EZH2 Inhibition Sensitizes CARM1-High, Homologous Recombination Proficient Ovarian Cancers to PARP Inhibition

Article

EZH2 Inhibition Sensitizes CARM1-High, Homologous Recombination Proficient Ovarian Cancers to PARP Inhibition Graphical Abstract

Authors Sergey Karakashev, Takeshi Fukumoto, Bo Zhao, ..., Andrew V. Kossenkov, Qin Liu, Rugang Zhang

Correspondence [email protected]

In Brief Karakashev et al. show that CARM1 promotes EZH2-mediated epigenetic silencing of the shieldin complex protein MAD2L2. Inhibition of EZH2 induces MAD2L2 expression and nonhomologous end-joining in CARM1-high, homologous recombination proficient ovarian carcinoma cells, sensitizing them to PARP inhibitors.

Highlights d

EZH2 inhibitor sensitizes CARM1-high EOC cells to PARP inhibitor

d

EZH2 inhibitor upregulates MAD2L2 and NHEJ activity in CARM1-high EOC cells

d

EZH2 and PARP inhibitor combination causes mitotic catastrophe

d

EZH2 and PARP inhibitors are synergistic in suppressing CARM1-high EOCs in vivo

Karakashev et al., 2020, Cancer Cell 37, 1–11 February 10, 2020 ª 2019 Elsevier Inc. https://doi.org/10.1016/j.ccell.2019.12.015

Please cite this article in press as: Karakashev et al., EZH2 Inhibition Sensitizes CARM1-High, Homologous Recombination Proficient Ovarian Cancers to PARP Inhibition, Cancer Cell (2019), https://doi.org/10.1016/j.ccell.2019.12.015

Cancer Cell

Article EZH2 Inhibition Sensitizes CARM1-High, Homologous Recombination Proficient Ovarian Cancers to PARP Inhibition Sergey Karakashev,1 Takeshi Fukumoto,1 Bo Zhao,1 Jianhuang Lin,1 Shuai Wu,1 Nail Fatkhutdinov,1 Pyoung-Hwa Park,1 Galina Semenova,1 Stephanie Jean,2 Mark G. Cadungog,2 Mark E. Borowsky,2 Andrew V. Kossenkov,1 Qin Liu,3 and Rugang Zhang1,4,* 1Gene

Expression and Regulation Program, The Wistar Institute, Philadelphia, PA 19104, USA F. Graham Cancer Center & Research Institute, Newark, DE 19713, USA 3Molecular and Cellular Oncogenesis Program, The Wistar Institute, Philadelphia, PA 19104, USA 4Lead Contact *Correspondence: [email protected] https://doi.org/10.1016/j.ccell.2019.12.015 2Helen

SUMMARY

In response to DNA double-strand breaks, MAD2L2-containing shieldin complex plays a critical role in the choice between homologous recombination (HR) and non-homologous end-joining (NHEJ)-mediated repair. Here we show that EZH2 inhibition upregulates MAD2L2 and sensitizes HR-proficient epithelial ovarian cancer (EOC) to poly(adenosine diphosphate-ribose) polymerase (PARP) inhibitor in a CARM1-dependent manner. CARM1 promotes MAD2L2 silencing by driving the switch from the SWI/SNF complex to EZH2 through methylating the BAF155 subunit of the SWI/SNF complex on the MAD2L2 promoter. EZH2 inhibition upregulates MAD2L2 to decrease DNA end resection, which increases NHEJ and chromosomal abnormalities, ultimately causing mitotic catastrophe in PARP inhibitor treated HR-proficient cells. Significantly, EZH2 inhibitor sensitizes CARM1-high, but not CARM-low, EOCs to PARP inhibitors in both orthotopic and patient-derived xenografts.

INTRODUCTION High-grade serous ovarian cancer (HGSOC) is the most common and fatal subtype of epithelial ovarian cancer (EOC). By inhibiting single-strand DNA break repair, poly(adenosine diphosphateribose) polymerase (PARP) inhibitors are synthetically lethal in homologous recombination (HR)-deficient cancer cells (Lord and Ashworth, 2017). Indeed, PARP inhibitors, such as olaparib, have been approved for treatment and maintenance in HGSOC with HR deficiency, such as those caused by BRCA1/2 mutations with substantial clinical benefits (Konstantinopoulos et al., 2015; Moore et al., 2018). However, there is a major unmet clinical need to expand PARP inhibitor utility into HR-proficient HGSOCs that account for
50% of HGSOCs (Konstantinopoulos et al., 2015). CARM1 (also known as PRMT4) is an arginine methyltransferase that asymmetrically dimethylates arginine residues on protein

substrates implicated in a number of pathways, including epigenetic regulation of gene transcription (Wang et al., 2014; Wu and Xu, 2012). CARM1 amplification/overexpression occurs in
20% of HGSOCs, and CARM1-high HGSOCs are typically HR-proficient and mutually exclusive with BRCA1/2 mutations (Karakashev et al., 2018). EZH2 is the catalytic subunit of the polycomb repressive complex 2 (PRC2), which silences its target genes by generating a lysine 27 trimethylation epigenetic mark on histone H3 (H3K27me3) (Cao and Zhang, 2004). CARM1 functions as an oncogene in breast cancer by methylating the BAF155 subunit of the SWI/SNF complex (Wang et al., 2014). In addition, inhibition of EZH2 activity is a therapeutic vulnerability in cells with functional deficiency in the SWI/SNF complex (Hohmann and Vakoc, 2014). However, despite the mutual exclusivity between CARM1 amplification/overexpression and BRCA1/2 mutations in HGSOCs, whether EZH2 inhibition sensitizes CARM1-high HGSOCs to PARP inhibitors has not been explored.

Significance Expanding the utility of PARP inhibitors into HR-proficient cancers remains a major unmet clinical need. CARM1 amplification/overexpression occurs in
20% of high-grade serous ovarian cancers, which are typically mutually exclusive with BRCA1/2 mutations. Our results indicate that selective upregulation of the shieldin component MAD2L2 (also known as REV7) can be explored for sensitizing PARP inhibitors in HR-proficient cells, and a combination of EZH2 and PARP inhibitors represents a precision treatment strategy for HR-proficient CARM1-high cancers. Cancer Cell 37, 1–11, February 10, 2020 ª 2019 Elsevier Inc. 1

Please cite this article in press as: Karakashev et al., EZH2 Inhibition Sensitizes CARM1-High, Homologous Recombination Proficient Ovarian Cancers to PARP Inhibition, Cancer Cell (2019), https://doi.org/10.1016/j.ccell.2019.12.015

Figure 1. CARM1-Dependent Sensitization of PARP Inhibitor by EZH2 Inhibitor (A and B) Synergy analysis for PARP inhibitor olaparib and EZH2 inhibitor GSK126 in (A) CARM1high A1847 parental and (B) CARM1 knockout A1847 cells. Cells were treated with the indicated concentration of olaparib and GSK126 for 72 h. The combination index (CI) value was determined as detailed in the STAR Methods. CI value indicates the following: <1, synergism; =1, additive effect; >1, antagonism. (C and D) Olaparib dose-response curves of (C) parental A1847 and (D) CARM1 knockout A1847 treated with the indicated concentration of EZH2 inhibitors GSK126 or tazemetostat or vehicle DMSO control based on colony formation assays. (E and F) The indicated cells were treated with 0.4 mM olaparib, 2.5 mM GSK126, or a combination for 72 h. The apoptotic cells were (E) quantified by Annexin V staining or (F) examined for expression of cleaved PARP p85 or cleaved caspase 3 by immunoblot. Data represent mean ± SEM. n = 3 independent experiments. p values were calculated using a two-tailed t test. See also Figure S1.

DNA double-strand break (DSB) is repaired by either error-free HR or error-prone non-homologous end-joining (NHEJ) pathways (Ceccaldi et al., 2016). The choice between these two DSB repair pathways is regulated by a number of factors, such as cell cycle and DSB end structure (Ceccaldi et al., 2016). For example, HR requires end resection to generate a 30 overhang, while NHEJ can join unresected ends. MAD2L2 (also known as REV7) is a subunit of the shieldin complex that plays a critical role in the choice between HR and NHEJ DSB repair (Boersma et al., 2015; Ghezraoui et al., 2018; Gupta et al., 2018; Noordermeer et al., 2018; Tomida et al., 2018; Xu et al., 2015). The MAD2L2-containing shieldin promotes NHEJ by protecting DNA ends from resecting. In BRCA-deficient cells, loss of shieldin complex impairs NHEJ and drives PARP inhibitor resistance. Despite the role of shieldin in promoting NHEJ and its loss in mediating PARP inhibitor resistance in BRCA-deficient cells (Boersma et al., 2015; Dev et al., 2018; Ghezraoui et al., 2018; Gupta et al., 2018; Noordermeer et al., 2018; Xu et al., 2015), whether MAD2L2-containing shieldin complex can be explored for sensitizing PARP inhibitor in HR-proficient cells has not been investigated. RESULTS EZH2 Inhibitor Sensitizes CARM1-High Cells to a PARP Inhibitor CARM1 amplification/overexpression is typically mutually exclusive with genetic alterations that cause HR defects, such as BRCA1/2 mutations in HGSOCs (Figures S1A and S1B) and 2 Cancer Cell 37, 1–11, February 10, 2020

