Familial epilepsy and developmental dysphasia: Description of an Italian pedigree with autosomal dominant inheritance and screening of candidate loci

Epilepsy Research (2008) 80, 9—17

journal homepage: www.elsevier.com/locate/epilepsyres

Familial epilepsy and developmental dysphasia: Description of an Italian pedigree with autosomal dominant inheritance and screening of candidate loci Roberto Michelucci a,∗, Eva Scudellaro b,d, Stefania Testoni a, Daniela Passarelli e, Patrizia Riguzzi a, Erica Diani d, Giovanni Vazza b, Valeria Vianello c, Aldo Scabar f, Maria L. Mostacciuolo b, Lilia Volpi a, Guido Rubboli a, Federica Pinardi a, Maria Margherita Mancardi g, Carlo Alberto Tassinari a, Carlo Nobile d a

Department of Neurosciences, Division of Neurology, Via Altura 3, Bellaria Hospital, 40139 Bologna, Italy Department of Biology, University of Padua, Padua, Italy c Department of Neurosciences, University of Padua, Padua, Italy d CNR-Institute of Neurosciences, Section of Padua, Padua, Italy e Division of Neurology, Infermi Hospital, Faenza, Italy f Division of Infantile Neuropsychiatry ‘‘Burlo Institute’’, Trieste, Italy g Muscular and Neurodegenerative Disease Unit, Institute ‘‘G. Gaslini’’, University of Genova, Genova, Italy b

Received 2 February 2006; received in revised form 15 January 2008; accepted 5 March 2008

KEYWORDS Familial epilepsy; Developmental dysphasia; Autosomal dominant trait; Focal and generalized EEG paroxysms

∗

Summary Purpose: To describe a familial epileptic condition combining a peculiar electro-clinical pattern with developmental language dysfunction in a large Italian kindred. Methods: We studied the clinical and neurophysiological features of a 4-generation family with 10 affected members (3 deceased). We also analysed in 7 affected and 7 healthy members microsatellite markers for 51 candidate loci for epilepsy, including 42 loci containing ion channel genes expressed in the brain, as well as the SPCH1 and SRPX2 loci. Results: Five of the seven living affected members (aged 20—58 years) had the full phenotype (seizures, EEG epileptiform abnormalities and dysphasia). The language dysfunction was the first symptom, becoming evident since the period of language development and mainly consisting of phonemic and syntactic paraphasias, difficulty of expression and reduced verbal fluency. The seizures had their onset between 2 and 23 years and were reported as epileptic falls (4)

Corresponding author. Tel.: +39 0516225734; fax: +39 0516225369. E-mail address: [email protected] (R. Michelucci).

0920-1211/$ — see front matter © 2008 Published by Elsevier B.V. doi:10.1016/j.eplepsyres.2008.03.014

10

R. Michelucci et al. associated or not with myoclonic features, absences (3), tonic—clonic (1) and complex partial seizures (1). The seizures were easily controlled by antiepileptic treatment in all patients except one. In the five patients with a good response of seizures to treatment, the EEG tracings showed the coexistence of focal and generalized epileptiform abnormalities; in the refractory patient the interictal EEG demonstrated bilateral asynchronous fronto-temporal paroxysms with left predominance and ictal SEEG recording suggested a multifocal origin of the discharges. MRI of the brain was normal in all patients. Linkage analysis provided negative LOD scores for all the investigated loci. Conclusion: We have described a novel familial pattern of epilepsy and developmental dysphasia which is not genetically linked to epilepsy or speech disorder loci, as documented by a candidategene linkage approach. © 2008 Published by Elsevier B.V.

