramuscularly. The rabbits, which received only PBS, were also maintained as

Fig. 1. Agarose gel electrophoresis of amplified PPRV N gene sequences. Lane 1: the amplified full-length NP gene (PPRN); lane 2: non-template control; lane M: 100 bp plus DNA ladder (MBI, Fermentas, MD, USA); lane 3: the amplified partial length NP gene (PPRN262).

V. Yadav et al. / Journal of Virological Methods 162 (2009) 56–63

59

Fig. 2. Characterization of the recombinant PPRV N protein. [1] Truncated PPRV N protein. (A) SDS-PAGE analysis. (C) Western blot. Soluble lysate of sonicated pET33b + BL21 lysate 0 h (lane 1), pETN262 7 h lysate (lane 2), pETN262 0 h lysate (lane 3), pETN262 7 h lysate (lane 4), His-tag purified protein eluted in 100 mM imidazole (lane 5), 300 mM imidazole (lane 6), 500 mM imidazole (lane 7). [2] Complete PPRV N protein. (B) SDS-PAGE and (D) Western blot. Soluble lysate of 7 h BL21 lysate (lane 1), 0 h pET33b + BL21 lysate (lane 2), 7 h pET33b + BL21 lysate (lane 3), pETN 0 h lysate (lane 4), pETN 7 h lysate (lane 5), purified His-tag protein eluted in 300 mM imidazole (lane 6), 500 mM imidazole (lane 7). Prestained molecular weight protein marker: lane M (MBI-Fermentas, MD, USA).

3.2. Expression of N protein in E. coli BL21 strain PCR positive BL21 clones were induced to express the N protein with IPTG. The expressed proteins were analyzed by SDS-PAGE (Fig. 2). A single intense band of 32 and 60 kDa could be seen (Fig. 2A, lane 2 and B, lane 5) corresponding to the expressed truncated and complete N protein, whereas no such protein bands were seen (Fig. 2B, lanes 1, 2 and 3) in the controls. The molecular weights (MW) of the truncated and complete N protein were 32 and 60 kDa, respectively. The N proteins separated in SDS-PAGE were transferred on to a NCM and immuno-detected with N protein specific MAb (Fig. 2C and D). An intense colour was observed with the protein corresponding to 32 and 60 kDa in case of proteins expressed after 7 h induction. The expressed truncated and complete PPRV N proteins along with the fused His-tag were approximately 32 and 60 kDa, respectively by SDS-PAGE and immunoblot. The expressed proteins were purified under non-denature conditions and eluted using 300 and 500 mM imidazole. 300 mM imidazole was found to be optimum and was thus used subsequently. There were no contaminating proteins in the preparation and the concentration of purified recombinant truncated N protein was 50 ␮g/ml, whereas, complete N protein was 20 ␮g/ml. 3.3. Assessment of recombinant N proteins as a diagnostic antigen in ELISA 3.3.1. Sandwich ELISA The reactivity of crude lysate, purified protein (1 ␮g/well) and reference positive PPRV antigen (106.5 TCID50 ) was compared by sELISA. The expressed PPRV N protein either in a truncated or in a complete form reacted well with PPRV N specific MAb in s-ELISA.

The mean reactivity of the purified truncated protein in terms of optical density (OD) at 492 nm was 1.404, while, that of the crude lysate was 1.5 (Fig. 3) as against PPRV antigen of 0.950. Similarly, the reactivity of the purified complete N protein was 0.425 and that of its crude lysate was 0.615. 3.3.2. Competitive ELISA As a preliminary study, the expressed N protein was tested as coating antigen instead of the PPRV antigen by ELISA for serological diagnosis of PPR. For optimization of the PPRV antigen or PPRV N protein and MAb dilutions, a checkerboard titration was performed. Control sera included were strong PPR-positive (n = 4); weak PPRpositive (n = 4) and PPR-negative samples (n = 4). The 1:50 dilution of the PPRV antigen was selected, which induced approximately 75% absorbance (492 nm) of the plateau with 1:200 dilution of MAb and 1:5 dilution of serum, which could differentiate clearly positive or negative (P/N) sera and showed maximum (P/N) differences. Similarly, the recombinant N protein and MAb were found optimum at 1:50 and 1:100 dilutions, respectively. The reactivity of the recombinant N protein with MAb is shown in Fig. 4. After optimization of the assay, samples with known PPRV antibody were employed for deciding cut-off value. Seventy PPRnegative serum samples from goat and sheep were screened, which revealed a mean percentage inhibition (PI) of 31.16 with standard deviation (S.D.) of 9.32. Therefore, the cut-off value was set as 49.8% (mean + 2S.D.) for deciding the status of serum samples in PPRV antigen based c-ELISA. Similarly, for the recombinant antigen, the cut-off value was set as 39.08% (mean 30.96 with 4.06S.D). The assay included standard controls (conjugate, strong positive, weak positive and negative) to assess the quality, accuracy and repeatability (Jacobson, 1998). The mean PI values of conjugate, strong positive,