expression of CARM1 positively correlates with copy number gain or amplification in the TCGA HGSOC dataset (Figure S1C). PARP inhibitors are synthetically lethal with BRCA1/2 mutations in patients with HGSOCs (Konstantinopoulos et al., 2015; Moore et al., 2018). Since EZH2 inhibition is synthetically lethal with alterations in the CARM1-regulated SWI/SNF complex (Karakashev et al., 2018), we explored whether there is a synergy between EZH2 and PARP inhibitors. Indeed, EZH2 inhibitor GSK126 synergizes with PARP inhibitor olaparib in CARM1-high A1847 cells, but not in CARM1 knockout A1847 cells (Figures 1A, 1B and S1D–S1F). Consistently, the half maximal inhibitory concentration (IC50) of olaparib was reduced by two different EZH2 inhibitors (GSK126 [McCabe et al., 2012] and tazemetostat [Kuntz et al., 2016]) in CARM1-high, but not CARM1 knockout A1847 cells (Figures 1C and 1D). Conversely, EZH2 inhibitors decreased olaparib IC50 in CARM1 overexpressing OVCAR3, but not in parental CARM1-low OVCAR3 cells (Figures S1G–S1I). In addition, genetic knockdown of EZH2 expression also decreased olaparib IC50 in CARM1-high A1847 cells (Figures S1J and S1K). Similar observations were also made using another PARP inhibitor, rucaparib (Figures S1L and S1M), and cisplatin (Figures S1N and S1O), and in additional CARM1-high cells with or without CARM1 knockdown and, conversely, in CARM1-low cell with or without CARM1 overexpression (Figures S1P–S1S). The observed synergy between EZH2 and PARP inhibitors correlated with apoptosis induction in a CARM1-dependent manner (Figures 1E and 1F). Together, we conclude that EZH2 inhibitors sensitize CARM1-high ovarian cancer cells to PARP inhibitors. CARM1-Dependent Upregulation of MAD2L2 by EZH2 Inhibitor To explore the mechanism underlying the observed synergy between EZH2 and PARP inhibitors in CARM1-high cells, we

Please cite this article in press as: Karakashev et al., EZH2 Inhibition Sensitizes CARM1-High, Homologous Recombination Proficient Ovarian Cancers to PARP Inhibition, Cancer Cell (2019), https://doi.org/10.1016/j.ccell.2019.12.015

cross-examined the RNA sequencing (RNA-seq) and EZH2 and H3K27me3 chromatin immunoprecipitation sequencing (ChIP-seq) datasets comparing parental CARM1-high with CARM1 knockout A1847 cells (Figure S2A). The analysis revealed that the NHEJ pathway was enriched in the direct EZH2/H3K27me3 target genes whose expression was upregulated by CARM1 knockout. They include two protein encoding genes, MAD2L2 and APLF, as well as a long non-coding RNA (LINP1), which are all known regulators of the NHEJ pathway (Figure S2A). Given the critical role of MAD2L2 in regulating NHEJ (Boersma et al., 2015; Dev et al., 2018; Ghezraoui et al., 2018; Gupta et al., 2018; Noordermeer et al., 2018; Xu et al., 2015), we focused our functional studies on MAD2L2. The association of EZH2 and its enzymatic product, H3K27me3, with the MAD2L2 promoter was reduced by CARM1 knockout, which correlated with an increase in the expression of MAD2L2 (Figure 2A). We validated the upregulation of MAD2L2 at both mRNA and protein levels in EZH2 inhibitor GSK126-treated and CARM1 knockout cells (Figures 2B and 2C). However, there was no additive effect on MAD2L2 induced by GSK126 and CARM1 knockout suggesting that EZH2 and CARM1 function in the same pathway. Conversely, ectopic CARM1 expression in CARM1-low OVCAR3 cells repressed MAD2L2 expression, which was restored by EZH2 inhibitor GSK126 treatment (Figure 2D). Consistent with CARM1-regulated SWI/SNF complex distribution (Wang et al., 2014) and SWI/SNF antagonism with EZH2 in regulating their target gene expression (Wilson and Roberts, 2011), CARM1 knockout drove the switch from the SWI/SNF subunits such as BAF155, BRG1 and SNF5 to EZH2 (Figures 2E–2G, S2B, and S2C). Notably, EZH2 inhibitor GSK126 decreased the association of H3K27me3 with the MAD2L2 promoter without affecting the association of either EZH2 or the subunits of the SWI/SNF complex with its promoter. Indeed, CARM1 expression negatively correlates with MAD2L2 expression in lasercapture and microdissected HGSOC specimens (Figure 2H). Similarly, CARM1-dependent expression and antagonism between EZH2 and SWI/SNF were also observed for other identified NHEJ regulators such as LINP1 and APLF (Figures S2D–S2J). Together, we conclude that EZH2 inhibitors sensitize ovarian cancer cells to PARP inhibitors in a CARM1-dependent manner, which correlates with the role of CARM1 in driving the switch from the SWI/SNF complex to EZH2-mediated gene silencing for NHEJ genes, such as MAD2L2. We next determined whether the CARM1-regulated antagonism between the SWI/SNF complex and EZH2 depends on the methylation of the R1064 residue of the BAF155 subunit by CARM1 (Wang et al., 2014). Toward this goal, we knocked down endogenous BAF155 in CARM1-high A1847 cells and ectopically expressed a small hairpin RNA (shRNA)-resistant wild-type BAF155 or a point mutant BAF155 R1064K that can no longer be methylated by CARM1 (Wang et al., 2014). Indeed, in the rescue experiment, the point mutant BAF155 R1064K that can no longer be methylated by CARM1 is sufficient to upregulate MAD2L2 on both mRNA and protein levels in BAF155 knockdown cells (Figures 2I and S2K). In contrast, wild-type BAF155 that can still be methylated by CARM1 was unable to upregulate MAD2L2 (Figures 2I and S2K). Consistently, the BAF155 R1064K mutant decreased the association of EZH2

and H3K27Me3 with the MAD2L2 promoter, while driving a switch of the SWI/SNF subunits, such as BAF155, BRG1, and SNF5, back to the MAD2L2 promoter (Figures 2J–2L, S2L, and S2M). As a control, wild-type BAF155 failed to drive the switch back from EZH2 to the SWI/SNF complex on the MAD2L2 promoter (Figures 2J–2L, S2L, and S2M). Similar observations were also made for other identified CARM1-regulated NHEJ regulators, such as LINP1 and APLF (Figures S2N–S2S). Thus, we conclude that CARM1 promotes the EZH2-mediated silencing of NHEJ regulators by methylating BAF155 to drive the switch from the SWI/SNF complex to EZH2-mediated gene silencing. EZH2 Inhibitor Upregulates NHEJ Activity in a CARM1Dependent Manner We next directly determined changes in NHEJ and HR activities, two alternating DNA DSB repairing pathways (Ceccaldi et al., 2016), using a dual HR and NHEJ reporter assay (Arnoult et al., 2017) (Figure 3A). Indeed, GSK126 treatment or CARM1 knockout significantly increased NHEJ activity in CARM1-high cells (Figure 3B). Conversely, ectopic CARM1 expression significantly decreased NHEJ activity in CARM1-low cells, which can be restored by EZH2 inhibitor GSK126 treatment (Figure 3C). Notably, CARM1 knockout also increased HR activity in CARM1-high cells and, conversely, ectopic CARM1 expression decreased HR activity in CARM-low cells (Figures S3A and S3B). In contrast, EZH2 inhibition did not affect HR activity (Figures S3A and S3B). The increase in both NHEJ and HR activity by CARM1 knockout was recapitulated using a CARM1 inhibitor EZM2302 (Drew et al., 2017) (Figures S3C–S3E). Interestingly, CARM1 did not affect any known HR regulating genes based on RNA-seq analysis (e.g., Figures S1D and S3F). Instead, CARM1 knockout altered cell-cycle distribution characterized by an increase in G2 phase (Figure S3G), which is known to favor HR-mediated DSB repair (Rothkamm et al., 2003). This suggests that compared with directly inhibiting CARM1 activity, inhibition of EZH2 activity is advantageous because it selectively upregulates NHEJ activity without affecting HR activity. Indeed, CARM1 inhibition failed to sensitize CARM1-high cells to PARP inhibitor (Figures S3H and S3I). Consistent with the finding that EZH2-mediated silencing of MAD2L2 depends on methylation of BAF155 by CARM1, same as the EZH2 inhibitor, the BAF155 R1064K mutant increased NHEJ activity without affecting HR activity in BAF155 knockdown cells (Figures 3D and 3E). As a control, wild-type BAF155 did not affect either NHEJ or HR activity (Figures 3D and 3E). This correlated with a decrease in olaparib IC50 in BAF155 R1064K rescued, but not wild-type BAF155 rescued cells (Figure S3J). Consistent with previous reports that MAD2L2-containing shieldin complex protects DNA end resection to promote NHEJ (Boersma et al., 2015; Dev et al., 2018; Ghezraoui et al., 2018; Gupta et al., 2018; Tomida et al., 2018; Xu et al., 2015), DNA combing assay revealed that upregulation of MAD2L2 by either EZH2 inhibitor GSK126 or CARM1 knockout correlated with a decrease in DNA end resection as reflected by an increase in CIdU/IdU ratio in the assay (Figure 3F). Together, we conclude that EZH2 inhibitor selectively upregulates NHEJ activity in CARM1-high cells, which correlates with a decrease in DNA end resection. Cancer Cell 37, 1–11, February 10, 2020 3

Please cite this article in press as: Karakashev et al., EZH2 Inhibition Sensitizes CARM1-High, Homologous Recombination Proficient Ovarian Cancers to PARP Inhibition, Cancer Cell (2019), https://doi.org/10.1016/j.ccell.2019.12.015

Figure 2. CARM1-Dependent Upregulation of MAD2L2 by EZH2 Inhibitor (A) EZH2 and H3K27me3 ChIP-seq and RNA-seq tracks of the MAD2L2 gene locus in parental and CARM1 knockout A1847 cells. (B and C) Expression of MAD2L2 (B) mRNA and (C) protein in CARM1-high parental A1847 cells with or without CARM1 knockout and treated with or without GSK126. (D) Expression of MAD2L2 in CARM1-low OVCAR3 cells with or without ectopic CARM1 expression treated with or without GSK126 determined by qRT-PCR. (E–G) Parental and CARM1 knockout A1847 cells treated with vehicle control or 10 mM GSK126 were subjected to ChIP analysis for the MAD2L2 promoter using antibodies against (E) EZH2, (F) H3K27me3, (G) BAF155, or an isotype-matched immunoglobulin (Ig)G control. (H) Negative correlation between CARM1 and MAD2L2 expression in HGSOC specimens based on a laser-capture and microdissected dataset (Mok et al., 2009). (I–L) A1847 cells were infected with a lentivirus encoding shRNA targeting the 30 untranslated region (UTR) of the BAF155 gene together with a retrovirus encoding a wild-type BAF155 or a BAF155 R1064K mutant. Drug-selected cells were (I) examined for expression of the indicated proteins by immunoblot or subjected to ChIP analysis for the MAD2L2 promoter using antibodies against (J) EZH2, (K) H3K27me3, (L) BAF155, or an isotype-matched IgG control. Data represent mean ± SEM. n = 3 independent experiments unless otherwise stated. p values were calculated using a two-tailed t test. See also Figure S2.