Introduction The association between epilepsy/epileptiform abnormalities and ‘‘interictal’’ language disturbances has long been the subject of debate and includes a number of clinical scenarios. Landau-Kleffner syndrome (LKS) is a non-familial epileptic encephalopathy characterized by the development in previously normal children of ‘‘acquired’’ aphasia as the result of paroxysmal abnormalities over the temporal regions, markedly activated during non-REM sleep in the form of Continuous Spike and Waves during Sleep (CSWS) pattern (Tassinari et al., 2000). Similarly, a number of children with developmental dysphasias may show ‘‘epileptiform’’ EEG abnormalities, which have been causally related to the language disturbances (Echenne et al., 1992; Picard et al., 1998). Lastly a familial condition, called autosomal dominant rolandic epilepsy with speech dyspraxia, combines an epileptic focal motor disorder with interictal language problems in the form of speech dyspraxia (Scheffer et al., 1995). Now we describe a large Italian kindred exhibiting the association of epilepsy (with focal and generalized features) and developmental language dysfunction over four generations. We also report a family study of selected candidate loci, either associated to other epilepsy syndromes or harbouring ion channel genes.

Patients and methods Clinical data collection We identified a relatively large four-generation non-consanguineous Italian family comprising 21 members (excluding spouses) of which 10 were affected (3 deceased). The family came to our attention through the index patient, IV:1, who was referred at our epilepsy unit for intractable focal epilepsy. The pedigree structure is presented in Fig. 1. All the 16 living members, including the 7 affected, were directly examined by 3 of the authors (RM, DP, ST). A personal and family history was obtained from each member along with a physical and neurological examination. At the time of our evaluation only one patient had active epilepsy whereas all the affected members had a previous history of childhood benign epilepsy, whose seizure semiology could be ascertained by means of direct interview of the parents/relatives and available clinical records. EEGs from patients III:4, IV:4, IV:5, IV:8, IV:9 covering several years of the history were already available at the time of our evaluation and were thoroughly reviewed by 3 of the authors (RM, DP, PR). Sleep EEGs had been performed in patients IV:1, IV:4, IV:5 and IV:9. Serial neuropsychological examinations, including intelligence (WISC-III) and receptive

or expressive language tests, were also available in five cases (IV:1, IV:4, IV:5, IV:8, IV:9). Routine and sleep EEGs were obtained in family members III:2 and IV:1. Each affected patient (except family members III:8 and III:4) had previously undergone a magnetic resonance imaging (MRI) with 1.5 T fixed-strength unit. The MRI was repeated twice in the index patient (with a 3 T machine).

Genotype determination All individuals participating in the study gave their written informed consent. Ten-milliliter venous blood samples were collected from all 7 affected and 7 unaffected family members (III:2, III:3, III:4, III:6, III:8, IV:1, IV:2, IV:4, IV:5, IV:6, IV:7, IV:8, IV:9, IV:10), and genomic DNA was extracted using a standard method. Nine loci linked to other familial epilepsy syndromes with unknown gene (2q24, 6p11-12, 8q24, 10q24, 15q14, 15q24, 16p12-q12, 19q22, and 22q11.12) (5), 42 additional loci harbouring one or more ion channel genes expressed in the brain (see Table 1), the SPCH1 locus at 7q31, linked to familial severe speech disorder (Fisher et al., 1998), and the SRPX2 locus linked to rolandic seizures, speech dyspraxia and mental retardation on chromosome Xp11.21 (Roll et al., 2006) were screened by typing at least one informative microsatellite marker for each locus according to standard PCR conditions. At ion channel loci, markers were chosen based on their positions within or flanking ion channel genes using the Human Genome Browser Gateway (http://genome/ucsc/edu/cgi-bin/hgGateway). Fifty-five markers from the ABI PRISM linkage mapping set version 2.5 were utilized because they were within few Mb of a selected ion channel gene; if no marker from the linkage panel was sufficiently close to a given ion channel gene, other microsatellites were chosen. In the case of the KCNQ2 gene on chromosome 20q13, we developed a new intragenic microsatellite marker (KCNQ2A) with higher informativity than pre-existing markers in that region

Figure 1 Pedigree of the family. () (䊉) women; () () men; (䊉) () full phenotype (epilepsy, EEG abnormalities and dysphasia); ( ) single tonic—clonic attack; (䊑) EEG abnormalities and dysphasia; (䊔) unclassified seizures.

Familial epilepsy and developmental dysphasia Table 1

11

Chromosome loci containing ion channel genes

Gene

Location

Marker

SCN1A, 2A2, 3A SCN8A

2q24.3 12q13.13

D2S2330 D12S85 D12S368

SCN1B

19q13.12

SCN2B

Table 1 (Continued ) Gene

Location

Marker D19S226

CACNA1B, CLIC 3

9q34.3

D9S1826 D9S1838

D19S225 D19S220

CACNA1E

1q25.3

D1S218 D1S238

11q23.3

D11S908 D11S925

CACNAB2

10p12.32

D10S1653 D10S548

NAH1 (SLC9A1)

7p15.3

D7S507 D7S493

CACNA1D, 2D2

3p21.31

D3S1581 D3S1300

NAH5 (SLC9A5)

5p15.2

D5S1981 D5S416

CACNA2D1

7q21.11

D7S669 D7S630

KCNA1, A5, A6

12p13.32

D12S99 D12S336

CACNA1G

17q21.33

D17S1868 D17S807

KCNA3, C4

1p13.3

D1S206 D1S252

CACNB4 CACNG1

2q23.3 17q24.1

KCNC1

11p15.1

D11S569 D11S902

D2S142 D17S807 D17S789

CLC2

12q24.11

KCNC2

12q21.1

D12S43 D12S92

D12S78 D12S1583

CLIC4

1p35.3

KCNC3

19q13.33

D19S902 D19S904

D1S2644 D1S234

GABRA1, A6, B2, G2

5q34

KCNG1

20q13.12

D20S196 D20S902

D5S422 D5S400

KCNH4 KCNJ2, J16

17q21.2 17q24.3

D17S934 D17S789 D17S949

CHRNB2 CHRNA4

1p21 20q13

D1S498 D20S173 KCNQ2A

KCNJ4, CACNG2

22q13.1

D22S283 D22S423

KCNJ6

21q22.13

D21S1255 D21S268

KCNK12 KCNMB1

2p21 5q35.1

D2S2259 D5S504 D5S422

KCNN1 KCNN2

19p13.11 5q22.3

D19S410 D5S421 D5S471

KCNN3 KCNQ2 KCNQ3

1q23.1 20q13 8q24

D1S498 KCNQ2A D8S1835 D8S558

KCNS1

20q13.12

D20S119 D20S178

KCNS3

2p24.2

D2S305 D2S165

HCN2 HCNH4 SUR2

19p13.3 15q24.1 6q23.2

D19S247 D15S131 D6S262 D6S292

CACNA1A

19p13.2

D19S221

Markers in normal font are from the ABI PRISM linkage mapping set version 2.5; those in bold were chosen from the Human Genome Browser Gateway (http://genome/ucsc/edu/cgibin/hggateway) database.

(primer sequences: forward: GGGAGATGACCCCCTTCTTA; reverse: AGAGAACGGCTCCAGGAGT). Fractionation of PCR products was carried out on an ABI3100 apparatus (Applied Biosystems, Foster City, CA, USA); linkage analysis was performed by using the MLINK program of the LINKAGE package version 5.2, assuming autosomal dominant inheritance and 80% penetrance.

Results Clinical study Deceased affected family members (I:1, II:1, II:3) There were three male family members whose histories were largely unknown and consisted of recurrent ‘‘epileptic seizures’’ (with fall to the ground) since childhood. Living affected family members (III:4, III:8, IV:1, IV:4, IV:5, IV:8, IV:9) There were four males and three females, aged 20—58 years. Of these patients, five (III:4, IV:1, IV:5, IV:8, IV:9) had the full phenotype (seizures, EEG epileptiform abnormalities and dysphasia), one (IV:4) had only EEG epileptiform abnormal-

12

Table 2

Characteristics of the language disorder Age at LD onset (years)

LD type

Other neuropsychological findings

IQ evaluations

Behavioural disturbances

Evolution of LD

III:4

2—3

Not examined

Not performed

Absent

Stable

III:8 IV:1*

NA 16.5

Not examined Short term and long term non-verbal memory deficit. Attention deficit. Spatial planning impairment

Not performed IQ = 93 (VIQ 90; PIQ 97) (18 years)

Absent Absent

NA Improved

IV:4*

2—3

None

IQ = 91 (VIQ 88; PIQ 95) (12 years) IQ = 89 (VIQ 85; PIQ 96) (15 years)

Absent

Improved

IV:5*

2—3

Mild grapho-perceptive and spatial functions impairment

IQ 68 (QIV 70; QIP 68) (9 years) IQ 68 (QIV 62; QIP 75) (13 years)

Present

Stable

IV:8*

2—3

DD (Dysarthria, lack of verbal fluency, phonemic and semantic paraphasias) Not examined AD (Language comprehension and fluency defect, both in phonemic and semantic aspects. Anomias) DD (Phonologic-syntactic and lexical impairment. Phonemic and semantic paraphasias. Verbal comprehension preserved) DD (Phonological and morpho-syntactic impairment. Phonemic and semantic paraphasias. Syntactic verbal comprehension defect. Language comprehension preserved) DD (Phonemic and semantic paraphasias)

Not performed

Present

Improved

IV:9*

2—3

Practo-gnosic dysfunctioning. Attention deficit Mild learning difficulties (especially in spatio-temporal and logical abilities); short-term verbal sequential memory deficit

IQ = 91 (VIQ 87; PIQ 96) (15 years)

Present

Improved

DD (Phonemic and semantic paraphasias)

*Pts undergoing repeated neuropsychological examinations. LD: language disorder; DD: developmental dysphasia; AD: acquired dysphasia; IQ: intellective quotient; PIQ: performance IQ; VIQ: verbal IQ. NA: not applicable.

R. Michelucci et al.

Pt.

Characteristics of the epilepsy

Pt.

Sex/age (years)

Age at seizure onset (years)

Seizure type

EEG (age of EEG abnormalities—–years, range)

Response to treatment and evolution

Neuroimaging

III:4

Female/49

3

Falling seizures

Female/52

23

Tonic—clonic

IV:1

Male/21

16

Complex partial (inconstant epigastric aura followed by loss of contact, head deviation to the right, inconstant fall to the ground, oroalimentary automatisms, prolonged post-ictal amnesia)

No treatment. Seizures disappeared after 1 year Isolated seizure during pregnancy. No recurrence with 2-year therapy with PB Refractory to treatment (LEV, TPM, PHT). 4—8 seizures in cluster per month

Not done

III:8

Interictal: left focal EAs (35) Not done

IV:4

Male/25

NA

IV:5

Female/20

3

Uncertain (absences reported only by a relative) Falling seizures. Absences

IV:8

Male/29

4

Falling seizures with myoclonic component. Absences

Interictal: right temporal and generalized EAs (5—8)

IV:9

Male/20

2

Falling seizures with myoclonic component. Absences

Interictal: slow left temporal abnormalities and generalized EAs (4—8)

Interictal: bitemporal asynchronous EAs, predominant on the left (18—21) Ictal: Video-EEG recording of seizures arising from the left temporal region. SEEG recording of seizures arising from variable regions (left and right temporal, left frontal) (21) Interictal: left temporal, left occipital, generalized EAs (9—14) Interictal: left frontal and generalized EAs (8—16)

VPA instituted since the age of 10 and withdrawn at the age of 15 Seizures disappeared at the age of 7 following treatment with VPA (therapy withdrawn at the age of 20) Seizures disappeared at the age of 6 following treatment with PB-VPA (therapy withdrawn at the age of 9) Seizures disappeared at the age of 12 following treatment with VPA (therapy withdrawn at the age of 15)

Not done

MRI normal Ictal SPECT: left temporal hyperperfusion

Familial epilepsy and developmental dysphasia

Table 3

MRI normal

MRI normal

Not done

MRI normal

EAs: epileptiform abnormalities; PB: phenobarbital; PHT: phenytoin; TPM: topiramate; VPA: valproate; LEV: levetiracetam; NA: not applicable.

13

14 ities and dysphasia, and one (III:8) had suffered from an isolated epileptic seizure during pregnancy (no EEG tracing was available). The latter subject is considered affected because she is an obligate carrier. The characteristics of language impairment and epilepsy as well as of EEG and MRI findings are described in detail in Tables 2 and 3 and are summarized in the following sections. Language disturbance: The language dysfunction was an early symptom in five of six patients. In these individuals it consisted in a slow acquisition of language without regression and was characterized by phonologicsyntactic impairment, with difficulty of expression and phonemic/semantic paraphasias. Difficulties in verbal comprehension were present in one case. Four subjects also displayed mild cognitive impairment, with learning and behavioural problems. When examined, IQ was normal (2 cases) or mildly impaired (1 case). Language dysfunction tended to remain unchanged or even to improve during longterm evolution. At variance with the above family members, the index patient (IV:I) had the onset of language difficulties (in the form of difficulty of expression and phonemic paraphasias) at the age of 16.5 years, the language dysfunction remaining unchanged thereafter. Seizures: The onset of seizures ranged between 2 and 23 years (mean: 8.5, median: 3 years). On the basis of the description provided by the parents, the seizures may be classified as falling seizures (III:4, IV:5, IV:8, IV:9), absences (IV:5, IV:8, IV:9), tonic—clonic seizures (III:8) and complex partial seizures (IV:1). In two patients (IV:8, IV:9) falling seizures were associated with a myoclonic component (‘‘the child falled down while jerking’’) and were followed by a prompt recovery of the standing position with mild — if any — loss of consciousness. In the remaining 2 cases (III:4; IV:5) the falls were similarly short-lasting but were not associated with overt motor events or muscle stiffening. These seizures had their onset in childhood (at 2—4 years) and occurred on a monthly basis. Absences, described as brief lapses of contact without other phenomena, were reported slightly after the onset of the falling seizures and occurred on a weekly basis.

R. Michelucci et al. In these patients with epileptic drops and absences, the seizures disappeared after a mean period of 5 years from the onset, usually following therapy with valproate (3 cases), valproate and phenobarbital (1 case) or without antiepileptic medication (1 case). One additional patient (III:8) also had a benign evolution, since she suffered from an isolated tonic—clonic seizure during pregnancy treated with phenobarbital for 2 years. In contrast, the index patient (IV:1) had a quite different clinical picture, with the onset at the age 16 of complex partial seizures (preceded by an abdominal aura and sometimes associated with falling to the ground) refractory to antiepileptic treatment. EEG abnormalities: In five patients (including the patient without a history of seizures, IV:4) the EEG tracings, recorded at the time of ‘‘active’’ epilepsy, showed the coexistence of focal (or multifocal) and ‘‘generalized’’ epileptiform abnormalities, in the form of spike-waves at 3—4 Hz (Fig. 2). The focal abnormalities involved the occipital (IV:4), temporal (IV:8, IV:9) or frontal (III:4, IV:5) regions. A CSWS pattern was never observed in the four patients who had sleep EEG recordings. In the patient with refractory complex partial seizures (IV:1) the interictal epileptiform abnormalities were localized asynchronously over both fronto-temporal regions, with left predominance (Fig. 3). In this case long-term video-EEG recording demonstrated a clear-cut left temporal onset of the epileptic discharges in 3 of the 5 recorded seizures. Similarly ictal SPECT disclosed a left temporal hyperperfusion. On stereo-electroencephalographic (SEEG) monitoring with intracranial electrodes, however, the seizures were shown to originate from different areas of the brain (left frontal, left temporal, right frontal). MRI of the brain was performed in 4 of 7 members (IV:1, IV:4, IV:5, IV:9) and was normal.

Genetic study Linkage simulation performed on the affected and unaffected family members available for the study (see Fig. 1) assuming autosomal dominant inheritance and 80% penetrance gave a maximum LOD score value of 2.67 at a

Figure 2 Patient IV:4. In the same tracing interictal generalized spike-wave discharges ending with a clear right posterior predominance (left) coexist with focal left posterior discharges (right).

Familial epilepsy and developmental dysphasia

15

Figure 3 Patient IV:I. In this tracing obtained after sleep deprivation, epileptiform abnormalities involve asynchronously the left temporal and the right centro-temporal regions.

recombination frequency 0.00. Analysis of microsatellite markers for 51 candidate loci for epilepsy — 9 linked to known familial epileptic syndromes (see ‘‘Genotype determination’’ section), and 42 harbouring ion channel genes (see Table 1) — and for the SPCH1 locus at 7q31 and SRPX2 at Xp11.21 gave in all cases negative LOD scores values (<−2.00; theta = 0.), ruling out their involvement in this familial condition.

Discussion In the present paper we describe an Italian pedigree showing a peculiar phenotype combining seizures, EEG epileptiform abnormalities and dysphasia. In four patients the epileptic condition was characterized by the onset during childhood of ‘‘falling seizures’’ and ‘‘absences’’ with benign evolution and remission of the attacks after a mean period of 5 years. It is generally agreed that falling seizures are a heterogeneous group of seizures (focal or generalized) which may recognize different pathophysiological mechanisms including tonic, myoclonic, myoclonic—atonic and atonic components (Tassinari et al., 1997). In falling seizures the true nature of the attacks may be ascertained only by means of videopolygraphic recording of the ictal events. Therefore it is not possible in our cases to better define the seizure types leading to the falling attacks. Moreover in these patients the interictal EEGs combined focal and generalized epileptiform abnormalities. In another patient (obligate carrier) there was an isolated tonic—clonic seizure during pregnancy. Lastly the index patient had the onset at the age of 16 of recurrent complex partial seizures refractory to medical treatment, which were demonstrated to originate from dif-

ferent areas of the brain on SEEG monitoring. Due to these specific clinical features, it could be questioned whether this patient has the same epileptic condition described in the other family members; it should be emphasized, however, that his MRI (performed three times, also with a 3-T machine) was constantly normal and did not disclose alternative etiologies; moreover he also developed a language disturbance. The speech problem in this family may be classified as developmental dysphasia in the five patients who had slow acquisition of language without regression and acquired aphasia in the index patient who had the onset of language disturbances at the age of 16.5 years. According to the usual system of classification (Rapin and Allen, 1983) the developmental dysphasia encountered in our pedigree may be defined as a phonologic-syntactic syndrome, as suggested by difficulty of expression, reduced verbal fluency, phonemic and semantic paraphasias, with a rather preserved comprehension. The clinical phenotype observed in the present pedigree has not been reported so far in the literature. Scheffer et al. (1995) described under the heading of ‘‘autosomal dominant rolandic epilepsy and speech dyspraxia’’ (ADRESD) a familial condition characterized by the association of nocturnal oro-facio-brachial partial seizures, centro-temporal epileptiform discharges, oral and speech dyspraxia and cognitive impairment. Recently the Xp11-21 gene SRPX2 was identified as being responsible for ‘‘rolandic epilepsy and speech dyspraxia’’ (RESD) in a family with a X-linked transmission patttern (Roll et al., 2006). Our family clearly differed for the semiology of seizures, location of EEG abnormalities and absence of speech and oral dyspraxia. Moreover linkage to the SRPX2 locus was excluded. Other familial partial epilep-

16 sies were also considered in the differential diagnosis and easily discarded. Partial epilepsy with pericentral spikes is a familial syndrome linked to chromosome 4p15 characterized by a variety of focal seizure types (even within individual members), benign evolution and typical paroxysmal abnormalities around the pericentral region (Kinton et al., 2002). At variance with our family, there is no evidence of language dysfunction and EEG abnormalities have no diffuse or generalized pattern. Familial partial epilepsy with variable foci is a benign focal epilepsy syndrome in which affected family members manifest only a single partial seizure type, despite multiple seizure types are present within a single family concordant with different EEG foci. Two different loci (2q and 22q) have been identified so far (Scheffer et al., 1998; Xiong et al., 1999). Again our family differs from the latter condition for the language disturbance and a more homogeneous electro-clinical phenotype. Autosomal recessive rolandic epilepsy with dystonia, a rare condition linked to chromosome 16p combining rolandic seizures with exercise-induced dystonia and writer’s cramp, has a different mode of inheritance and manifests additional specific clinical features that are not present in our family (Guerrini et al., 1999). Lastly our pedigree has none of the characteristic features of autosomal dominant nocturnal frontal lobe epilepsy (Phillips et al., 1995) and autosomal dominant lateral temporal lobe epilepsy (Ottman et al., 1995; Michelucci et al., 2003). As for the pathophysiology of the association between epilepsy and language disorders, it may be hypothesized in our family that a common genetic substrate may cause both disorders by inducing structural brain abnormalities such as focal dysplasias or neuron migration disturbances. An alternative explanation is that apparently subclinical paroxysmal activity may be the cause of language deterioration, as demonstrated in LKS (Tassinari et al., 2000). Interestingly two of our patients with the onset of seizures and language impairment in the first years of life were diagnosed as having LKS. It is widely recognized that epileptic syndromes have a strong genetic basis and, although the majority of idiopathic epilepsies have a complex inheritance, a number of loci and genes have been discovered in specific familial epileptic disorders (Gutierrez-Delicado and Serratosa, 2004). Similarly, a genetic component has been also suggested for developmental disorders of speech and language (Billard et al., 1994; Hurst et al., 1990), most of them being however of multifactorial origin. An autosomal dominant form of severe speech and language disorder has been linked to a locus, SPCH1, on chromosome 7q31 in a single large pedigree (Fisher et al., 1998) and, subsequently, the causative gene for this disorder, FOXP2, has been identified in the same family (Lai et al., 2001). Our pedigree, characterized by the combination of both epilepsy and speech disorder, showed an autosomal dominant pattern of inheritance, therefore suggesting a monogenic trait and justifying the search for a major susceptibility locus. We tested microsatellite markers for 51 candidate loci for epilepsy, including 42 loci containing ion channel genes expressed in the brain, some of which are already known to cause other forms of familial epilepsy (Gutierrez-Delicado and Serratosa, 2004), as well as the SPCH1 and SRPX2 loci and did not find any evidence of link-

R. Michelucci et al. age. Despite these negative results, screening of candidate ion channel loci may be useful in other family studies and may facilitate identification of new epilepsy-related genes. In conclusion we have described a peculiar familial epileptic condition characterized by the association of heterogeneous seizure types, multifocal and generalized EEG paroxysms and developmental dysphasia. This syndrome is not genetically linked to known epilepsy or speech disorder loci, as documented by a candidate-gene linkage approach.

Acknowledgments We thank the family members for their participation in this study. This work was supported by the Genetic Commission of the Italian League Against Epilepsy (LICE) and by TelethonItaly (grant no. GGP02339 to R.M and C.N.).

References Billard, C., Toutain, A., Loisel, M.L., Gillet, P., Barthez, M.A., Maheut, J., 1994. Genetic basis of developmental dysphasia: report of eleven familial cases in six families. Genet. Couns. 5, 23—33. Echenne, B., Cheminal, R., Rivier, F., Negre, C., Touchon, J., Billiard, M., 1992. Epileptic electroencephalographic abnormalities and developmental dysphasia: a study of 32 patients. Brain Dev. 14, 216—225. Fisher, S.E., Vargha-Khadem, F., Watkins, K.E., Monaco, A.P., Pembrey, M.E., 1998. Localisation of a gene in a severe speech and language disorder. Nat. Genet. 18, 168—170. Guerrini, R., Bonanni, P., Nardocci, N., Parmeggiani, L., Piccirilli, M., De Fusco, M., Aridon, P., