Extraction of high quality genomic DNA from microsamples of human blood

SCIENTIFIC & TECHNICAL

Extraction of high quality genomic DNA from microsamples of human blood MA H-W, CHENG J and CADDY B* Forensic Science Unit, University of Strathclyde, 204 George St, Glasgow, United Kingdom GI IXW Journal of the Forensic Science Society 1994; 34: 231 -236 Received 18 March 1993; accepted 20 January 1994

.+ simple and efficient method for extracting human genomic DNA from microsamples of blood has been developed. This method used sodium perchlorate, chloroform, polymerised silica gel and a dumbbellshape tube, instead of proteinase K and phenol. The entire process took less than two hours, and high molecular weight DNA , in high yield and purity, was obtained from a few microlitres of human blood. DNA prepared in this way can be easily digested with restriction endonucleases and has been employed for DNA profiling and the polymerase chain reaction.

Vorstellung einer neu entwickelten, einfachen und effizienten Methode zur Extraktion menschlicher DNS aus Mikroproben von Blut. Das Verfahren benutzt Natrium-Perchlorat, Chloroform, polymerisierter Silica-Gel und ein speziell geformtes MikroTestrohrchen, anstelle von K-Proteinase und Phenol. Der ganze Extraktionsprozess dauert weniger als zwei Stunden, um hochmolekulare DNS, in grosser Menge und Reinheit, aus wenigen Mikrolitern Blut zu erhalten. Die so gewonnene DNS ist leicht verarbeitbar mit Restriktion-Endonukleasen und kann fur DNS-Profiling wie auch PCR-Zwecke genutzt werden.

Une mCthode simple et efficace pour extraire I'ADN gknomique humain de micro Cchantillons de sang a CtC dCveloppCe. Cette mithode utilise du perchlorate de sodium, du chloroforme, un silica gel polymCrisC et un tube i~ reaction en forme d'haltkre au lieu de la protCinase K et du phCnol. Le processus complet prend moins de deux heures et de 1'ADN B haut poids molCculaire avec un rendement et une puretC ClevCe a CtC obtenu B partir de quelques microlitres de sang humain. De 1'ADN prCparC de cette faqon peut &tre facilement digCrC avec des endonuclCases de restriction et a CtC employ6 pour le profilage de I'ADN et la PCR.

Se desarrolla un mitodo simple y eficiente para extraer el ADN gendmico humano de micromuestras de sangre. El mCtodo usa perclorato s6dic0, cloroformo, gel de silice polimerizada y un tubo de diseiio especial en forma de campana en lugar de proteinasa K y fenol. El proceso completo tarda menos de dos horas y se obtiene un ADN de alto peso molecular con un alto rendimiento y pureza, a partir de pocos microlitros de sangre humana. El ADN obtenido de esta forma puede ser facilmente digerido con endonucleasas de restricci6n y se ha empleado en la obtencidn de perfiles de ADN mediante hibridaci6n asi como en la reaccidn en cadena de la polimerasa.

Key Words: DNA; Extraction; Microsamples; Polymerised silica gel; Dumbbell tube. *Corresponding author.

JFSS 1994; 34(4): 231-236

Introduction DNA profiling and the polymerase chain reaction (PCR) are perhaps the two most powerful techniques which have appeared in forensic science in recent times [I, 21, but they usually require the isolation of adequate quantities of high quality DNA from biological samples, devoid of protein and other restriction enzyme inhibitors [3]. In forensic science the extraction of DNA is often required from microsamples of blood, and although many simplified and fast methods of extraction of DNA have been reported [4,5], they are not applicable to small blood samples [6]. The conventional method for extracting DNA involves the digestion of nuclear lysates with proteinase K followed by phenal/chloroform extraction [7], but this method has limitations for the recovery of DNA from microsamples [8] because it can be difficult to separate the DNA from any digested proteins at the interphase of the aqueous and organic layers during phenol/chloroform purification processing. The outcome of this is a reduction in the yield of DNA. To extract DNA from small whole blood samples, conventional methods use either pronase digestion for several hours or proteinase K digestion followed by phenol/chloroform extraction [I, 9-11], but apart from Yokoi and Sagisaka's work [ll], there are no data available to indicate the yield and purity of any DNA extracted. Using proteinase K and phenol to isolate sufficient DNA for dot blot hybridisation, Yokoi and Sagisaka were only able to estimate a recovery of 250ng of DNA from 10 p l of whole blood. The purity as assessed from A260/A2,0ratio lay between 1.8 and 2.0. To extract adequate DNA from 300p1 of whole blood in order to perform a DNA profiling with a multi-locus probe, Singer et al. [12] used a modified protein salting-out procedure which took an extended time to complete (about 17 hours). These workers still employed proteinase K as a means of digesting proteins. A newer method using chelex 100 as a chelating agent was reported to produce DNA suitable for PCR analysis but not for DNA profiling using single or multi-locus probes [13]. The procedure proposed in the present paper used sodium perchlorate and polymerised silica gel (PSG) to replace proteinase K and phenol respectively, and a specially designed dumbbell tube to reduce the area of the interface between the aqueous and organic phases. The PSG is a protein binding material which lies between the top aqueous and bottom organic layers.