NHEJ and MAD2L2 Determine the Sensitization of CARM1-High Cells to PARP Inhibitor by EZH2 Inhibitor To determine whether the observed sensitization to PARP inhibitor by EZH2 inhibitor in CARM1-high cells depends on the observed 4 Cancer Cell 37, 1–11, February 10, 2020

upregulation of the NHEJ pathway, we knocked down KU70 (Figure 4A), a key regulator of the NHEJ pathway (Ceccaldi et al., 2016). KU70 knockdown reversed the observed decrease in PARP inhibitor olaparib IC50 and apoptosis induction in CARM1-high cells by

Please cite this article in press as: Karakashev et al., EZH2 Inhibition Sensitizes CARM1-High, Homologous Recombination Proficient Ovarian Cancers to PARP Inhibition, Cancer Cell (2019), https://doi.org/10.1016/j.ccell.2019.12.015

Figure 3. EZH2 Inhibitor Selectively Increases NHEJ Activity in CARM1-High Cells (A) Schematics of the dual NHEJ and HR reporter assay (Arnoult et al., 2017). (B and C) NHEJ activity in (B) CARM1-high A1847 cells with or without CARM1 knockout or (C) CARM1-low OVCAR3 cells with or without ectopic CARM1 expression and treated with or without 10 mM GSK126 for 72 h as determined by the percentage of EGFP cells in the dual NHEJ and HR reporter assay. (D and E) A1847 cells were infected with a lentivirus encoding shRNA targeting the 30 untranslated region (UTR) of the BAF155 gene together with a retrovirus encoding a wild-type BAF155 or a BAF155 R1064K mutant. Drug-selected cells were examined for (D) NHEJ and (E) HR activity in the dual NHEJ and HR reporter assay as determined by percentages of EGFP or mCherry-positive cells. (F) EZH2 inhibitor GSK126 increases DNA end protection as determined by DNA combing assay. Schematics of the assay are shown in the top, and representative fibers from each of the indicated conditions are shown in the inserted images. The CIdU/IdU ratio was quantified as a surrogate for DNA end protection (n = 100 cells). Scale bar, 5 mm. Data represent mean ± SEM. n = 3 independent experiments unless otherwise stated. p values were calculated using a two-tailed t test. See also Figure S3.

EZH2 inhibitor (Figures 4B and 4C). To directly determine the role of MAD2L2 in the observed sensitization of PARP inhibitor by EZH2 inhibitor, we knocked down MAD2L2 in EZH2 inhibitor GSK126treated cells (Figure 4D). MAD2L2 knockdown significantly decreased NHEJ activity induced by GSK126, without affecting HR activity (Figures 4E and 4F). Indeed, MAD2L2 knockdown significantly reversed the decrease in olaparib IC50 and apoptosis induced by EZH2 inhibitor (Figures 4G and 4H). Together, we

conclude that MAD2L2 upregulation and the associated increase in NHEJ activity play a major role in the observed sensitization to PARP inhibitor by EZH2 inhibitor in CARM1-high cells. EZH2 and PARP Inhibitor Combination Causes Chromosomal Abnormalities and Mitotic Catastrophe NHEJ repair is error-prone, which may lead to genomic instability and cell death (Ceccaldi et al., 2016). We determined Cancer Cell 37, 1–11, February 10, 2020 5

Please cite this article in press as: Karakashev et al., EZH2 Inhibition Sensitizes CARM1-High, Homologous Recombination Proficient Ovarian Cancers to PARP Inhibition, Cancer Cell (2019), https://doi.org/10.1016/j.ccell.2019.12.015

Figure 4. Sensitization to PARP Inhibitor by EZH2 Inhibitor Is NHEJ and MAD2L2 Dependent (A–C) CARM1-high A1847 cells expressing shKU70 or shControl were (A) validated for KU70 knockdown by immunoblot, (B) examined for olaparib doseresponse curves with or without 2.5 mM GSK126, or (C) quantified for apoptosis by Annexin V staining in cells treated with vehicle control, 0.4 mM olaparib, 2.5 mM GSK126, or a combination for 72 h. Red dashed line indicates 50% of growth inhibition. (D–H) A1847 cells expressing the indicated shMAD2L2s or shControl and treated with or without GSK126 were (D) validated for MAD2L2 knockdown by immunoblot, examined for (E) NHEJ or (F) HR activities, (G) examined for olaparib dose-response curves with or without 2.5 mM GSK126, or (H) quantified for apoptosis by Annexin V staining in cells treated with vehicle control, 0.4 mM olaparib, 2.5 mM GSK126, or a combination for 72 h. Data represent mean ± SEM. n = 3 independent experiments unless otherwise stated. p values were calculated using a two-tailed t test.

that there was a significant increase in chromosomal abnormalities based on chromosome spread of metaphase cells in GSK126 and olaparib combination-treated CARM1-high cells compared with either treatment alone (Figures 5A and 5B). In contrast, the combination did not significantly increase chromosomal abnormalities in CARM1 knockout cells (Figures 5A and 5B). To determine whether the observed chromosomal abnormalities contribute to the observed apoptosis induction by GSK126 and olaparib, we performed live-cell imaging. Consistently, compared with either GSK126 or olaparib-treated cells, the combination induced mitotic catastrophe in CARM1high cells (Figure 5C and Videos S1, S2, S3, and S4). In 6 Cancer Cell 37, 1–11, February 10, 2020

contrast, the combination failed to induce mitotic catastrophe in CARM1 knockout cells (Figure 5D and Videos S5, S6, S7, and S8). We conclude that EZH2 and PARP inhibitor combination induces chromosomal abnormalities and ultimately mitotic catastrophe in a CARM1-dependent manner. EZH2 and PARP Inhibitors Are Synergistic in Suppressing the Growth of CARM1-High, but Not CARM1-Low Tumors In Vivo in Both Orthotopic and Patient-Derived Xenograft Models To determine whether EZH2 inhibitor sensitizes CARM1-high EOCs to PARP inhibitors in vivo, we utilized three different

Please cite this article in press as: Karakashev et al., EZH2 Inhibition Sensitizes CARM1-High, Homologous Recombination Proficient Ovarian Cancers to PARP Inhibition, Cancer Cell (2019), https://doi.org/10.1016/j.ccell.2019.12.015

Figure 5. Sensitization to PARP Inhibitor by EZH2 Inhibitor Correlates with an Increase in Chromosomal Abnormalities and Mitotic Catastrophe (A and B) Parental control and CARM1 knockout A1847 cells were treated with vehicle control, 0.4 mM olaparib, 2.5 mM GSK126, or a combination for 72 h. The treated cells were (A) subjected to metaphase chromosome spread, and (B) chromosomal abnormalities were quantified for the indicated groups (n = 20 metaphase spreads). Arrows point to examples of chromosomes with missing arms or fusion chromosomes. Scale bar, 10 mm. (C and D) (C) Parental control and (D) CARM1 knockout A1847 cells treated with vehicle control, 0.4 mM olaparib, 2.5 mM GSK126, or a combination for 72 h were subjected to time-lapse video microscopic analysis for mitosis. Cell nuclei were visualized by staining for DNA using siR-DNA. Scale bar, 10 mm. Time is expressed as minutes:seconds. Data represent mean ± SEM. p values were calculated using a two-tailed t test. See also Videos S1, S2, S3, S4, S5, S6, S7, and S8.