60

V. Yadav et al. / Journal of Virological Methods 162 (2009) 56–63

weak positive and negative serum samples were (98–100 vs 94–95; 82–98 vs 82.5–86.5; 67.25–78 vs 54.5–69.5 and 28–32 vs 26–32), with PPRV antigen and recombinant PPRV N protein, respectively. The mean reactivity of the PPRV N MAb with 1:50 dilution of PPRV antigen and recombinant protein was 0.774 and 0.466 at 492 nm, respectively. An optimized assay was assessed for its suitability for seromonitoring and sero-surveillance of PPR. Serum samples collected periodically from PPR-vaccinated goats were also tested. In this assay, a steady increase in the antibody titre (PI) was observed after the second week in all goats, which crossed the cut-off value (50%), i.e., 53–56%. These serum samples were also tested by SNT; an increase in antibody titre was observed after second week post-vaccination and remained steady throughout the observation period as reported earlier (Singh et al., 2004a; Balamurugan et al., 2007). This assay was also applied for the detection of PPRV antibodies from known samples (n = 101) collected randomly from sheep or goats suspected for PPR infection. All the samples were found positive and their PI values ranged from 54 to 93. Out of 120 unknown serum samples tested, 93 samples were found positive by PPRV antigen and 73 samples were found positive by recombinant protein based c-ELISA. 3.4. Immunological response to recombinant N proteins in rabbit model

Fig. 3. Reactivity of expressed PPRV truncated (PPRN262) N protein in PPR sandwich ELISA. A1–H1: blank wells; A2–D2: reference positive PPRV antigen; E2–H2: reference negative antigen; A3–B3, C3–D3, E3–F3, G3–H3: PPRN262 0, 5, 6 and 7 h samples, respectively. A4–B4: BL21 control (0 h) sample, C4–D4: BL21 control (6 h) sample, E4–F4: pET33b + BL21 control (0 h) sample, G4–H4: pET33b + BL21control (6 h) sample, A5–B5, C5–D5, E5–F5: purified (PPRN262) protein eluted fractions with 100, 300 and 500 mM imidazole, respectively.

The immunological response of the recombinant N protein was studied in rabbits. The sera collected on 14th, 21st and 28th dpi from rabbits immunized with the ISA-206 adjuvanted purified recombinant proteins were tested for the presence of PPRV N protein specific antibodies in competitive and indirect ELISAs. In c-ELISA, positivity was expressed in terms of PI value (Singh et al., 2004a). The serum samples showing PI value of more than 40% were considered as positive. There was an increase in the PI value of the serum samples collected from immunized rabbits on 14th and 21st dpi, and later it decreased. However, PI values in control animal group were below the cut-off level throughout the experiment. In indirect ELISA, there was a gradual increase in OD492 nm value of serum samples collected up to 21st dpi and then there was a decrease in the OD value of the samples collected later (Fig. 5). 4. Discussion

Fig. 4. Reactivity of the expressed PPRV truncated N protein with 1:100 MAb.

Thorough epidemiological investigation is essential for the control of any disease. PPR is considered as one of the main constraints in augmenting the productivity of small ruminants in endemic countries such as parts of Africa, the Middle East and India. The disease is economically important and hence, its control and eradication is a priority. Use of whole virus antigen in diagnostic assay is not safe, as it requires bio-safety measures and proper disposal. In order to meet the increasing demand of diagnostic reagents, it is necessary to supply a safe, potent and cost-effective

Fig. 5. Immunogenicity of expressed PPRV truncated (PPRN262) and complete (PPRV N) N protein in rabbit. PPRV N protein specific antibody levels increase with days post-immunization up to 21 days, indicating the expressed protein maintain the native immunogenic epitopes. (A) Competitive ELISA: line shows positive/negative cut-off at 40% percentage inhibition (PI). (B). Indirect ELISA: line shows positive/negative cut-off about 0.2, i.e., double the OD value of the negative serum reaction.