After proteins are denatured and fragmented by sodium perchlorate, the PSG is added to bind to small fragments of protein covalently while at the same time forming a plug in between the two liquid phases. The large fragments of protein are trapped below the PSG plug. The narrow neck of the dumbbell tube allows the tube to hold the PSG plug firmly and reduces the possible loss of DNA at the interface.

Materials and methods The materials were obtained from Sigma (agarose gel, A DNA Hind 111 digest marker, pBR 322 Hae 111 digest marker, proteinase K, and RNase I enzymes; the restriction enzyme Hinf I, AluI and EcoR); from Perkin-Elmer-Cetus (the thermalstable Taq polymerase, dNTP and 10X reaction buffer); and from Fisons (sodium perchlorate). A Philips UV/Vis spectrophotometer, model PU 8740, was used for all measurements. The extraction buffer was made up of lOmM Tris-HC1, 320 mM sucrose, 5 mM MgC12, 1% Triton X-100, pH 7.5. The lysis buffer consisted of 400mM Tris-HC1, pH 8.0, 60mM EDTA, 150 mM NaCl and 1% SDS. The PSG slurry consisted of 0.8 g of PSG suspended in 1ml of 1X TE buffer. (PSG may now be purchased as a kit for DNA extraction from Scotlab Ltd., Kirkshaws Road, Coatbridge, Lanarkshire, Scotland ML5 8AD, or ScotLab Inc., 30 Controls Drive, Shelton, CT 06484, USA). 1 X TE buffer was made up of 10 mM Tris-HC1, 1 mM EDTA, pH 8.0; 10X reaction buffer consisted of l00mM Tris-HC1, pH 8.3 at 25"C, 500 mM KC1, 15 mM MgCl,, 0.01% gelatin and 10X TAE buffer was made up of 40mM Tris-base, 20 mM sodium acetate and 0.2 mM EDTA, pH 8.3.

DNA extraction Lymphocytes were prepared by adding extraction buffer, as shown in Table 1, to different volumes of EDTA-treated human blood. The contents were TABLE 1 Corresponding volumes (pl) of reagents required for the extraction of DNA from diierent volumes of blood (pl) Whole blood

Extraction buffer

Lysis buffer

5M Sodium perchlorate

1-15 15-50 50-100 100-500

150 200 400 2,oOc'

205 255 305 330

10 15 25 100

JFSS 1994; 34(4): 231-236

mixed on a tilt shaker for 5 minutes and centrifuged at 1300 X G for 3 minutes. The supernatant in each tube was then removed. The pelleted lymphocytes in each tube were resuspended in lysis buffer and 5mM sodium perchlorate solution was added. The volume of both lysis buffer and sodium perchlorate solution for a specified range of blood volumes are listed in Table 1. The mixture was tilt-shaken at room temperature for 20 minutes and then incubated in a 65°C water bath for 20 minutes with gentle inversion every 5 minutes to achieve a uniform lysis of the lymphocytes. A 580 ml aliquot of chilled chloroform (-20°C) was added to each tube. The contents were mixed on a tilt shaker for 10 minutes and then transferred into a dumbbell-shape tube (available from Scotlab) (Figure 1) by pipette. After centrifugation at 1000 X G for 1 minute in a swinging-bucked rotorhead, 45 ml of PSG slurry was added to each tube without mixing. The tubes were centrifuged again at 1360X G for 4 minutes. The aqueous phase in each tube was poured into a fresh Eppendorf tube and spun at 16000 X G for 2 minutes to remove any residual PSG. The DNA was then precipitated by adding two volumes of cool ethanol (4°C) and pelleted by centrifugation at 16000 X G for 5 minutes. After drying at 56°C for 4 minutes, the DNA pellet was allowed to redissolve in a suitable volume of 1 X TE buffer. Enzyme digestion Each of three DNA samples with an identical quantity of about 3 p g of DNA was digested using 10 units of

