Expression profiles of key transcription factors involved in lipid metabolism in Beijing-You chickens

Gene 537 (2014) 120–125

Contents lists available at ScienceDirect

Gene journal homepage: www.elsevier.com/locate/gene

Expression profiles of key transcription factors involved in lipid metabolism in Beijing-You chickens R.Q. Fu 1, R.R. Liu 1, G.P. Zhao, M.Q. Zheng, J.L. Chen, J. Wen ⁎ Institute of Animal Sciences (IAS), Chinese Academy of Agricultural Sciences (CAAS), Beijing 100193, China State Key Laboratory of Animal Nutrition, Beijing 100193, China Key Laboratory of Farm Animal Genetic Resources and Germplasm Innovation, Ministry of Agriculture, Beijing 100193, China

a r t i c l e

i n f o

Article history: Accepted 31 July 2013 Available online 5 October 2013 Keywords: Lipid metabolism Beijing-You chickens Transcription factors mRNA

a b s t r a c t Intramuscular fat (IMF) is a crucial factor for the meat quality of chickens. With the aim of studying the molecular mechanisms underlying IMF deposition in chickens, the expression profiles of five candidate transcription factors involved in lipid metabolism in several tissues were examined in Beijing-You (BJY) chickens at five ages (0, 4, 8, 14 and 20 wk). Results showed that accumulation of IMF in breast (IMFbr), thigh (IMFth) and abdominal fat weight increased significantly (P b 0.01) after 8 wk. Accumulation of both IMFbr and IMFth from 8 to 14 wk exceeded that from 14 to 20 wk; IMFth was 4–7 times of IMFbr. As for the expression profiles of key transcription factors: 1) expression of C/EBPα and PPARγ in abdominal fat was significantly higher than that in breast and thigh muscles at all ages. The expression of C/EBPα was positively correlated with PPARγ in both breast and thigh muscles, which indicated that both C/EBPα and PPARγ promoted fat deposition and might act through a unified pathway; 2) the expression of SREBP-1 in 0, 4, and 8 wk in thigh muscle was significantly higher than that in breast; 3) expression of C/EBPβ at 4 and 8 wk was significantly higher than that at 14 and 20 wk; and it was positively correlated with IMFth and IMFbr from 0 to 8 wk; 4) expression of PPARα in breast and thigh muscles was significantly higher than that in abdominal fat. Taken together, all five transcription factors studied play roles in lipid metabolism in chickens with C/EBPα and PPARγ being important effectors. © 2013 Published by Elsevier B.V.

1. Introduction It is commonly known that intramuscular fat (IMF) contributes to flavor and juiciness. It is an important factor for the palatability of chicken meat. The content of IMF is the result of lipogenesis and lipolysis with complex molecular mechanisms. Chickens differ from mammals in having minimal dissectible adipose tissue associated with the connective elements of skeletal muscle and lipid accumulation is more influenced by uptake of blood lipids and subsequent lipogenesis rather than de novo fatty acid synthesis (Griffin et al., 1987, 1992). Liver serves as the main site of fatty acid synthesis and exports lipids as lipoproteins along with those derived from the gut (Griffin et al., 1987, 1992;

Abbreviations: AbFW, abdominal fat weight; ADD-1, adipocyte determination and differentiation-dependent factor 1; ANOVA, analysis of variance; BJY, Beijing-You; C/EBPα, CCAAT/enhancer-binding protein factors α; C/EBPβ, CCAAT/enhancer-binding protein factors β; GLM, generalized linear model; IMF, intramuscular fat; IMFbr, IMF in breast muscle; IMFth, IMF in thigh muscle; MCE, mitotic clonal expansion; PPARα, peroxisome proliferatoractivated receptor α; PPARγ, peroxisome proliferator-activated receptor γ; SREBP1, sterol regulatory element-binding protein 1. ⁎ Corresponding author at: No 2, Yuanmingyuan West Road, Haidian District, Beijing 100193, China. Tel.: +86 10 62815856. E-mail address: [email protected] (J. Wen). 1 The authors contributed equally to this work. 0378-1119/$ – see front matter © 2013 Published by Elsevier B.V. http://dx.doi.org/10.1016/j.gene.2013.07.109