xenograft models. In the orthotopic model, the tumors established by CARM1-high A1847 cells in mouse bursa that covers mouse ovary were treated with vehicle, olaparib, GSK126, or a combination of olaparib and GSK126 (Figures 6A and 6B). Consistent with HR proficiency in CARM1-high EOCs, olaparib alone did not affect the growth of the CARM1-high tumors (Figures 6A and 6B). However, the combination was significantly more effective in suppressing the growth of the orthotopic CARM1-high tumors compared with GSK126 alone (Figures 6A and 6B). Similar observations were also made in subcutaneous xenograft models (Figure S4A). This correlated with a significant improvement of survival of mice bearing CARM1-high tumors in the combination treatment group compared with the GSK126-alone treatment group (Figure 6C). As a control, the GSK126 and olaparib combination treatment did not significantly suppress the growth of tumors established by CARM1 knockout A1847 cells (Figure S4B). Significantly, similar synergistic effects between EZH2 inhibitor GSK126 and PARP inhibitor olaparib were also observed in two CARM1-high, but not two CARM1-low, HGSOC patientderived xenograft (PDX) models (Figures 6D–6H and S4C– S4F). Notably, the combination treatment did not significantly decrease the body weight of the treated mice, indicating that

the combination of EZH2 and PARP inhibitors was not toxic (Figure S4G). Consistently, gross organ morphology and histological analyses of kidney, lung, and liver harvested at the end of the experiment from combination-treated mice revealed no abnormalities, suggesting that the combination treatment was well tolerated (Figures S4H and S4I). Together, we conclude that EZH2 inhibitor sensitizes CARM1-high, but not CARM1low, tumors to PARP inhibitor in orthotopic and patient-derived ovarian cancer xenograft models. We next sought to correlate the tumor suppressive effects observed in vivo with the molecular mechanism we have characterized in vitro. Indeed, MAD2L2 expression was increased by GSK126 treatment in CARM1-high tumors (Figures 6I and S4J), which correlated with a decrease in H3K27me3 levels (Figures 6J, 6K, S4K, and S4L). In addition, the apoptosis marker cleaved caspase 3 was higher, while the proliferation marker Ki67 was lower, in the combination treatment group compared with GSK126-alone treatment group (Figures 6J, 6K, S4K, and S4L). Indeed, chromosomal abnormalities in GSK126 and olaparib combination-treated CARM1-high PDX, but not CARM1-low PDX, were significantly increased when compared with either treatment alone (Figures 6L and 6M). Together, these data support the notion that EZH2 inhibitor Cancer Cell 37, 1–11, February 10, 2020 7

Please cite this article in press as: Karakashev et al., EZH2 Inhibition Sensitizes CARM1-High, Homologous Recombination Proficient Ovarian Cancers to PARP Inhibition, Cancer Cell (2019), https://doi.org/10.1016/j.ccell.2019.12.015

Figure 6. EZH2 Inhibitor Sensitizes CARM1-High Tumors to PARP Inhibitor In Vivo (A and B) CARM1-high A1847 cells were unilaterally injected into the ovarian bursa sac of immunocompromised mice (n = 5 mice per group). Randomized mice were treated with vehicle control, olaparib (50 mg per kg daily intraperitoneally [i.p.]), GSK126 (25 mg per kg daily by i.p.), or a combination for an additional 3 weeks. At the end of treatment, the mice were euthanized. (A) Reproductive tracts with tumors from the indicated treatment groups were dissected and (B) tumor volumes were measured as a surrogate for tumor burden. ANOVA with post hoc multiple comparisons statistical analysis revealed that the combination is synergistic (p = 0.028). (C) Kaplan-Meier survival curves for the indicated groups. p value was calculated by log rank test. (D) Expression of CARM1 and a loading control b-actin in the indicated CARM1-high and CARM1-low HGSOC PDXs was determined by immunoblot. A1847 and OVCAR3 were used as CARM1-high and CARM1-low controls, respectively. (E–H) Mice with the indicated orthotopic (E and F) CARM1-high and (G and H) CARM-low PDXs were randomized into four different treatment groups and treated with vehicle control, olaparib (50 mg per kg daily by i.p.), GSK126 (25 mg per kg daily by i.p.), or a combination. Tumor weight was measured as a surrogate for tumor burden at the end of the treatment. ANOVA with post hoc multiple comparisons statistical analysis revealed that the combination is synergistic in CARM1high (p = 0.006), but not CARM1-low (p = 0.394), PDXs. (I–K) Tumors dissected from CARM1-high PDX #1 with the indicated treatments were (I) examined for MAD2L2 mRNA expression by qRT-PCR, or (J) subjected to immunological staining for apoptosis marker cleaved caspase 3, cell proliferation marker Ki67, or H3K27Me3 on serial sections, and (K) the histological score (legend continued on next page)

8 Cancer Cell 37, 1–11, February 10, 2020

Please cite this article in press as: Karakashev et al., EZH2 Inhibition Sensitizes CARM1-High, Homologous Recombination Proficient Ovarian Cancers to PARP Inhibition, Cancer Cell (2019), https://doi.org/10.1016/j.ccell.2019.12.015

sensitizes EOCs to PARP inhibitor in vivo in a CARM1-dependent manner, which correlates with upregulation of MAD2L2 and the associated induction of apoptosis and suppression of cell proliferation. DISCUSSION Here we report that selectively increasing NHEJ activity by upregulating the expression of shieldin complex components, such as MAD2L2, represents a therapeutic strategy to sensitize HR-proficient tumors to PARP inhibitors. Our study demonstrated that MAD2L2 and NHEJ play a major role in mediating the observed synergy between EZH2 and PARP inhibitors in CARM1-high cells because inhibition of either MAD2L2 or NHEJ activity significantly reversed the synergistic effects. However, a limitation of our study is that we cannot formally exclude the possibility that other mechanisms may also directly or indirectly contribute to the synergy. Regardless, this dataset demonstrates that regulating the choice between NHEJ and HR through altering the shieldin complex can be explored for sensitizing HR-proficient cells to PARP inhibitors. These findings indicate that a combination of EZH2 and PARP inhibitors represents a precision treatment strategy for CARM1-high cancers. In contrast, although CARM1 inhibition or knockout upregulates MAD2L2 and increases NHEJ activity, this was accompanied by an increase in HR activity. Consequently, CARM1 inhibition failed to sensitize CARM1-high cells to PARP inhibitors. Thus, when combined with PARP inhibitors, EZH2 inhibitors are clearly advantageous compared with CARM1 inhibitors. Notably, upregulation of MAD2L2 by EZH2 inhibition is CARM1 dependent. Indeed, in CARM1-low cells, EZH2 inhibition does not significantly increase MAD2L2 expression and NHEJ activity. Interestingly, loss of EZH2 function promotes PARP inhibitor resistance in BRCA2-deficient cells (Rondinelli et al., 2017). Thus, genetic context should be taken into consideration for the EZH2 and PARP inhibitor combination. Notably, although BRCA1 promoter is methylated in A1847 cells, the IC50 to PARP inhibitor olaparib in A1847 cells is comparable to those of BRCA1/2 wild-type cell lines without BRCA1 promoter methylation (Stordal et al., 2013). Consistently, our data show that A1847 cells are not sensitive to olaparib. PARP inhibitors demonstrate substantial clinical benefits in HR-deficient cancers such as BRCA1/2-mutated HGSOCs (Konstantinopoulos et al., 2015; Moore et al., 2018). Extending the efficacy of PARP inhibitors to HR-proficient HGSOCs is a critical unmet clinical need. CARM1 amplification/overexpression occurs in
20% of HGSOCs that are typically HR-proficient (Karakashev et al., 2018). In addition, although CARM1 amplification/overexpression is often mutually exclusive with BRCA1/ 2 mutations, CARM1 upregulation can also occur in cells that have acquired HR proficiency, one of the most common resistance mechanisms to PARP inhibitors (Konstantinopoulos

et al., 2015). For example, the PEO1 cell line is BRCA2 deficient and sensitive to PARP inhibitors, whereas PEO4 is derived from ascites of the same patients at the time of relapse with platinum resistance with proficient BRCA2 and HR due to a secondary mutation (Sakai et al., 2009). PEO1 is CARM1-low (Karakashev et al., 2018), whereas PEO4 is CARM1-high, and PEO4 is sensitive to EZH2 and PARP inhibitor combination. These findings suggest that the EZH2 and PARP inhibitor combination may be effective in overcoming PARP inhibitor resistance caused by acquired HR proficiency. Notably, CARM1 is often amplified or overexpressed in a number of major cancer types (El Messaoudi et al., 2006; Hong et al., 2004; Kim et al., 2010). Thus, our discovery will have far-reaching implications for expanding the clinical utility of PARP inhibitors. STAR+METHODS Detailed methods are provided in the online version of this paper and include the following: d d d

d

d d

KEY RESOURCES TABLE LEAD CONTACT AND MATERIALS AVAILABILITY EXPERIMENTAL MODEL AND SUBJECT DETAILS B Cell Lines B Mice METHOD DETAILS B Immunoblotting B CRISPR-Mediated CARM1 Knockout B Tet-Inducible shEZH2 Knockdown B Lentivirus Infection B Reverse-Transcriptase Quantitative PCR (RT-qPCR) B Annexin V Staining B Colony Formation Assay B Chromatin Immunoprecipitation (ChIP), and Cut and Run ChIP Analysis B Cell-Cycle Analysis B Metaphase Spread B Dual HR and NHEJ Reporter Assay B DNA Combing Assay B Xenograft Ovarian Cancer Models B Immunohistochemical (IHC) Staining QUANTIFICATION AND STATISTICAL ANALYSIS DATA AND CODE AVAILABILITY

SUPPLEMENTAL INFORMATION Supplemental Information can be found online at https://doi.org/10.1016/j. ccell.2019.12.015. ACKNOWLEDGMENTS This work was supported by US National Institutes of Health grants (R01CA160331, R01CA163377, R01CA202919, and R01CA239128 to R.Z.;

(H score) of the indicated markers was quantified from three separate fields from five tumors from five individual mice in each of the indicated treatment groups. Scale bar, 50 mm. (L and M) Cells isolated from fresh CARM1-high or -low PDXs post the indicated treatments were (L) subjected to metaphase chromosome spread, and (M) chromosomal abnormalities were quantified for the indicated groups (n >20 metaphase spreads). Arrows point to examples of chromosomes with missing arms or fusion chromosomes. Scale bar, 10 mm. Data represent mean ± SEM. p values were calculated using a two-tailed t test unless otherwise stated. See also Figure S4.