V. Yadav et al. / Journal of Virological Methods 162 (2009) 56–63

antigen. Among the structural proteins of morbilliviruses, N protein is the highly conserved immunogenic core protein (Lefvre et al., 1991) and is expressed at a high level in infected cells (Diallo et al., 1994). Further, N protein has both type-specific and cross-reactive epitopes. So, it is a good candidate antigen for diagnosis of morbilliviruses. The recombinant N proteins of the virulent Kabete O strain of RPV (Ismail et al., 1994) and Nigeria 75/1 PPRV (Ismail et al., 1995) were expressed in baculovirus and have been used in ELISA to distinguish vaccinated animals from those infected with RPV and for serological diagnosis of PPR. Production of recombinant antigens in bacteria is simpler and more economical when compared to mammalian or insect cell culture system. In this system, the desired product can comprise more than 50% of the total cell protein in a mere few hours post-induction (Studier et al., 1990). The N protein of PPRV does not require any post-translational modifications. Therefore, in the present study, truncated (262 aa from N-terminal region) and complete N protein of PPRV were expressed as 32 and 60 kDa recombinant fusion proteins in a prokaryotic (E. coli) system and their diagnostic or immunogenic potentials have been evaluated. The full-length and partial PPRV N gene sequences were amplified by RT-PCR, cloned into pET33b vector and characterized. In order to express PPRV N protein, BL21 strain of E. coli was used for transformation of the characterized recombinant plasmid DNA. After the characterization of the BL21 clones, expression of recombinant N proteins was induced using 1 mM IPTG at 30 ◦ C. At this temperature, there would be increased expression and activity of a number of E. coli chaperons, thereby enhanced protein folding and reduced precipitation of inclusion bodies (Ferrer et al., 2003). Pre-induction incubation for 3 h at 37 ◦ C was necessary to achieve mid-log phase growth. Samples collected at various time intervals were analyzed by SDS-PAGE. Upon comparison of protein profiles of the recombinant clones with that of the control (vector and BL21 cells), MW of 32 and 60 kDa expressed proteins were observed in case of recombinant pETN262 and pETN clones, respectively, as early as 4 hpi. The intensity of the bands increased gradually up to 7 hpi. In un-induced and control cultures, such specific bands were not observed even after prolonged incubation. Therefore, 32 and 60 kDa bands corresponded to cloned partial and full-length gene products, respectively (Fig. 2A and B). The optimum time of harvest was 7 hpi and not much difference was observed in the rate of expression either at 6 or 7 hpi but thereafter, there was a reduction in expression. This reduction could be attributed to autolysis of bacterial cells as reported earlier (Pathak et al., 2008). The proteins resolved in SDS-PAGE were transferred on to a NCM and were detected by using a PPRV N protein specific MAb (Fig. 2C and D). On analysis, specific bands of 32 and 60 kDa molecular size were observed for truncated and complete PPRV N proteins, respectively. This confirmed that the expressed recombinant proteins were specific to PPRV and no other non-specific bands were noticed. The predicted size of the complete N protein from aa sequences is about 58 kDa (Muthuchelvan et al., 2006) while the truncated protein is 30 kDa. The calculated size as per aa composition along with fused His-tag and as observed by the mobility in SDS-PAGE, was in agreement with the reported size indicating that the 32 and 60 kDa proteins were the product from the cloned gene. Western blot analysis with MAb against the PPRV N protein indicated that the bands observed in SDS-PAGE are virus specific. Such His-tag fusion proteins have been expressed in case of Nipah virus also (Yu et al., 2006). Further, to assess the utility of the expressed proteins, they were purified by using Ni-NTA affinity columns to their homogeneity. This method has been successfully used for purification of several other expressed proteins (Yu et al., 2006; Sun et al., 2007). Presence