Leclercq et al., 1984; Leveille et al., 1975). Together, these serve as substrates for use by other tissues, including deposition in muscle as well as in adipose tissue. The regulation of lipid deposition in adipose tissue is incompletely understood but can be expected to involve adipogenesis (differentiation and maturation), lipid transport, lipogenesis and lipolysis; the latter three would be of additional importance in muscle. There is evidence, from a variety of species, for certain transcription factors playing roles in controlling adipocyte differentiation, lipogenesis and lipolysis (Haraguchi et al., 2003; Hausman et al., 2009; Hummasti et al., 2008). Adipogenesis is a well-regulated process controlled by a highly coordinated activation of various transcription factors. Temporal expression, in a highly coordinated cascade, of transcripts for CCAAT/ enhancer-binding protein factors (C/EBPα, C/EBPβ), sterol regulatory element-binding protein 1 (SREBP1), and peroxisome proliferatoractivated receptors (PPARα and PPARγ) is especially important (Elam et al., 2001; Koo et al., 2001; Rosen et al., 2000). SREBP1 plays an important role in the early stages of adipogenesis (Kim and Spiegelman, 1996). In addition to C/EBPβ being expressed in the early stages of adipogenesis (Darlington et al., 1998; Timchenko et al., 1996), C/EBPβ as a transcriptional relay might be under the direct control of some effects of insulin and/or SREBP1 in mature fat cells (Le Lay et al., 2002; Timchenko et al., 1996). Subsequently, C/EBPβ induces the expression of C/EBPα and PPARγ at later stages of cell differentiation (Rosen et al.,

R.Q. Fu et al. / Gene 537 (2014) 120–125

121

Table 1 Primers for the targeted and reference transcripts. Gene name

Primer sequencea

Product length (bp)

GenBank Accession

SREBP1

F CTGAAGGGTGACGAGGAGGG R GCTGCTGCCACAGGTTGGT F ATTACGAGGCGGACTGTTTGG R CGGGTGAGGCTGATGTAGGTG F GTGGACAAGAACAGCAACGAGTACCGC R TGCCTGAAGATGCCCCGCAGAGT F TCAGAATAAGGAAGCCGAAGT R GATTGGAGAAGCCAGGGAT F CACAAGCGGAGAAGGAG R TTTGGTCAGAGGGAAGG F GAGAAATTGTGCGTGACATCA R CCTGAACCTCTCATTGCCA

301

AY029224.1

304

NM_205253.1

200

NM_001031459.1

110

AF163809.1

134

AF163811.1

152

L08165

C/EBPβ C/EBPα PPARα PPARγ β-actin a

Each primer is shown 5′ to 3′.

2002; Timchenko et al., 1996) and these participate in a positive feedback loop, promoting and maintaining the differentiated state (Yeh et al., 1995a). The two transcription factors, C/EBPα and PPARγ, play essential roles in activating terminal differentiation of adipocytes, lipid synthesis and other specific programs (Hausman et al., 2009; Olofsson et al., 2008; Rosen et al., 2002). PPARα is another important contributor to lipid metabolism by increasing fatty acid β-oxidative and lipid oxidation, hence reducing lipid accumulation (Muoio et al., 2002; Tsuchida et al., 2005; Ye et al., 2001). The dynamics of these transcription factors (SREBP1, C/EBPβ, C/EBPα, PPARγ and PPARα) in important tissues across maturation in chickens are still unclear, as are the possible effects of the transcription factors on fat deposition. Beijing-You (BJY) chickens are a local variety, with a high fat content and an excellent flavor. The objective of this study was to describe developmental changes and explore possible relationships between expression of transcription factors and fat deposition in economically important tissues during growth of chickens.

five groups, each of 10 birds. All birds were raised under recommended conditions with ad libitum feed and water. At each age tested (day of hatch, 4, 8, 14 and 20wk), the 10 birds of a group were fasted for 12 h, weighed then killed by stunning and exsanguination. Samples (50–100mg) of each right breast muscle, thigh muscle, and abdominal fat were rapidly removed and snap-frozen in liquid nitrogen for storage at −80 °C. The remainder of each sampled tissue was stripped of obvious connective tissues, weighed, and then stored at −20 °C.

2.2. Intramuscular fat (IMF) IMF in the right breast muscle (IMFbr) and IMF in thigh muscle (IMFth) were measured by Soxhlet extraction, exactly as described by Zerehdaran et al. (2004) and Cui et al. (2012).

2.3. RNA extraction and reverse transcription (RT) 2. Materials and methods 2.1. Animals and sample collection All experimental procedures were performed according to the Guidelines for Experimental Animals established by the Ministry of Science and Technology (Beijing, China). Fifty BJY male hatchlings came from conservation stock (Institute of Animal Science, Chinese Academy of Agricultural Sciences, Beijing, China) and were randomly assigned to

Total RNA was isolated at 4 °C using the Trizol reagent (Invitrogen, US), then any residual genomic DNA and protein were removed with Dnase I (TaKaRa, Japan) and RNA clean kit (TIANGEN, Beijing). The purified RNA was dissolved (200–400 ng/ml, OD260/OD280 = 1.8–2.0), and stored at −70 °C. Total RNA was used for RT (in 20 μl final volume) following the manufacturer's instruction (Promega, USA) and cDNA was stored at − 70 °C for subsequent real time-PCR.

Note: different letters indicate significant differences between ages within each trait (P<0.05, n=10). IMF could not be measured and there was no abdominal fat at 0 wk (all shown as 0) Fig. 1. IMF in breast and thigh and AbFW across ages of BJY. Note: different letters indicate significant differences between ages within each trait (P b 0.05, n = 10). IMF could not be measured and there was no abdominal fat at 0 wk (all shown as 0).

122

R.Q. Fu et al. / Gene 537 (2014) 120–125

Table 2 Relative expression of SREBP1 in different tissues and ages. Tissue

Age (wk) 0

Breast Thigh Abdominal fat

4 y

−1.11 ± 0.29 −0.39 ± 0.11xBC –

8 y

−0.73 ± 0.14 −0.21 ± 0.08xB −1.11 ± 0.12y

14 xy

−0.71 ± 0.25 −0.43 ± 0.14xBC −1.00 ± 0.11y

20 x

−0.46 ± 0.10 −0.62 ± 0.07xC −1.10 ± 0.08y

−0.57 ± 0.18y 0.10 ± 0.07xA −1.32 ± 0.08z

Note: different lowercase superscripts indicate significant differences (P b 0.05) among tissues, and different uppercase superscripts indicate significant differences (P b 0.05) between ages. Abdominal fat was not present at 0 wk so is given a –. (n = 7 for each mean).

lipid accumulation, was quantified and each is described in the following sections.

2.4. Real time-PCR Real time-PCR was performed using a Thermal Cycler with Dice Real Time Detection System (ABI 7500, USA) and TaKaRa DRR018A reagents, following the supplier's instructions. Each 20 μl PCR mixture contained 10 μl of SYBR Premix Ex Taq™ II, 0.8 μl (10 mM) of each primer (Table 1), 0.4 μl of ROX Reference Dye II (50×), 2 μl of cDNA (total 100 ng) and 6.0 μl of ddH2O. After an initial denaturing for 30 s at 95 °C, there were 40 cycles of amplification (95 °C for 5 s and 60 °C for 34 s). Samples were assayed in triplicate for standard curves, and PCR efficiency of the five genes and β-actin was consistent. For all transcripts, cDNA from chicken liver at 0 wk served as a standard control. Negative control (without samples) and positive control (β-actin) reactions were performed within each assay. The amplification efficiency of transcripts of interest and the internal standard (β-actin) were consistent. Dissociation curves verified that single PCR products were amplified. The relative abundance of transcripts was calculated from lg2 −ΔΔCT. 2.5. Statistical methods Correlations were estimated with the descriptive procedure (Correlations Model) and the expression data were analyzed with the ANOVA procedure (GLM model with Duncan's tests) of SAS 8.0 to assess differences between tissues and ages. All data presented graphically are means ± SEM and those outside the limit of mean ± 2 ∗ SD in each group were deleted. The level of significance was P b 0.05. 3. Results 3.1. Content of IMF (%) in skeletal muscle and the weight of abdominal fat The contents of IMFbr and IMFth at 4 wk were significantly higher than those at 8 wk (P b 0.01). All three variables increased significantly (P b 0.01) after 8 wk (Fig. 1). The accumulation of IMF from 8 to 14 wk exceeded that from 14 to 20 wk in both breast (1.46% vs 0.55%) and thigh (6.87% vs 2.40%). Additionally, at each age except 0 wk, IMFth was 4–7 times that of IMFbr. 3.2. The expression of transcription factors potentially related to IMF Expression, in each tissue of interest and at the five ages, of the transcription factors (SREBP1, C/EBPβ, C/EBPα, PPARγ and PPARα) influencing

3.2.1. SREBP1 As shown in Table 2, the abundance of SREBP1 transcripts in breast muscle and abdominal fat did not differ markedly with age. In thigh muscle, expression at 20 wk was higher than at all earlier ages (P b 0.05), but there were no striking differences from 0 to 14 wk. The expression in breast muscle and thigh muscle was significantly higher than that in abdominal fat at 14 and 20 wk (both P b 0.01). At 0, 4, and 8 wk, expression in thigh muscle was significantly higher than in breast muscle; there was no difference between breast muscle and abdominal fat at 4 and 8 wk. 3.2.2. C/EBPβ The relative abundance of C/EBPβ transcripts (Table 3) in thigh muscle at the other ages was greater than that at hatching (P b 0.01), but without significant changes from 4 to 20 wk. Transcript abundances in breast muscle and abdominal fat at 14 and 20 wk were significantly lower than those at 4 and 8 wk (P b 0.05). Expression at 0, 4 and 8 wk in breast muscle significantly exceeded that in thigh muscle. Expression in abdominal fat was lower than in breast muscle at all ages (4 to 20wk) and in thigh muscle at 14 and 20wk. 3.2.3. C/EBPα The mRNA abundances of C/EBPα are summarized in Table 4. The lowest expression in breast muscle was at 4 wk. In abdominal fat, expression increased from 4 to 8 wk then decreased from 14 wk to the lowest level at 20 wk. The abundance of C/EBPα kept stable in thigh muscle at different stages. Expression in breast muscle and thigh muscle was significantly lower than that in abdominal fat at all ages with the only difference between the two muscles occurring at 4 wk. 3.2.4. PPARγ With the exception of thigh muscle, there were no significant changes in PPARγ expression across the ages studied (Table 5). Expression in thigh was highest at hatching and decreased significantly at 4 and 8 wk. Expression in abdominal fat (4 to 14 wk) was significantly higher than that in either muscle and exceeded that in thigh muscle at 20 wk; there was no difference between breast muscle and thigh muscle, except at hatching.

Table 3 Relative expression of C/EBPβ in different tissues and ages. Tissue

Age (wk) 0

Breast Thigh Abdominal fat

4 xB

0.12 ± 0.08 −0.67 ± 0.21yB –

8 xA

1.08 ± 0.27 0.56 ± 0.17xyA 0.23 ± 0.16yA

14 xA

1.18 ± 0.19 0.44 ± 0.13yA 0.17 ± 0.13yA

20 xB

0.43 ± 0.07 0.41 ± 0.09xA −0.56 ± 0.14yB

0.41 ± 0.17xB 0.42 ± 0.09xA −0.67 ± 0.11yB

Note: different lowercase superscripts indicate significant differences (P b 0.05) among tissues, and different uppercase superscripts indicate significant differences (P b 0.05) between ages. Abdominal fat was not present at 0 wk so is given a –. (n = 7 for each mean).

R.Q. Fu et al. / Gene 537 (2014) 120–125

123

Table 4 Relative expression of C/EBPα in different tissues and ages. Tissue

Age (wk) 0

Breast Thigh Abdominal fat

4 A

−1.15 ± 0.19 −1.05 ± 0.19 –

8 zB

−1.83 ± 0.17 −1.22 ± 0.11y −0.40 ± 0.05xB

14 yA

−1.06 ± 0.09 −1.19 ± 0.11y −0.03 ± 0.10xA

20 yA

−1.23 ± 0.13 −1.34 ± 0.12y −0.12 ± 0.05xA

−1.07 ± 0.12yA −1.10 ± 0.08y −0.44 ± 0.06xB

Note: different lowercase superscripts indicate significant differences (P b 0.05) among tissues, and different uppercase superscripts indicate significant differences (P b 0.05) between ages. Abdominal fat was not present at 0 wk so is given a –. (n = 7 for each mean).

3.2.5. PPARα As Table 6 shows, the abundance of PPARα transcripts at 0 wk was significantly higher than that at 20 wk in breast muscle, but there were no differences at 4, 8, and 14 wk. In thigh muscle and abdominal fat, expression decreased (from 0 to 8 wk, thigh; 4 to 8 wk, abdominal fat) then rebounded at later stages. Expression in breast muscle was significantly higher than that in abdominal fat at 4 and 8 wk and that in thigh muscle was greater than in abdominal fat at all ages beyond 0 wk. There was no difference between the two muscles at 4 and 8 wk but, at other ages, expression in thigh exceeded that in breast.

et al.'s (2008) study. As Ye et al. (2009) reported, at each age except 0 wk, IMFth was 4–7 times that of IMFbr. According to our finding that the increases in the content of IMFbr and IMFth from 8 to 14 wk (1.46% and 6.87%) were higher than those from 14 to 20 wk (0.55% and 2.40%), we suggest that the period from 8 to 14wk is the most important stage for IMF deposition in BJY chickens. There was a steady increase in AbFW after 8 wk. 5.2. Effect of SREBP1 on fat deposition

Changes in the expression of C/EBPβ were positively correlated with IMFth (r = 0.62, P b 0.01) and with IMFbr only at 0 to 8 wk (r = 0.61, P=0.01), but negatively correlated (r=−0.69, Pb 0.01) with abdominal fat weight (AbFW) from 4 to 20 wk. The expression of PPARα, just for weeks 0 to 8, was negatively correlated with IMFth (r = −0.69, P b 0.01). Several other correlations, for part or all of the ages examined, existed but none exceeded 0.6 (positive or negative).

SREBP1, also known as ADD-1, is a major determinant preferentially activating genes required for fatty acid synthesis (Chang et al., 2006; Le Lay et al., 2002; Sekiya et al., 2007). Over-expression of SREBP1 increased fatty acid secretion, and fatty liver (Horton et al., 2003; Shimomura et al., 1998). In the current study, at 0, 4, and 8 wk, the expression of SREBP1 in thigh muscle was higher than that in breast muscle, which demonstrated that SREBP1 might play a role in lipid metabolism in muscle in the early developmental stages (Kim and Spiegelman, 1996). In addition, transcript abundances of SREBP1 from 14 to 20wk were found to be positively correlated with those of PPARγ in thigh muscle and C/EBPα in abdominal fat, consistent with previous reports that SREBP1 played a role in lipogenesis through PPARγ or C/EBPα (Castillo et al., 1999; Horton et al., 2003; Le Lay et al., 2002; Pettinelli and Videla, 2011).

4.2. Associations among the five transcription factors

5.3. Effect of C/EBPβ on fat deposition

SREBP1 was positively correlated with PPARγ in thigh muscle (r = 0.60, P b 0.01) and C/EBPα (r = 0.81, P b 0.01) in abdominal fat from 14 to 20 wk. The expression of C/EBPα was positively correlated with PPARγ in breast muscle (r=0.68, P=0.01) for both the first three stages of 0, 4, 8wk and the last three stages from 8 to 20wk (r=0.61, P=0.03), and was positively correlated in thigh muscle over all ages (r = 0.65, P b 0.01).

C/EBPβ is a prerequisite factor for mitotic clonal expansion (MCE) in the adipocyte differentiation program (Tang et al., 2003). We find that the expression of C/EBPβ in breast muscle and abdominal fat at 4 and 8 wk was significantly higher than at 14 and 20 wk and this was consistent with the previous report (Darlington et al., 1998). In addition, it was positively correlated with IMFth and IMFbr (before 8 wk), so we deduce that C/EBPβ played a role in lipid accumulation in the program of adipocyte differentiation rather than in fat synthesis.

4. Correlation of transcription factors with indices of fat accumulation 4.1. Relationships between transcription factors and fat traits

5. Discussion 5.4. Effect of PPARγ and C/EBPα on fat deposition 5.1. The content of fat in different tissues and different growth stages IMF is the main factor underlying tenderness, juiciness and flavor, and it changed with aging. In this study, IMFbr and AbFW at 20 wk were significantly higher than those at 14 wk and they were both notably higher than before 8 wk. IMFth at 14 and 20 wk was significantly higher than that at 4 and 8 wk. These results were consistent with Li

Previous studies found that C/EBPα and PPARγ participate in a single pathway of fat cell development and in inducing an array of genes related to lipid metabolism (Olofsson et al., 2008; Rosen et al., 2002; Yeh et al., 1995a). In the current study, the expression of C/EBPα and PPARγ in abdominal fat was significantly higher than that in breast muscle and thigh muscle at all stages. This pattern is consistent with the phenotype

Table 5 Relative expression of PPARγ in different tissues and ages. Tissue

Age (wk) 0

Breast Thigh Abdominal fat

4 y

0.38 ± 0.03 0.97 ± 0.12xA –

8 y

0.50 ± 0.08 0.55 ± 0.07yB 1.84 ± 0.09x

14 y

0.70 ± 0.14 0.52 ± 0.13yB 1.54 ± 0.17x

20 y

0.65 ± 0.27 0.66 ± .08yAB 1.60 ± 0.19x

1.26 ± 0.45xy 0.83 ± 0.07yAB 1.77 ± 0.05x

Note: different lowercase superscripts indicate significant differences (P b 0.05) among tissues, and different uppercase superscripts indicate significant differences (P b 0.05) between ages. Abdominal fat was not present at 0 wk so is given a –. (n = 7 for each mean).