Cancer Cell 37, 1–11, February 10, 2020 9

Please cite this article in press as: Karakashev et al., EZH2 Inhibition Sensitizes CARM1-High, Homologous Recombination Proficient Ovarian Cancers to PARP Inhibition, Cancer Cell (2019), https://doi.org/10.1016/j.ccell.2019.12.015

P50CA228991 to R.Z.; and R50CA211199 to A.V.K.), US Department of Defense (OC150446 and OC180109 to R.Z.), The Honorable Tina Brozman Foundation for Ovarian Cancer Research (to R.Z.) and Ovarian Cancer Research Alliance (Collaborative Research Development Grant to R.Z., and Ann and Sol Schreiber Mentored Investigator Award to S.W. and J.L.). S.K. is supported by an AACR-AstraZeneca ovarian cancer research fellowship. Support of Core Facilities was provided by Cancer Centre Support Grant (CCSG) CA010815 to The Wistar Institute. AUTHOR CONTRIBUTIONS S.K., T.F., B.Z., J.L., S.W., N.F., P.-H.P., G.S., A.V.K., and Q.L. performed the experiments and analyzed data. S.J., M.G.C., and M.E.B. contributed key experimental reagents. S.K. and R.Z. designed the experiments and wrote the paper. R.Z. conceived the study. DECLARATION OF INTERESTS S.K. and R.Z. are co-inventors on a patent application covering the use of EZH2 inhibitors in CARM1-expressing cancers. All other authors declare no competing interests. Received: January 28, 2019 Revised: October 23, 2019 Accepted: December 30, 2019 Published: January 30, 2020 REFERENCES Aird, K.M., Zhang, G., Li, H., Tu, Z., Bitler, B.G., Garipov, A., Wu, H., Wei, Z., Wagner, S.N., Herlyn, M., and Zhang, R. (2013). Suppression of nucleotide metabolism underlies the establishment and maintenance of oncogeneinduced senescence. Cell Rep. 3, 1252–1265. Arnoult, N., Correia, A., Ma, J., Merlo, A., Garcia-Gomez, S., Maric, M., Tognetti, M., Benner, C.W., Boulton, S.J., Saghatelian, A., and Karlseder, J. (2017). Regulation of DNA repair pathway choice in S and G2 phases by the NHEJ inhibitor CYREN. Nature 549, 548–552. Boersma, V., Moatti, N., Segura-Bayona, S., Peuscher, M.H., van der Torre, J., Wevers, B.A., Orthwein, A., Durocher, D., and Jacobs, J.J.L. (2015). MAD2L2 controls DNA repair at telomeres and DNA breaks by inhibiting 5’ end resection. Nature 521, 537–540. Cao, R., and Zhang, Y. (2004). The functions of E(Z)/EZH2-mediated methylation of lysine 27 in histone H3. Curr. Opin. Genet. Dev. 14, 155–164. Ceccaldi, R., Rondinelli, B., and D’Andrea, A.D. (2016). Repair pathway choices and consequences at the double-strand break. Trends Cell Biol. 26, 52–64. Dev, H., Chiang, T.W., Lescale, C., de Krijger, I., Martin, A.G., Pilger, D., Coates, J., Sczaniecka-Clift, M., Wei, W., Ostermaier, M., et al. (2018). Shieldin complex promotes DNA end-joining and counters homologous recombination in BRCA1-null cells. Nat. Cell Biol. 20, 954–965. Drew, A.E., Moradei, O., Jacques, S.L., Rioux, N., Boriack-Sjodin, A.P., Allain, C., Scott, M.P., Jin, L., Raimondi, A., Handler, J.L., et al. (2017). Identification of a CARM1 inhibitor with potent in vitro and in vivo activity in preclinical models of multiple myeloma. Sci. Rep. 7, 17993. El Messaoudi, S., Fabbrizio, E., Rodriguez, C., Chuchana, P., Fauquier, L., Cheng, D., Theillet, C., Vandel, L., Bedford, M.T., and Sardet, C. (2006). Coactivator-associated arginine methyltransferase 1 (CARM1) is a positive regulator of the Cyclin E1 gene. Proc. Natl. Acad. Sci. U S A 103, 13351–13356. Ghezraoui, H., Oliveira, C., Becker, J.R., Bilham, K., Moralli, D., Anzilotti, C., Fischer, R., Deobagkar-Lele, M., Sanchiz-Calvo, M., Fueyo-Marcos, E., et al. (2018). 53BP1 cooperation with the REV7-shieldin complex underpins DNA structure-specific NHEJ. Nature 560, 122–127. Gupta, R., Somyajit, K., Narita, T., Maskey, E., Stanlie, A., Kremer, M., Typas, D., Lammers, M., Mailand, N., Nussenzweig, A., et al. (2018). DNA repair network analysis reveals shieldin as a key regulator of NHEJ and PARP inhibitor sensitivity. Cell 173, 972–988.e23.

10 Cancer Cell 37, 1–11, February 10, 2020

Hohmann, A.F., and Vakoc, C.R. (2014). A rationale to target the SWI/SNF complex for cancer therapy. Trends Genet. 30, 356–363. Hong, H., Kao, C., Jeng, M.H., Eble, J.N., Koch, M.O., Gardner, T.A., Zhang, S., Li, L., Pan, C.X., Hu, Z., et al. (2004). Aberrant expression of CARM1, a transcriptional coactivator of androgen receptor, in the development of prostate carcinoma and androgen-independent status. Cancer 101, 83–89. Karakashev, S., Zhu, H., Wu, S., Yokoyama, Y., Bitler, B.G., Park, P.H., Lee, J.H., Kossenkov, A.V., Gaonkar, K.S., Yan, H., et al. (2018). CARM1-expressing ovarian cancer depends on the histone methyltransferase EZH2 activity. Nat. Commun. 9, 631. Kim, Y.R., Lee, B.K., Park, R.Y., Nguyen, N.T., Bae, J.A., Kwon, D.D., and Jung, C. (2010). Differential CARM1 expression in prostate and colorectal cancers. BMC Cancer 10, 197. Konstantinopoulos, P.A., Ceccaldi, R., Shapiro, G.I., and D’Andrea, A.D. (2015). Homologous recombination deficiency: exploiting the fundamental vulnerability of ovarian cancer. Cancer Discov. 5, 1137–1154. Kuntz, K.W., Campbell, J.E., Keilhack, H., Pollock, R.M., Knutson, S.K., Porter-Scott, M., Richon, V.M., Sneeringer, C.J., Wigle, T.J., Allain, C.J., et al. (2016). The importance of being me: magic methyls, methyltransferase inhibitors, and the discovery of Tazemetostat. J. Med. Chem. 59, 1556–1564. Lord, C.J., and Ashworth, A. (2017). PARP inhibitors: synthetic lethality in the clinic. Science 355, 1152–1158. McCabe, M.T., Ott, H.M., Ganji, G., Korenchuk, S., Thompson, C., Van Aller, G.S., Liu, Y., Graves, A.P., Della Pietra, A., 3rd, Diaz, E., et al. (2012). EZH2 inhibition as a therapeutic strategy for lymphoma with EZH2-activating mutations. Nature 492, 108–112. Mok, S.C., Bonome, T., Vathipadiekal, V., Bell, A., Johnson, M.E., Wong, K.K., Park, D.C., Hao, K., Yip, D.K., Donninger, H., et al. (2009). A gene signature predictive for outcome in advanced ovarian cancer identifies a survival factor: microfibril-associated glycoprotein 2. Cancer Cell 16, 521–532. Moore, K., Colombo, N., Scambia, G., Kim, B.G., Oaknin, A., Friedlander, M., Lisyanskaya, A., Floquet, A., Leary, A., Sonke, G.S., et al. (2018). Maintenance olaparib in patients with newly diagnosed advanced ovarian cancer. N. Engl. J. Med. 379, 2495–2505. Noordermeer, S.M., Adam, S., Setiaputra, D., Barazas, M., Pettitt, S.J., Ling, A.K., Olivieri, M., Alvarez-Quilon, A., Moatti, N., Zimmermann, M., et al. (2018). The shieldin complex mediates 53BP1-dependent DNA repair. Nature 560, 117–121. Rondinelli, B., Gogola, E., Yucel, H., Duarte, A.A., van de Ven, M., van der Sluijs, R., Konstantinopoulos, P.A., Jonkers, J., Ceccaldi, R., Rottenberg, S., and D’Andrea, A.D. (2017). EZH2 promotes degradation of stalled replication forks by recruiting MUS81 through histone H3 trimethylation. Nat. Cell Biol. 19, 1371–1378. Rothkamm, K., Kruger, I., Thompson, L.H., and Lobrich, M. (2003). Pathways of DNA double-strand break repair during the mammalian cell cycle. Mol. Cell. Biol. 23, 5706–5715. Sakai, W., Swisher, E.M., Jacquemont, C., Chandramohan, K.V., Couch, F.J., Langdon, S.P., Wurz, K., Higgins, J., Villegas, E., and Taniguchi, T. (2009). Functional restoration of BRCA2 protein by secondary BRCA2 mutations in BRCA2-mutated ovarian carcinoma. Cancer Res. 69, 6381–6386. Skene, P.J., and Henikoff, S. (2017). An efficient targeted nuclease strategy for high-resolution mapping of DNA binding sites. Elife 6, https://doi.org/10.7554/ eLife.21856. Stordal, B., Timms, K., Farrelly, A., Gallagher, D., Busschots, S., Renaud, M., Thery, J., Williams, D., Potter, J., Tran, T., et al. (2013). BRCA1/2 mutation analysis in 41 ovarian cell lines reveals only one functionally deleterious BRCA1 mutation. Mol. Oncol. 7, 567–579. Tomida, J., Takata, K.I., Bhetawal, S., Person, M.D., Chao, H.P., Tang, D.G., and Wood, R.D. (2018). FAM35A associates with REV7 and modulates DNA

Please cite this article in press as: Karakashev et al., EZH2 Inhibition Sensitizes CARM1-High, Homologous Recombination Proficient Ovarian Cancers to PARP Inhibition, Cancer Cell (2019), https://doi.org/10.1016/j.ccell.2019.12.015

damage responses of normal and BRCA1-defective cells. EMBO J. 37, https:// doi.org/10.15252/embj.201899543. Wang, L., Zhao, Z., Meyer, M.B., Saha, S., Yu, M., Guo, A., Wisinski, K.B., Huang, W., Cai, W., Pike, J.W., et al. (2014). CARM1 methylates chromatin remodeling factor BAF155 to enhance tumor progression and metastasis. Cancer Cell 25, 21–36. Wilson, B.G., and Roberts, C.W. (2011). SWI/SNF nucleosome remodellers and cancer. Nat. Rev. Cancer 11, 481–492.

Wu, J., and Xu, W. (2012). Histone H3R17me2a mark recruits human RNA polymerase-associated factor 1 complex to activate transcription. Proc. Natl. Acad. Sci. U S A 109, 5675–5680. Xu, G., Chapman, J.R., Brandsma, I., Yuan, J., Mistrik, M., Bouwman, P., Bartkova, J., Gogola, E., Warmerdam, D., Barazas, M., et al. (2015). REV7 counteracts DNA double-strand break resection and affects PARP inhibition. Nature 521, 541–544.

Cancer Cell 37, 1–11, February 10, 2020 11

Please cite this article in press as: Karakashev et al., EZH2 Inhibition Sensitizes CARM1-High, Homologous Recombination Proficient Ovarian Cancers to PARP Inhibition, Cancer Cell (2019), https://doi.org/10.1016/j.ccell.2019.12.015

STAR+METHODS KEY RESOURCES TABLE

REAGENT or RESOURCE

SOURCE

IDENTIFIER

Antibodies mouse anti-CARM1

Cell Signaling

Cat#12495; RRID:AB_2797935

goat anti-BAF155

Santa Cruz

Cat#SC9746; RRID:AB_671099

rabbit anti-methylated R1064 BAF155

Millipore

Cat#ABE1339; RRID:AB_2731994

rabbit anti-EZH2

Cell Signaling

Cat#5246; RRID:AB_10694683

rabbit anti-cleaved PARP p85

Promega

Cat#G7341; RRID:AB_430876

mouse anti-Ki67

Cell Signaling

Cat#9449; RRID:AB_2715512

rabbit anti-cleaved caspase 3

Cell Signaling

Cat#9661; RRID:AB_2341188

rabbit anti-H3K27Me3

Cell Signaling

Cat#9733; RRID:AB_2616029

mouse anti-b-actin

Sigma

Cat#A1978; RRID:AB_476692

rabbit anti-KU70

Abcam

Cat#ab83501; RRID:AB_10564007

rabbit anti-MAD2L2

Abcam

Cat#ab115622; RRID:AB_10901285

mouse anti-BRG1

Santa Cruz

Cat#sc-17796; RRID:AB_626762

rabbit anti-SNF5

Bethyl

Cat#A301-087A; RRID:AB_2191714

rabbit anti-BAF155

Cell Signaling

Cat#11956; RRID:AB_2797776

AlexaFluor cy3-conjugated goat anti-rat secondary antibody

Thermo

Cat#A10522; RRID:AB_2534031

mouse anti-IdU monoclonal antibody

BD

Cat#347580; RRID:AB_10015219

mouse anti-IdU monoclonal antibody

BD

Cat#347580; RRID:AB_10015219

DH5a competent E. coli

Thermo Fisher

Cat#18265017

Stbl3 competent E. coli

Thermo Fisher

Cat#C737303

Bacterial and Virus Strains

Chemicals, Peptides, and Recombinant Proteins Lipofectamine 2000

Thermo Fisher

Cat#11668019

DNase I

Sigma

Cat#4536282001

RNase A

Thermo Fisher

Cat#EN0531

Proteinase K

Thermo Fisher

Cat#AM2544

Dynabeads protein A

Thermo Fisher

Cat#10002D

Dynabeads protein G

Thermo Fisher

Cat#10004D

TRizol

Thermo Fisher

Cat#15596026

MboI

New England Biolabs

Cat#R0147L

DNA Polymerase I, large Fragment

New England Biolabs

Cat#M0210

T4 DNA ligase

New England Biolabs

Cat#M0202

T4 DNA polymerase I

New England Biolabs

Cat#M0203

DNA quick ligase

New England Biolabs

Cat#M2200

MNase

Cell Signaling

Cat#10011S

BsmBI

Fermentas

Cat#ER0452

EcoR1

NEB

Cat#R0101S

AgeI

NEB

Cat#R0552S

GSK126

Xcess Biosciences

Cat#A-1275

GSK126

Xcess Biosciences

Cat#M60071

Cisplatin

Selleckchem

Cat#S1166

Olaparib

Selleckchem

Cat#S1060

Olaparib

L C Laboratories

Cat#O-9201 (Continued on next page)

e1 Cancer Cell 37, 1–11.e1–e6, February 10, 2020

Please cite this article in press as: Karakashev et al., EZH2 Inhibition Sensitizes CARM1-High, Homologous Recombination Proficient Ovarian Cancers to PARP Inhibition, Cancer Cell (2019), https://doi.org/10.1016/j.ccell.2019.12.015

Continued REAGENT or RESOURCE

SOURCE

IDENTIFIER

Rucaparib

Selleckchem

Cat# S1098

Tazemetostat

Selleckchem

Cat#S7128

ZM2302

Probechem

Cat#PC-61030

Doxycyclin

Sigma

D9891

Xylene

Fisher Scientific

Cat#1330-20-7

IdU

Sigma

Cat#I7125

CldU

Sigma

Cat#C6891

Hydroxyurea

Sigma

SigmaCat#H8627

Citrate buffer

Thermo Fisher

Cat#005000

Mayer’s Hematoxylin

Dako

Cat#3309S

Propidium iodide

Sigma

Cat#p4170

LookOut Mycoplasma PCR detection

Sigma

Cat#MP0035

Lenti-Pac HIV Expression Packaging Kit

Genecopoeia

Cat#LT001

ViraPower Lentiviral Packaging Mix

Thermo Fisher

Cat#K497500

Critical Commercial Assays

Annexin V FITC and PI kit

Thermo Fisher

Cat#V13242

Dako EnVision+ system

Dako

Cat#K4011

AmpFLSTR Identifiler PCR Amplification kit

Life Technologies

Cat#4322288

RNA-seq data

Karakashev et al., 2018

GSE95645

ChIP-seq data

Karakashev et al., 2018

GSE95645

Deposited Data

Experimental Models: Cell Lines Phoenix cells

Dr. G. Nolan, Stanford University, USA

N/A

A1847

Dr. A. Godwin, Fox chase Cancer Center, currently at University of Kansas Cancer Center

N/A

OVCAR3

ATCC

HTB-161

OVCAR5

Dr. T. Hamilton, Fox Chase Cancer Center

N/A

OVCAR10

Dr. A. Godwin, Fox chase Cancer Center, currently at University of Kansas Cancer Center

N/A

CAOV3

ATCC

HTB-75

PEO4

Sigma

10032308-1VL

CARM1-high PDX #1

Helen F. Graham Cancer Center at Christiana Care Health System

N/A

CARM1-low PDX #1

Helen F. Graham Cancer Center at Christiana Care Health System

N/A

CARM1-high PDX #2

Dr. J. Conejo-Garcia, Moffitt Cancer Center

N/A

CARM1-low PDX #2

Dr. J. Conejo-Garcia, Moffitt Cancer Center

N/A

Experimental Models and Subject Details

Oligonucleotides 50 - ACCGCCCAGTGGAGAAATTC -30 (MAD2L2 forward)

This paper

N/A

50 -CATCGCACACGCTGATCTT-30 (MAD2L2 reverse)

This paper

N/A

50 - CCGCTGCTGGGAATAACAGA-30 (APLF forward)

This paper

N/A

50 - GCTTCAATGGTAAGAGCTGACT-30 (APLF reverse)

This paper

N/A

50 - AGCCGGTCCAGTACACCTTT-30 (LINP1 forward)

This paper

N/A

50 - GGAAAGCACCGTCTGTTGTT -30 (LINP1 reverse)

This paper

N/A

50 - GAGGCTGGAAGTGAGGATG-30 (MAD2L2 forward)

This paper

N/A

50 - GAGTGTCAGAGCGTGGAAA-30 (MAD2L2 reverse)

This paper

N/A (Continued on next page)

Cancer Cell 37, 1–11.e1–e6, February 10, 2020 e2

Please cite this article in press as: Karakashev et al., EZH2 Inhibition Sensitizes CARM1-High, Homologous Recombination Proficient Ovarian Cancers to PARP Inhibition, Cancer Cell (2019), https://doi.org/10.1016/j.ccell.2019.12.015

Continued REAGENT or RESOURCE

SOURCE

IDENTIFIER

50 - CATGCAGTGAGGTTTCCATAAAG-30 (APLF forward)

This paper

N/A

50 - TTCAGTCAGCTGGACATTCG-30 (APLF reverse)

This paper

N/A

50 - TGCTTGGCTCACAATATCTCTC-30 (LINP1 forward)

This paper

N/A

50 - TCTTCATGAATCCCAGCTGTC-30 (LINP1 reverse)

This paper

N/A

pLentiCRISPR-CARM1

Karakashev et al., 2018

N/A

pLentiCRISPR v2

Addgene

Cat#52961

tet-pLKO-puro

Addgene

Cat#21915

pLKO.1-shKU70 1

Molecular Screening Facility (Wistar)

TRCN0000039610

tet-pLKO-on -shEZH2

Cloning, this paper

N/A

pLKO.1-shKU70 2

Molecular Screening Facility (Wistar)

TRCN0000039612

pLKO.1-shMAD2L2 1

Molecular Screening Facility (Wistar)

TRCN0000006570

pLKO.1-shMAD2L2 2

Molecular Screening Facility (Wistar)

TRCN0000006573

pLKO.1-shBAF155

Molecular Screening Facility (Wistar)

TRCN0000015628

pLenti-CARM1

Genecopoeia

Cat#EX-Y3476-Lv105-B

pCBA I-SceI plasmid

Addgene

Cat#26477

pLCN-DRR plasmid

Addgene

Cat#98895

pCAGGS-DRR-mCherry-Donor-EF1a-BFP

Addgene

Cat#98896

Recombinant DNA

Software and Algorithms Leica LAS-X 3.3 software

Leica

N/A

ImageJ Software

NIH

N/A

Ingenuity Pathway Analysis software

Qiagen

N/A

FlowJo version 7

FlowJo, LLC

N/A

GraphPad Prism 7 software

GraphPad

N/A

LEAD CONTACT AND MATERIALS AVAILABILITY Further information and requests for resources and reagents should be directed to and will be fulfilled by the Lead Contact, Rugang Zhang ([email protected]). EXPERIMENTAL MODEL AND SUBJECT DETAILS Cell Lines Human EOC cell lines were obtained from indicated sources as detailed in Key Resources Table and were re-authenticated by The Wistar Institute’s Genomics Facility using short tandem repeat profiling using AmpFLSTR Identifiler PCR Amplification kit (Life Technologies). A1847, OVCAR3, OVCAR5, OVCAR10, CAOV3, and PEO4 cells were cultured in RPMI1640 supplemented with 10% fetal bovine serum (FBS) and 1% penicillin/streptomycin at 37 C supplied with 5% CO2. Mycoplasma testing was performed monthly by LookOut Mycoplasma PCR detection (Sigma). Mice The protocols were approved by the Wistar Institutional Animal Care and Use Committee (IACUC). Mice are housed in solid bottom, single use ventilated or static cages. Cage bottoms and bedding are changed every two weeks for ventilated cages, and weekly for static. Lids and feeders are changed every 4 weeks. Animal quarters are serviced by individual animal caretakers who are trained to recognize the symptoms characteristic of sick animals. Each day the caretakers initial a checklist posted in each room indicating that observations were made. Temperature and humidity are monitored and documented. Staff monitors for and documents any animal welfare conditions and removes any dead animals if observed and notifies research staff and facility management. If an animal welfare condition is observed both the veterinarian and animal facility director or supervisor are notified. Animals are treated if there are open veterinary cases including weekends and holidays. For in vivo experiments, the sample size of at least 5 mice per group was determined on the basis of the data shown from in vitro experiments. 6-8-week old female immunocompromised NSG mice from Wistar Institute Animal Facility were used for all in vivo experiments.

e3 Cancer Cell 37, 1–11.e1–e6, February 10, 2020

Please cite this article in press as: Karakashev et al., EZH2 Inhibition Sensitizes CARM1-High, Homologous Recombination Proficient Ovarian Cancers to PARP Inhibition, Cancer Cell (2019), https://doi.org/10.1016/j.ccell.2019.12.015

METHOD DETAILS Immunoblotting Protein was extracted with RIPA buffer (150 mM NaCl, 1% NP40, 0.5% sodium deoxycholate, 0.1% SDS, 50 mM Tris pH 8.0 and 1 mM phenylmethylsulfonyl fluoride). Protein was separated by SDS–PAGE gel and transferred to a PVDF membrane. Membranes were blocked with 5% non-fat milk and then incubated with primary antibodies and secondary antibodies. CRISPR-Mediated CARM1 Knockout pLentiCRISPR-CARM1 was constructed by inserting the CARM1 guide RNA (gRNA; 50 -AGCACGGAAAATCTACGCGG-30 ). pLentiCRISPR v2 (Addgene) was digested and dephosphorylated with BsmBI restriction enzyme (Fermentas) for 30 min at 37 C. The digested plasmid was run on a 1% agarose gel, cut out, and purified using the Wizard SV Gel and PCR Clean Up kit (Promega). The oligonucleotides were phosphorylated using T4 PNK (M0201S) with T4 Ligation Buffer (New England Biolabs, Inc.). Samples were annealed in a thermocycler at 37 C for 30 min and then at 95 C for 5 min and then were ramped down to 25 C at 5 C/min. Annealed oligonucleotides were diluted 1:200 in RNase/DNase-free water. Ligation of the annealed oligonucleotide and digested pLentiCRISPR v2 plasmid was performed using Quick Ligase (New England Biolabs, Inc.). Tet-Inducible shEZH2 Knockdown tet-pLKO-shEZH2 was constructed by inserting the EZH2 shRNA (the sense sequence is 50 - TATTGCCTTCTCACCAGCTGC -30 ) into the tet-pLKO-puro vector (Addgene) digested with AgeI and EcoRI restriction enzymes (NEB) and dephosphorylated for 30 min at 37 C. The digested plasmid was run on a 1% agarose gel, cut out, and purified using the Wizard SV Gel and PCR Clean Up kit (Promega). The oligonucleotides were phosphorylated using T4 PNK (M0201S) with T4 Ligation Buffer (New England Biolabs, Inc.). Samples were annealed in a thermocycler at 37 C for 30 min and then at 95 C for 5 min and finally were ramped down to 25 C at 5 C per min. Annealed oligonucleotides were diluted 1:200 in RNase/DNase-free water. Ligation of the annealed oligonucleotide and digested tet-pLKO-puro plasmid was performed using Quick Ligase (New England Biolabs, Inc.). To induce EZH2 knockdown, cells infected with tet-inducible shEZH2 virus were treated with 100 ng/ml of Doxycycline (Sigma). Lentivirus Infection Phoenix cells were used to package the retroviruses (a gift from G. Nolan, Stanford University, USA). Plasmid encoding wild-type BAF155 and mutant R1064K BAF155 were described as previously published (Karakashev et al., 2018). Lentivirus was packaged using the Virapower Kit or Lenti-Pac HIV Expression Packaging Kit accordingly to manufacturer’s instructions. Cells infected with viruses encoding the puromycin resistance gene were selected in 1 mg/ml puromycin. Reverse-Transcriptase Quantitative PCR (RT-qPCR) RNA was isolated by RNeasy Mini Kit (Qiagen). mRNA expression for MAD2L2, APLF, and LINP1 was determined using SYBR green 1-step iScript (Bio-Rad) with a Life Technologies QuantStudio 3 machine. Annexin V Staining Phosphatidylserine externalization was detected using an Annexin V FITC and PI kit following the manufacturer’s instructions. Briefly, cells were washed with cold PBS and resuspended in Annexin V binding buffer and stained with Annexin V and PI at room temperature and then analyzed immediately. Annexin V-positive cells were detected using the Becton-Dickinson LSR18 machine and analyzed with FlowJo version 7 software module. Colony Formation Assay 1,000 to 2,000 cells were plated into a 24 well tissue culture plate and treated with the indicated compounds. Cell medium was changed every three days with appropriate drug doses for 10 days. Colonies were washed twice with PBS and fixed with 10% methanol and 10% acetic acid in distilled water. Fixed colonies were stained with 0.005% crystal violet. Integrated density was measured using NIH ImageJ software. Chromatin Immunoprecipitation (ChIP), and Cut and Run ChIP Analysis The following antibodies were used to perform conventional ChIP: rabbit anti-EZH2 (Cell Signaling, 10 ml per immunoprecipitation), rabbit anti-H3K27me3 (Cell Signaling, 10 ml per immunoprecipitation). An isotype-matched IgG was used as a negative control. ChIP DNA was analyzed by quantitative PCR against the promoter of the human MAD2L2, APLF, and LINP1 genes. Cut and run ChIP was performed as described (Skene and Henikoff, 2017). In brief, parental A1847 cell or A1847 CARM1-knockout cells were gently washed twice in room temperature with Wash Buffer (20 mM HEPES pH 7.5, 150 mM NaCl, 0.5 mM spermidine and a Roche complete EDTA-free tablet (Sigma-Aldrich) per 50 ml) and centrifuged at 600xg for 3 min. Cells were then resuspended in Antibody Buffer (antibody with 1:100 dilution in wash buffer supplemented with 0.05% digitonin and 2mM EDTA). The following antibodies were used: mouse anti-BRG1 (Santa Cruz), rabbit anti-SNF5 (Bethyl), and rabbit anti-BAF155 (Cell Signaling). An isotype-matched IgG was used as a negative control. After 2 hr incubation at 4 Cˌ supernatant was removed by centrifugation and cell pellets were washed once with Dig-Wash Buffer (Wash Buffer containing 0.05% digitonin). Cell pellets were then Cancer Cell 37, 1–11.e1–e6, February 10, 2020 e4

Please cite this article in press as: Karakashev et al., EZH2 Inhibition Sensitizes CARM1-High, Homologous Recombination Proficient Ovarian Cancers to PARP Inhibition, Cancer Cell (2019), https://doi.org/10.1016/j.ccell.2019.12.015

resuspended in Protein A-MNase at a final concentration of 700ng/ml in Dig-Wash Buffer, incubated for 1 hr at 4 C, washed twice in Dig-Wash Buffer and resuspended in 100 ml of Dig-Wash Buffer. Tubes were placed at 0 C, mixed with 2 ml 100 mM CaCl2, incubated at 0 C for 30 min, and reactions were stopped by addition of 100 ml 2xSTOP buffer (340 mM NaCl, 20 mM EDTA pH8, 4 mM EGTA, 0.05% digitonin, 50 mg/ml RNase A (Thermo), 50 mg/ml glycogen). 10 ml of each sample was collected as input and the remaining sample was centrifuged 16,000Xg for 5 min at 4 C and the supernatant was collected. Both input and supernatant DNA were purified by phenol–chloroform–isoamyl alcohol and chloroform extraction and ethanol precipitation. ChIP DNA was analyzed by quantitative PCR against the promoter of the human MAD2L2, APLF, and LINP1 genes. Cell-Cycle Analysis Cells were fixed with 70% ethanol, treated with bovine RNAase for 30 min, and labeled with propidium iodide (PI) solution (Sigma). Cell suspension were incubated for 15 min at room temperature and PI staining was detected by using the Becton-Dickinson LSR18 machine, and analyzed with FlowJo version 7 software module. Metaphase Spread Cells were synchronized with colcemid (50 ng/mL) for 3 hr and then incubated in 0.075 mol/L potassium chloride (KCl) at 37 C for 10 min. Next, cells were fixed with Carnoy fixative (3:1 methanol:acetic acid) and incubated at 4 C overnight. Fixed cells were dropped onto uncoated microscope slides and dried for 24 hr at room temperature. Slides were next stained in Giemsa staining solution (Sigma) for 4 min. Stained slides were analyzed for total gaps and breaks by Nikon Eclipse 80i microscope. Dual HR and NHEJ Reporter Assay The dual HR and NHEJ reporter assay was performed as previously described (Arnoult et al., 2017). Briefly, indicated cells were plated in a 6-well plates at a 50% confluence one day before transfection. Cells were transfected with 500ng of pCBA I-SceI plasmid (Addgene), 500ng of pLCN-DRR plasmid (Addgene) plasmid, and 500ng of pCAGGS-DRR-mCherry-Donor-EF1a-BFP plasmid (Addgene). After 72 hr incubation cells were collected and BFP, mCherry, and eGFP expression was detected by using the Becton-Dickinson LSR18 machine and analyzed with FlowJo version 7 software module. DNA Combing Assay The DNA combing assay was performed as we previously described (Aird et al., 2013). Specifically, replicating DNA was first labeled with 25 mM 5-iodo-2’-deoxyuridine (IdU) for 20 min. Cells were then subjected to the second DNA labeling with 250 mM 5-chloro-2’deoxyuridine (CldU) for another 20 min. After double labeling, cells were treated with 4mM Hydroxyurea (Sigma) to induce replication stress. 2.5 mL of the cell suspension (
2,500 cells) were spotted onto one end of the glass slide, followed by addition of 7.5 mL of lysis buffer (50 mM EDTA, 0.5% SDS, 200 mM Tris-HCl, pH 7.5). After incubation for 8 min at room temperature, the slides were tilted to 15 to allow the DNA fibers to spread along the slide. DNA fibers were treated with 2.5M hydrochloric acid and incubated with rat antiBrdU (BU1/75) monoclonal antibody (Novus, 1:500) that recognizes CIdU, but not IdU at 4 C overnight, followed by an AlexaFluor cy3-conjugated goat anti-rat secondary antibody (Thermo, 1:500) for 1.5 h at room temperature. The mouse anti-IdU monoclonal antibody (BD, 1:500) that recognizes IdU but not CIdU (4 C overnight) and AlexaFluor 488-conjugated goat anti-mouse secondary antibody (Thermo, 1:500) (1.5 h at room temperature) were used to detect IdU. Images were acquired randomly from fields with untangled fibers using Eclipse 80i Nikon Fluorescence Microscope. The lengths of CIdU (AF cy3, red) and IdU (AF 488, green) labeled patches were measured using the Image J software, and mm values were converted into kb using the conversion factor 1 mm = 2.59 kb. A minimum of 100 individual fibers was analyzed for each experiment and the mean of at least three independent experiments presented. Xenograft Ovarian Cancer Models The protocols were approved by the Institutional Animal Care and Use Committee (IACUC). For in vivo experiments, the sample size of at least 5 mice per group was determined on the basis of the data shown from in vitro experiments. For orthotopic xenograft models, 1 X 106 parental A1847 control or A1847 CARM1 knockout cells were unilaterally injected into the ovarian bursa sac of 6-8-week old female immunocompromised NSG mice (n = 5 mice per group). One week after injection the mice were treated with vehicle control (20% captisol), Olaparib (50 mg per kg daily by i.p.), GSK126 (25 mg per kg daily i.p.), or a combination for 3 weeks. At the end of the experiments, tumors were surgically dissected and tumor size was measured. For subcutaneous xenograft models, 5 X 106 parental A1847 or A1847 CARM1 knockout cells were unilaterally injected subcutaneously (n = 5 mice per group) in the flank of 6-8-week old female immunocompromised NSG mice. One week after injection the mice were randomized and treated with vehicle control (20% captisol), Olaparib (50 mg per kg daily by i.p.), GSK126 (25 mg per kg daily by i.p.) or a combination for 5 weeks. Tumor size was measured every 3 days. For survival experiments, after stopping the treatment, the mice were followed until burden reached 10% of the body weight as determined by The Wistar Institute IACUC guideline. For CARM1-high PDX #1 and CARM1-low PDX #1, the procurement of human ovarian tumor tissues was approved by the Institutional Review Board of Christina Care Health System. De-identified patient tumor samples were obtained from Helen F. Graham Cancer Center at Christiana Care Health System. Second passage PDXs were orthotopically xenografted into the ovarian bursa sac of 6-8-week old female immunocompromised NSG mice (n = 7 mice per group for CARM1-high PDX #1 and n = 5 mice per group for CARM1-low PDX #1). Mice were randomized and treated with vehicle control (20% captisol), Olaparib (50 mg per kg daily, by i.p.), e5 Cancer Cell 37, 1–11.e1–e6, February 10, 2020

Please cite this article in press as: Karakashev et al., EZH2 Inhibition Sensitizes CARM1-High, Homologous Recombination Proficient Ovarian Cancers to PARP Inhibition, Cancer Cell (2019), https://doi.org/10.1016/j.ccell.2019.12.015

GSK126 (25 mg per kg daily by i.p.), or a combination starting on the day of the transplantation. Tumor weight was measured at the end of the treatment (77 days for CARM1-high PDX #1 and 97 days for CARM1-low PDX #1). For CARM1-high PDX #2 and CARM1low PDX #2, PDXs were generated using frozen viable stocks of second passage PDXs specimens as previously described (Karakashev et al., 2018). Passage 3 HGSOC PDXs were re-established in 6-8-week old female immunocompromised NSG mice that are CARM1-high and CARM1-low, respectively. Specifically, PDXs were unilaterally engrafted subcutaneously into 6-8-week old female immunocompromised NSG mice (n = 5 mice per group). Mice were randomized and treated with vehicle control (20% captisol), Olaparib (50 mg per kg daily, by i.p.), GSK126 (25 mg per kg daily by i.p.), or a combination starting the day of the injection. Tumor size was measured every 3 days for 77 days. Immunohistochemical (IHC) Staining IHC staining was performed on serial sections. Tissue sections were stained using Dako EnVision+ system following the manufacturer’s instructions. Briefly, formalin-fixed, paraffin-embedded tumors were sectioned, and slides were deparaffinized using xylenes (Fisher Scientific). Antigens were unmasked using citrate buffer (Thermo Fisher). Endogenous peroxidases were quenched with 3% hydrogen peroxide in methanol. Staining was performed using antibodies against H3K27me3 (Cell Signaling, 1:100 dilution), cleaved caspase 3 (Cell Signaling, 1:50 dilution), or Ki67 (Cell Signaling, 1:500 dilution). Counterstaining was performed using Mayer’s Hematoxylin (Dako). Expression of the stained markers was scored using a histologic score (H score). QUANTIFICATION AND STATISTICAL ANALYSIS Experiments were repeated 3 times unless otherwise stated. The representative images are shown unless otherwise stated. Statistical analysis was performed using GraphPad Prism 7 (GraphPad) for Mac OS. Quantitative data are expressed as mean ± SEM. unless otherwise stated. For all statistical analyses, the level of significance was set at 0.05. For correlation studies, Pearson’s correlation was used for calculating p and r values in GraphPad Prism 5 (GraphPad) for Mac OS. Analysis was performed blindly but not randomly. Animal experiments were randomized. There was no exclusion from the experiments. For in vivo synergy analysis, all data were log10 transformed before data analysis to improve normality and homoscedasticity. ANOVA with post-hoc multiple comparisons were performed for between groups comparisons. A general linear model with interaction term between single treatment was used for testing the synergistic combination effect in mouse model. Genes that were significantly upregulated in CARM1 knockout cells (FDR<5%) and had significantly decreased EZH2 and H3K27me3 peaks (FDR<1%) were considered for overlap as direct CARM1/EZH2/H3K27me3 targets and significance of the overlap was tested using hypergeometric test. List of genes involved in NHEJ was obtained from QIAGEN’s Ingenuity Pathway Analysis software (IPA, QIAGEN Redwood City, www.qiagen.com/ingenuity, function ‘‘Non-homologous end joining [NHEJ]’’) and through literature search and the function enrichment among direct CARM1/EZH2/H3K27me3 targets was tested using Fisher Exact Test. Pearson correlation test between CARM1 and MAD2L2 expression in laser capture micro-dissected human high-grade serous ovarian cancer specimens used gene expression data from NCBI GEO dataset GSE18520 (Mok et al., 2009). Stratification of patients into high and low CARM1 expression level in the TCGA HGSOC dataset was done using threshold value equal to average log2 CARM1/GAPDH ratio among patients with CARM1 amplification. DATA AND CODE AVAILABILITY Previously published RNA-seq and ChIP-seq of EZH2 and H3K27me3 for parental A1847 and CARM1 knockout A1847 cells were used in this study (NCBI GEO accession number GSE95645) (Karakashev et al., 2018).

Cancer Cell 37, 1–11.e1–e6, February 10, 2020 e6