61

of C-terminal His-tag both in cloned gene product and expression vector facilitated the easy and efficient purification. The N-terminal His-tag is not preferred due to several disadvantages reported elsewhere, especially in purification (Chen et al., 2003; Svensson et al., 2006). It was found that 300 mM imidazole concentration was optimum for elution of protein. Various concentrations of imidazole (100–500 mM) have been reported in purifying expressed proteins (Yu et al., 2006; Latha et al., 2007; Pathak et al., 2008). Purification under non-denaturing conditions avoids arduous work of re-folding of denatured protein. This is advantageous to retain conformational epitopes on the protein and thereby facilitates better reactivity even with MAbs. It also helps to retain the immunogenicity of recombinant protein, as was reported earlier (Finzi et al., 2003). Though other immuno-assays are used, ELISA is one of the most sensitive and extensively applied methods to evaluate expressed proteins (Choi et al., 2005b; Li et al., 2006). The mean reactivity of the purified protein was 1.404, while, that of crude lysate was 1.5 (Fig. 3) as against PPRV antigen of 0.950 in s-ELISA. Similarly, the reactivity of the purified complete N protein was 0.425 and that of its crude lysate was 0.615. The discrepancy in the reactivity may be due to reactive epitopes on the truncated protein available for binding with PPRV N protein specific Mab with the same concentration in ELISA being comparatively higher than that of the complete protein. This indicated that the expressed PPRV N protein reacted well with PPRV N specific MAb in s-ELISA, implying the recognition of the epitopes located on expressed proteins by the MAb. This suggests that the either forms of the expressed protein could be used as positive antigen in place of PPRV in s-ELISA, but the crude lysate is economical as the purification step could be avoided. Such crude cell lysate in the presence of protease inhibitors and a protein stabilizer have been evaluated in c-ELISA for detecting the antibodies to PPRV (Choi et al., 2005b). Further, to evaluate recombinant N protein for its potential use in serological diagnosis, c-ELISA was employed as a preliminary study. The expressed protein was tested for its suitability as antigen in ELISA instead of the whole virus being used as a coating antigen. A recombinant protein was used in ELISA along with the PPRV antigen to compare the reactivity. The results indicated that the expressed N protein reacted well with PPR serum in ELISA making it evident that the epitopes present in expressed protein are well recognized by the antibody. The OD values of all the standards used in this assay did not show much variation between the plates, indicating repeatability of the assay. The serum samples received from areas endemic for PPR were also tested, which could clearly differentiate between infected and uninfected population. In a preliminary study, out of 120 serum samples tested, 93 samples were found positive by PPRV antigen and 73 samples were found positive by recombinant protein based c-ELISA. Libeau et al. (1995) also reported 94.5% relative sensitivity and 99.4% relative specificity of recombinant N protein based c-ELISA when compared to virus neutralization test while testing PPR serum samples. However, the relative sensitivity and specificity of the assay was not compared with that of the virus due to the limited number of samples analyzed in this preliminary study. However, this assay needs to be validated by screening more number of serum samples. The mean reactivity of the PPRV N protein and PPRV antigen with MAb was 0.466 and 0.774, respectively indicating that the recombinant N protein can replace the whole virus as coating antigen in c-ELISA. For an effective control of any infectious disease, its detailed epidemiological characteristics must be studied by extensive clinical and serological surveillance before launch of the control programme. The c-ELISA described here could be an alternative to PPRV H MAb based c-ELISA (Singh et al., 2004a) for sero-epidemiological surveys.

62

V. Yadav et al. / Journal of Virological Methods 162 (2009) 56–63

The serum samples collected on 14th, 21st and 28th dpi from rabbits immunized with the ISA-206 adjuvanted purified recombinant proteins showed PPRV N protein specific antibody response when tested in competitive and indirect ELISAs (Fig. 4). In N protein, the amino-terminal assembly domains of 420 aa are highly conserved across the genus and among PPRV strains. But, in RPV, it has been established that the epitopes at the amino-terminal half of the N protein are variable, highly immunogenic (Bodjo et al., 2007) and stimulate humoral immune response more rapidly than those in C-terminal region (Choi et al., 2005a) as observed in this study. The reduction in the immune response could be due to the usage of a single dose of purified protein as reported earlier (Gulati et al., 2001). This indicated that the expressed PPRV N proteins in E. coli retained the conformational epitopes and displayed immunogenic potential in rabbits. Similarly, Dahl et al. (2004), reported the plasmid DNA encoding CDV N and hemagglutinin (H) genes protected the mink on challenge. Authors also argued that the combination of both genes offered better protection, rather than administering plasmid DNA encoding either H or N alone. However, in the present study, the challenge experiment was not carried out in rabbits due to non-availability of the rabbit adapted PPR challenge virus. Further, evaluation of these recombinant proteins alone or in combination with PPRV H protein is warranted in homologous natural host(s), so as to assess the immunogenicity of these recombinant proteins. In Asian countries, PPR is currently enzootic and only lineage IV of PPRV is circulating and hence, PPR ELISA has great export potential. But, PPR-free countries may not accept the current ELISA kit, in which, live attenuated PPRV is used as antigen. In these circumstances, the recombinant PPRV N protein based ELISA would be the most sought assay as compared to whole PPRV antigen based kits. Further, it is well known that the prokaryotic expression system is cost-effective, user-friendly and easy to scale up commercially. It is also possible to produce the recombinant antigen on a large-scale in a single batch with use of fermentors. Such a product would have the homogeneity due to a single-cycle of down-stream processing. Therefore, recombinant technology based PPR diagnostics and prophylactics will be of immense value during PPR eradication and post-eradication phases. Acknowledgements The authors are thankful to the Director, Indian Veterinary Research Institute for providing necessary facilities to carry out this work and the staff of Rinderpest and Allied Diseases Laboratory, IVRI, Mukteswar, for their valuable and timely help in carrying out this work. Further, V. Yadav acknowledges IVRI for financial support in terms of Senior Research Fellowship to carry out the Ph.D. Programme. References Balamurugan, V., Sen, A., Saravanan, P., Rasool, T.J., Yadav, M.P., Bandyopadhyay, S.K., Singh, R.K., 2006. Development and characterization of a stable Vero cell line constitutively expressing Peste des petits ruminants virus (PPRV) hemagglutinin protein and its potential use as antigen in enzyme-linked immunosorbent assay for serosurveillance of PPRV. Clin. Vaccine Immunol. 3 (12), 1367–1372. Balamurugan, V., Singh, R.P., Saravanan, P., Sen, A., Sarkar, J., Sahay, B., Rasool, T.J., Singh, R.K., 2007. Development of an indirect ELISA for the detection of antibodies against Peste des petits ruminants virus in small ruminants. Vet. Res. Commun. 31, 355–364. Bodjo, S.C., Kwiatek, O., Diallo, A., Albina, E., Libeau, G., 2007. Mapping and structural analysis of B-cell epitopes on the morbillivirus nucleoprotein amino terminus. J. Gen. Virol. 88, 1231–1242. Burnette, W.N., 1981. ‘Western blotting’ electrophoretic transfer of proteins from sodium dodecyl sulfate-polyacrylamide gels to unmodified nitrocellulose and radiographic detection with antibody and radioiodinated protein A. Anal. Biochem. 112, 195–203.