124

R.Q. Fu et al. / Gene 537 (2014) 120–125

Table 6 Relative expression of PPARα in different tissues and ages. Tissue

Age (wk) 0

Breast Thigh Abdominal fat

4 yA

−0.38 ± 0.08 0.15 ± 0.17xA –

8 xAB

−0.64 ± 0.11 −0.42 ± 0.08xBC −1.28 ± 0.05yAB

14 xAB

−0.53 ± 0.18 −0.48 ± 0.05xC −1.45 ± 0.14yB

20 yAB

−0.85 ± 0.11 −0.02 ± 0.01xAB −1.13 ± 0.09yA

−0.88 ± 0.20yB 0.06 ± 0.02xA −1.01 ± 0.05yA

Note: different lowercase superscripts indicate significant differences (P b 0.05) among tissues, and different uppercase superscripts indicate significant differences (P b 0.05) between ages. Abdominal fat was not present at 0 wk so is given a –. (n = 7 for each mean).

that fat deposition in the abdomen was significantly higher than in breast and thigh muscles in the chickens. The expression of C/EBPα was positively correlated with PPARγ in breast muscle for both the first three (0 to 8 wk) and the last three (8 to 20 wk) ages, and positively correlated in thigh muscle at all ages. It indicated that both C/EBPα and PPARγ likely promoted fat deposition and acted through a unified pathway in chickens as well as other species (Chatterjee et al., 2011; El-Jack et al., 1999; Jiang et al., 2001; Marchildon et al., 2010; Olofsson et al., 2008; Yeh et al., 1995b). C/EBPα and PPARγ should be important candidate factors for lipid metabolism in chickens. 5.5. Effect of PPARα on fat deposition PPARα is predominantly expressed in liver and brown adipose tissue (Barbier et al., 2002; Szanto and Nagy, 2005), contributed to fatty acid β-oxidation and reduced lipid accumulation (Barbier et al., 2002; Tsuchida et al., 2005). In the present study, PPARα was negatively correlated with IMFth from 0 to 8 wk, and the expressed quantity of PPARα in thigh muscle was significantly higher than that in abdominal fat at the last four ages, both of which are consistent with the phenotype that fat accumulation in thigh was lower than that in the abdomen. These results were consistent with previous studies that PPARα contributed to fat oxidation (Muoio et al., 2002; Tsuchida et al., 2005; Ye et al., 2001). The reason may be that PPARα is crucial in the expression of certain enzymes of β-oxidation and in the process of peroxisome proliferation in skeletal muscle. The present approach has used gene expression profiling to explore the function of key transcription factors involved in lipid metabolism in chickens. Possible regulation by translational mechanisms and posttranslational modifications may also contribute. Further examination in both embryonic and post-hatch stages of development is required. 6. Conclusion The current study has shown that accumulation of IMF in breast (IMFbr) and thigh (IMFth) and abdominal fat weight (AbFW) increased significantly (Pb0.01) after 8wk; accumulation of both IMFbr and IMFth from 8 to 14 wk exceeded that from 14 to 20 wk; IMFth was 4–7 times that of IMFbr. Based on the expression profiles of key transcription factors, we found that 1) expression of both C/EBPα and PPARγ was consistent with their promoting fat deposition and might act through a unified pathway in chickens. 2) SREBP1 might play a role in lipid metabolism in muscle in the early developmental stages. 3) Expression of C/EBPβ at 4 and 8 wk was significantly higher than that at 14 and 20 wk; and it was positively correlated with IMFth and IMFbr from 0 to 8 wk. 4) PPARα in breast and thigh muscles was significantly higher than that in abdominal fat. Taken together, all five transcription factors studied here appear to play roles in lipid metabolism in chickens with C/EBPα and PPARγ being important effectors. Conflict of interest The authors do not have any possible conflicts of interest.

Acknowledgments Authors acknowledged W. Bruce Currie (Emeritus Professor, Cornell University) for his contributions to the manuscript. The research was supported by grants from the National Natural Science Foundation of China (31272437), the National High-tech R&D Program (2013AA102501), and the China Agriculture Research System (CARS-42).

References Barbier, O., et al., 2002. Pleiotropic actions of peroxisome proliferator–activated receptors in lipid metabolism and atherosclerosis. Arterioscler. Thromb. Vasc. Biol. 22, 717–726. Castillo, G., et al., 1999. Role and regulation of PPARγ during adipogenesis. J. Anim. Sci. 77 (Suppl.), 9–15. Chang, Yongsheng, et al., 2006. Keratinocyte Growth Factor Induces Lipogenesis in Alveolar Type II Cells through a Sterol Regulatory Element Binding Protein-1c–Dependent Pathway. Am. J. Respir. Cell Mol. Biol. 35, 268. Chatterjee, Raghunath, et al., 2011. Suppression of the C/EBP family of transcription factors in adipose tissue causes lipodystrophy. J. Mol. Endocrinol. 46, 175–192. Cui, H.X., et al., 2012. Liver dominant expression of fatty acid synthase (FAS) gene in two chicken breeds during intramuscular-fat development. Mol. Biol. Rep. 39, 3479–3484. Darlington, Gretchen J., Ross, Sarah E., MacDougald, Ormond A., 1998. The role of C/EBP genes in adipocyte differentiation. J. Biol. Chem. 273, 30057–30060. Elam, Marshall B., et al., 2001. Increased hepatic VLDL secretion, lipogenesis, and SREBP-1 expression in the corpulent JCR: LA-cp rat. J. Lipid Res. 42, 2039–2048. El-Jack, A.K., Hamm, J.K., Pilch, P.F., Farmer, S.R., 1999. Reconstitution of insulin-sensitive glucose transport in fibroblasts requires expression of both PPARγ and C/EBPα. J. Biol. Chem. 274, 7946–7951. Griffin, H.D., Butterwith, S.C., Goddard, C., 1987. Contribution of lipoprotein lipase to differences in fatness between broiler and layer‐strain chickens. Br. Poult. Sci. 28, 197–206. Haraguchi, G., et al., 2003. PPAR(alpha) and PPAR(gamma) activators suppress the monocytemacro- phage apoB-48 receptor. J. Lipid Res. 44, 1224–1231. Hausman, G.J., et al., 2009. Board-invited review: the biology and regulation of preadipocytes and adipocytes in meat animals. J. Anim. Sci. 87, 1218–1246. Horton, J.D., Shimomura, I., Ikemoto, S., Bashmakov, Y., Hammer, R.E., 2003. Overexpression of sterol regulatory element-binding protein-1a in mouse adipose tissue produces adipocyte hypertrophy, increased fatty acid secretion, and fatty liver. J. Biol. Chem. 278, 36652–36660. Hummasti, S., Hong, C., Bensinger, S.J., Tontonoz, P., 2008. HRASLS3 is a PPARγ-selective target gene that promotes adipocyte differentiation. J. Lipid Res. 49, 2535–2544. Jiang, Y.J., et al., 2001. Modulation of cytosolic phospholipase A2 by PPAR activators in human preadipocytes. J. Lipid Res. 42, 716–724. Kim, J.B., Spiegelman, B.M., 1996. ADD1/SREBP1 promotes adipocyte differentiation and gene expression linked to fatty acid metabolism. Gene Dev. 10, 1096–1107. Koo, S.H., Dutcher, A.K., Towle, H.C., 2001. Glucose and insulin function through two distinct transcription factors to stimulate expression of lipogenic enzyme genes in liver. J. Biol. Chem. 276, 9437–9445. Le Lay, S., Lefrère, I., Trautwein, C., Dugail, I., Krief, S., 2002. Insulin and Sterol-regulatory Element-binding Protein-1c (SREBP-1C) Regulation of Gene Expression in 3 T3-L1 Adipocytes IDENTIFICATION OF CCAAT/ENHANCER-BINDING PROTEIN β AS AN SREBP-1C TARGET. J. Biol. Chem. 277, 35625–35634. Leclercq, B., Hermier, D., Salichon, M.R., 1984. Effects of age and diet on plasma lipid and glucose concentrations in genetically lean or fat chickens. Reprod. Nutr. Dev. 24, 53–61. Leveille, G.A., Romsos, D.R., Yeh, Y.Y., O’Hea, E.K., 1975. Lipid biosynthesis in the chick. A consideration of site of synthesis, influence of diet and possible regulatory mechanisms. Poult. Sci. 54, 1075–1093. Li, W.J., et al., 2008. Gene expression of heart-and adipocyte-fatty acid-binding protein and correlation with intramuscular fat in Chinese chickens. Anim. Biotechnol. 19, 190–194. Marchildon, F., St-Louis, C., Akter, R., Roodman, V., Wiper-Bergeron, N.L., 2010. Transcription factor Smad3 is required for the inhibition of adipogenesis by retinoic acid. J. Biol. Chem. 285, 13274–13284. Muoio, D.M., et al., 2002. Fatty Acid Homeostasis and Induction of Lipid Regulatory Genes in Skeletal Muscles of Peroxisome Proliferator-activated Receptor (PPAR) α Knock-out Mice EVIDENCE FOR COMPENSATORY REGULATION BY PPARδ. J. Biol. Chem. 277, 26089–26097.

R.Q. Fu et al. / Gene 537 (2014) 120–125 Olofsson, L.E., et al., 2008. CCAAT/enhancer binding protein α (C/EBPα) in adipose tissue regulates genes in lipid and glucose metabolism and a genetic variation in C/EBPα is associated with serum levels of triglycerides. J. Clin. Endocrinol. Metab. 93, 4880–4886. Pettinelli, P., Videla, L.A., 2011. Up-regulation of PPAR-γ mRNA expression in the liver of obese patients: an additional reinforcing lipogenic mechanism to SREBP-1c induction. J. Clin. Endocrinol. Metab. 96, 1424–1430. Rosen, E.D., Walkey, C.J., Puigserver, P., Spiegelman, B.M., 2000. Transcriptional regulation of adipogenesis. Genes Dev. 14, 1293–1307. Rosen, E.D., et al., 2002. C/EBPα induces adipogenesis through PPARγ: a unified pathway. Genes Dev. 16, 22–26. Sekiya, M., et al., 2007. SREBP-1-independent regulation of lipogenic gene expression in adipocytes. J. Lipid Res. 48, 1581–1591. Shimomura, L., et al., 1998. Insulin resistance and diabetes mellitus in transgenic mice expressing nuclear SREBP-1c in adipose tissue: model for congenital generalized lipodystrophy. Genes Dev. 12, 3182–3194. Szanto, A., Nagy, L., 2005. Retinoids potentiate peroxisome proliferator-activated receptor γ action in differentiation, gene expression, and lipid metabolic processes in developing myeloid cells. Mol. Pharmacol. 67, 1935–1943. Tang, Q.Q., Otto, T.C., Lane, M.D., 2003. CCAAT/enhancer-binding protein β is required for mitotic clonal expansion during adipogenesis. PNAS 100, 850–855.

125

Timchenko, N.A., Wilde, M., Nakanishi, M., Smith, J.R., Darlington, G.J., 1996. CCAAT/ enhancer-binding protein alpha (C/EBP alpha) inhibits cell proliferation through the p21 (WAF-1/CIP-1/SDI-1) protein. Genes Dev. 10, 804–815. Tsuchida, A., et al., 2005. Peroxisome Proliferator–Activated Receptor (PPAR) α Activation Increases Adiponectin Receptors and Reduces Obesity-Related Inflammation in Adipose Tissue Comparison of Activation of PPARα, PPARγ, and Their Combination. Diabetes 54, 3358–3370. Ye, J.M., et al., 2001. Peroxisome Proliferator—Activated Receptor (PPAR)-α Activation Lowers Muscle Lipids and Improves Insulin Sensitivity in High Fat—Fed Rats Comparison with PPAR-γ Activation. Diabetes 50, 411–417. Ye, M.H., Chen, J.L., Zhao, G.P., Zheng, M.Q., Wen, J., 2009. Associations of A-FABP and HFABP markers with the content of intramuscular fat in Beijing-You chicken. Anim. Biotechnol. 21, 14–24. Yeh, W.C., Cao, Z., Classon, M., McKnight, S.L., 1995a. Cascade regulation of terminal adipocyte differentiation by three members of the C/EBP family of leucine zipper proteins. Genes Dev. 9, 168–181. Yeh, W.C., Li, T.K., Bierer, B.E., McKnight, S.L., 1995b. Identification and characterization of an immunophilin expressed during the clonal expansion phase of adipocyte differentiation. PNAS 92, 11081–11085. Zerehdaran, S., Vereijken, A.L., Van Arendonk, J.A., van Der Waaijt, E.H., 2004. Estimation of genetic parameters for fat deposition and carcass traits in broilers. Poult. Sci. 83, 521–525.