the restriction enzymes Hinf I, Alu I and EcoR I respectively at 37°C for 4 hours. For comparison, DNA was extracted from microsamples of whole blood by incubation at 37°C overnight with proteinase K followed by phenol/chloroform extraction using a conventional procedure [4]. PCR amplification For the typing of the VNTR at the 3' end of the human apolipoprotein B (apo B) gene [14], the human genomic DNA extracted with the proposed method was used as a template and the following two primers were used: 5' CCTTCTCACTTGGCAAATAC 3' and 5' ATGGAAAGGGAGAAATI'ATG 3'. The reaction mixture of PCR was composed of 5 p1 of 10X reaction buffer, 19p1 of deionised distilled water, 200 mM each deoxynucleoside triphosphate (dNTP), 320 ng of the first primer and 160 ng of the second primer, and 2 units of thermostable Taq polymerase. For the generation of the first batch of PCR products 40 ng of the extracted DNA were used as templates for each sample. Doubled amounts of the DNA templates for each sample were used to generate the second batch of PCR products. The PCR mixtures were initially melted at 94°C for 75 seconds and then 30 cycles of amplification were performed: 1 minute at 94"C, 6 minutes at 58°C. The final extension was carried out at 58°C for 4 minutes. Extraction efficiency and purity The quantity and purity of the extracted DNA was determined using a UV spectrophotometer. Before spectrophotoscopic measurement, DNA obtained from each of 50p1, 100pl and 500p1 samples of whole blood were diluted to 3 ml with 1 X TE buffer. Ten DNA samples from 10 p1 of blood were pooled and then diluted to 3ml with 1X T E buffer. The absorption of DNA samples at 260 and 280nm were recorded and concentrations calculated using one unit = 50mglml. The purity of the extracted DNA was assessed from the A2,,/A2, ratio, and this procedure was also carried out with DNA extracted by the conventional method. Agarose gel electrophoresis

FIGURE 1 n e cross-section view of a dumbbell tube.

JFSS 1994; 34(4): 231-236

In order to determine the molecular weight of the DNA and the approximate quantity of DNA extracted by the proposed method, electrophoresis of the extracts was performed on 0.8% agarose gels prepared in 1 X TAE buffer. For the examination of the PCR results obtained using DNA extracted by the proposed protocol as templates, a 2% agarose gel

prepared in 1X TAE buffer was employed. On completion the gels were examined under a UV transilluminator and the results recorded on Polaroid 667 film.

Results and discussion and A,,, values from the Table 2 shows the conventional proteinase K, phenol/chloroform method and the proposed method, the ratio of these two values and the yield of DNA. Using the specially designed dumbbell-shape tube, at least 300 ng of high quality DNA was extracted from 10 p l of human blood kept at -20°C for 1 month. Electrophoresis of the DNA extracted by the new procedure showed that the molecular weight of the DNA was above 20Kb. The reproducibility of the extraction results is demonstrated in Figure 2. The traditional proteinase K, phenol/chloroform method [4] has been the model for extracting DNA for many years. Although many improved methods have emerged, most of them are variations on the same theme and show little practical improvement. Other modified methods have not gained wide acceptance in forensic science for a variety of reasons, one being that they are not suitable for microsamples. With the conventional method, one disadvantage of proteinase K incubation at 37°C is that some nuclease

TABLE 2 UV spectrophotometric data for DNA extracted from microblood samples (A) by the proposed method and (B) by the conventional method Sample Volume of A260 A280 no blood ( m l ) ( A U ) ( A U ) A2601A280

Yield (ml)

FIGURE 2 DNA extract from microsamples of whole human blood with the proposed methods. Lanes 1 and 10 were ADNA Hind I11 digest size marker with quantities of 0.2 and 0.54pg, respectively. Lanes 2 and 3, 4 and 5, 6 and 7, 8 and 9 were DNA extracted from 5, 10, 15 and 2 0 p l of whole human blood respectively. Electrophoresis at 40 V for 90 minutes in 0.8°/~agarose gel.

degradation may occur [IS], although with care this should be avoided. Another disadvantage is that some DNA is unavoidably left at the interphase between the top aqueous phase and the bottom organic phase, to prevent protein contamination during aspiration of the aqueous from the organic phase. As a consequence, the aspiration has to be repeated several times to purify the DNA. This undoubtedly causes a reduction in DNA yield and the operation becomes laborious. T o overcome these disadvantages sodium perchlorate and PSG were used instead of proteinase K and phenol respectively, and a dumbbell-shape tube was introduced into the new protocol. With this method a single extraction was sufficient, and the extracted DNA was easily digested by many restriction endonucleases such as Hinf I, Alu I and EcoR I, and has also been used for RFLP and PCR analysis.

Conclusions The new method offers several advantages. It is suitable for the specialised use of forensic requirements and offers a significant reduction in time, both for the operator and for the redissolution of DNA. It enables pure, high molecular weight DNA to be extracted in high yield, and is especially suitable for forensic DNA profiling and PCR.

*The results were obtained by pooling ten DNA samples extracted from 10 p.1 of whole blood.

Acknowledgement The authors would like to thank Mr M Pearce of the Forensic Science Unit, University of Strathclyde, for his assistance in the generation of PCR result. JFSS 1994; 34(4): 231-236

References 1. Gill P, Jeffreys AJ and Werrett DJ. Forensic application of DNA 'fingerprints'. Nature 1985; 318: 577-579. 2. Higuchi R, Beroldingen CH, Sensabaugh G F and Erlich HA. DNA typing from single hairs. Nature 1988; 332: 543-546. 3. Maniatis T, Fritsch E F and Sambrook J. Molecular Cloning: A Laboratory Manual. Cold Spring Harbor, NY: Cold Spring Harbor Laboratory Press, 1982: 458-460. 4. Adeli K and Ogboma G. Rapid purification of human DNA from whole blood for potential application in clinical chemistry laboratories. Clinical Chemistry 1990; 36: 261-264. 5. Miller SA, Dykes D D and Polesky HF. A salting out procedure for extracting DNA from human nucleated cells. Nucleic Acids Research 1988; 16: 1215. 6. Jeanpierre M. A rapid method for the purification of DNA from blood. Nucleic Acids Research 1987; 15: 9611. 7. Sambrook J, Fritsch E F and Maniatis T. Molecular Cloning: A Laboratory Manual, Vol 1, 2 and 3, 2nd edn. Cold Spring Harbor, NY: Cold Spring Harbor Laboratory Press, 1989. 8. Singer E, Kuenzle CC, Thomann PE and Ulrich H. DNA fingerprinting: improved DNA extraction from small blood samples. Nucleic Acids Research 1988; 16: 7738-7739. 9. Roewer L, Nurnberg P, Fuhrmann E, Rose M, Prokop 0 and Epplen JT. Stain analysis using oligo-

JFSS 1994; 34(4): 231-236

10.

11.

12.

13.

14.

15.

nucleotide probes specific for simple repetitive DNA sequences. Forensic Science International 1990; 47: 59-70. Kobayashi R, Nakauchi H, Nakahori Y, Nakagome Y and Matsuzawa S. Sex identification in fresh blood and dried bloodstains by a nonisotopic deoxyribonucleic acid (DNA) analyzing technique. Journal of Forensic Sciences 1988; 33: 613-620. Yokoi T and Sagisaka K. Sex determination of blood stains with a recombinant DNA probe: comparison with radioactive and non-radioactive labeling methods. Forensic Science International 1989; 41: 117-124. Singer E, Kuenzle CC, Thomann PE and Hubscher U. DNA fingerprinting: improved DNA extraction from small blood samples. Nucleic Acids Research 1988; 16: 7738. Walsh PS, Metzger D A and Higuchi R. Chelex 100 as a medium for simple extraction of DNA for PCR-based typing from forensic material. BioTechniques 1991; 10: 506-513. Boerwinkle E, Xiong W, Fourest E and Chan L. Rapid typing of tandemly repeated hypervariable loci by the polymerase chain reaction: application to the apolipoprotein B 3' hypervariable region. Proceedings of the National Academy of Science of the USA 1989; 86:212-216. Johns MB Jr and Paulus-Thomas E. Purification of human genomic DNA from whole blood using sodium perchlorate in place of phenol. Analytical Biochemistry 1989; 108: 276-278.