Chen, H., Coote, B., Attree, S., Hiscox, J.A., 2003. Evaluation of a nucleoprotein-based enzyme-linked immunosorbent assay for the detection of antibodies against infectious bronchitis virus. Avian Pathol. 32, 519–526. Choi, K.S., Nah, J., Ko, Y.J., Kang, S.Y., Jo, N.I., 2005b. Rapid competitive enzyme-linked immunosorbent assay for detection of antibodies to Peste des Petits Ruminants virus. Clin. Diagn. Lab. Immunol. 12, 542–547. Choi, K.S., Nah, J., Ko, Y.J., Kang, S.Y., Yoon, K.J., Jo, N.I., 2005a. Antigenic and immunogenic investigation of B-cell epitopes in the nucleocapsid protein of Peste des Petits Ruminants virus. Clin. Diagn. Lab. Immunol. 12, 114–121. Dahl, L., Jensen, T.H., Gottschalck, E., Karlskov-Mortensen, P., Jensen, T.D., Nielsen, L., Andersen, M.K., Buckland, R., Wild, T.F., Blixenkrone-Møller, M., 2004. Immunization with plasmid DNA encoding the hemagglutinin and the nucleoprotein confers robust protection against a lethal canine distemper virus challenge. Vaccine 22, 3642–3648. Dechamma, H.J., Dighe, V., Kumar, C.A., Singh, R.P., Jagadish, M., Kumar, S., 2006. Identification of T-helper and linear B epitope in the hypervariable region of nucleocapsid protein of PPRV and its use in the development of specific antibodies to detect viral antigen. Vet. Microbiol. 118 (3–4), 201–211. Dhar, P., Sreenivasa, B.P., Barrett, T., Corteyn, M., Singh, R.P., Bandyopadhyay, S.K., 2002. Recent epidemiology of peste des petits ruminants virus (PPRV). Vet. Microbiol. 88, 153–159. Diallo, A., 1990. Morbillivirus group: genome organization and proteins. Vet. Microbiol. 23, 155–163. Diallo, A., Barrett, T., Barbron, M., Meyer, G., Lefevre, P.C., 1994. Cloning of nucleocapsid protein gene of peste des petits ruminants virus: relationship to other morbilliviruses. J. Gen. Virol. 75, 233–237. Diallo, A., Minet, C., Le Goff, C., Berhe, G., Albina, E., Libeau, G., Barrett, T., 2007. The threat of peste des petits ruminants: progress in vaccine development for disease control. Vaccine 26, 5591–5597. Ferrer, M., Chernikova, T.N., Yakimov, M.M., Golyshin, P.N., Timmis, K.N., 2003. Chaperonins govern growth of Escherichia coli at low temperatures. Nat. Biotechnol. 21, 1266–1267. Finzi, A., Cloutier, J., Cohen, E.A., 2003. Two-step purification of His-tagged Nef protein in native condition using heparin and immobilized metal ion affinity chromatographies. J. Virol. Methods 111, 69–73. Gargadennec, L., Lalanne, A., 1942. La peste des petits ruminants. Bull. Serve. Zootech. Epizoot. Afr. Occid. Fr. 5, 16–21. Gibbs, E.P.J., Taylor, W.P., Lawman, M.J.P., Bryant, J., 1979. Classification of peste des petits ruminants virus as the fourth member of the genus Morbillivirus. Intervirology 11, 268–274. Gulati, B.R., Shirin, M., Patnayak, D.P., Goyal, S.M., Kapur, V., 2001. Detection of antibodies to U.S. isolates of avian pneumovirus by a recombinant nucleocapsid protein-based sandwich enzyme-linked immunosorbent assay. J. Clin. Microbiol. 39, 2967–2970. Ismail, T., Admad, S., D’souza-Ault, M., Bassiri, M., Saliki, J., Mebus, C., Yilma, T., 1994. Cloning and expression of the nucleocapsid gene of virulent Kabete O strain of rinderpest virus in baculovirus: use in differential diagnosis between vaccinated and infected animals. Virology 198, 138–147. Ismail, T.M., Yamanaka, M.K., Saliki, J.T., EL-Kholy, A., Mebus, C., Yilma, T., 1995. Cloning and expression of the nucleoprotein of Peste-des-petits-ruminants virus in baculovirus for use in serological diagnosis. Virology 208, 776–778. Jacobson, R.H., 1998. Validation of serological assays for diagnosis of infectious diseases. Rev. Sci. Tech. OIE 17, 469–486. Jeggo, M.H., Anderson, J., 1992. FAOIAEA external quality assurance programme for the FAOIAEA competitive ELISA results in 1992. In: The Sero-monitoring of Rinderpest throughout Africa: Phase II. IAEA, Vienna, pp. 9–21. Kamata, H., Ohkubo, S., Sugiyama, M., Matsuura, Y., Kamata, Y., Tsukiyama-Kohara, K., Imaoka, K., Kai, C., Yoshikawa, Y., Yamanouchi, K., 1993. Expression in baculovirus vector system of the nucleocapsid protein gene of rinderpest virus. J. Virol. Methods 43, 159–166. Latha, D., Geetha, M., Ramadass, P., Narayanan, R.B., 2007. Evaluation of ELISA based on the conserved and functional middle region of nucleocapsid protein to detect distemper infection in dogs. Vet. Microbiol. 120, 251–260. Lefvre, P.C., Diallo, A., Schenkel, F., Hussein, S., Staak, S., 1991. Serological evidence of peste des petits ruminants in Jordan. Vet. Rec. 128, 110. Li, G., Pan, l., Mou, D., Chen, Y., Zhang, Y., Li, X., Ren, J., Wang, P., Zhang, Y., Jia, Z., Huang, C., Sun, Y., Yang, W., Xiao, Y.S., Bai, X., 2006. Characterization of truncated hantavirus nucleocapsid proteins and their application for serotyping. J. Med. Virol. 78, 926–932. Libeau, G., Prehaud, C., Lancelot, R., Colas, F., Guerre, L., Bishop, D.H., Diallo, A., 1995. Development of a competitive ELISA for detecting antibodies to the peste des petits ruminants virus using a recombinant nucleoprotein. Res. Vet. Sci. 58, 50–55. Muthuchelvan, D., Sanyal, A., Balamurugan, V., Dhar, P., Bandyopadhyay, S.K., 2006. Sequence analysis of the nucleoprotein gene of Asian lineage PPR vaccine virus. Vet. Res. Commun. 30, 953–961. Pathak, K.B., Biswas, S.K., Tembhurne, P.A., Hosamani, M., Bhanuprakash, V., Gaya Prasad, Singh, R.K., Rasool, T.J., Mondal, B., 2008. Prokaryotic expression of truncated VP7 of bluetongue virus (BTV) and reactivity of the purified recombinant protein with all BTV type-specific sera. J. Virol. Methods 152, 6–12. Shaila, M.S., Purushothaman, V., Bhavasar, D., Venugopal, K., Venkatesan, R.A., 1989. Peste des petits ruminants of sheep in India. Vet. Rec. 125, 602. Shaila, M.S., Shamaki, D., Forsyth, M.A., Drallo, A., Groatley, L., Kitching, R.P., Barrett, T., 1996. Geographic distribution and epidemiology of peste des petits ruminants viruses. Virus Res. 43, 149–153.

V. Yadav et al. / Journal of Virological Methods 162 (2009) 56–63 Singh, R.P., De, U.K., Pandey, K.D., in press. Virological and antigenic characterization of two Peste des Petits Ruminants (PPR) vaccine viruses of Indian origin. Comp Immunol Microbiol Infect Dis. Singh, R.P., Saravanan, P., Sreenivasa, B.P., Singh, R.K., Bandyopadhyay, S.K., 2004c. Prevalence and distribution of peste des petits ruminants virus infection in small ruminants in India. Rev. Sci. Technol. 23, 807–819. Singh, R.P., Sreenivasa, B.P., Dhar, P., Bandyopadhyay, S.K., 2004b. A sandwich-ELISA for the diagnosis of Peste des petits ruminants (PPR) infection in small ruminants using anti-nucleocapsid protein monoclonal antibody. Arch. Virol. 149, 2155–2170. Singh, R.P., Sreenivasa, B.P., Dhar, P., Shah, L.C., Bandyopadhyay, S.K., 2004a. Development of a monoclonal antibody based competitive-ELISA for detection and titration of antibodies to peste des petits ruminants (PPR) virus. Vet. Microbiol. 98, 3–15.

63

Studier, F.W., Rosenberg, A.H., Dunn, J.J., 1990. Use of T7 RNA polymerase to direct expression of cloned genes. Methods Enzymol. 185, 60–89. Sun, Y., Xing, J.F., Zhu, R.N., Deng, J., Zhao, L.Q., Wang, F., Qian, Y., 2007. Sequence analysis and prokaryotic expression of nucleocapsid protein genes of human respiratory syncytial viruses isolated from children in Beijing. Bing Du Xue Bao 23 (6), 459–465. Svensson, J., Andersson, C., Reseland, J.E., Lyngstadaas, P., Bulow, L., 2006. Histidine tag fusion increases expression levels of active recombinant amelogenin in Escherichia coli. Protein Expr. Purif. 48, 134–141. Yu, F., Khairullah, N.S., Inoue, S., Balasubramaniam, V., Berendam, S.J., Teh, L.K., Ibrahim, N.S., Abdul Rahman, S.A., Hassan, S.S., Hasebe, F., Sinniah, M., Morita, K., 2006. Serodiagnosis using recombinant Nipah virus nucleocapsid protein expressed in Escherichia coli. J. Clin. Microbiol. 44, 3134–3138.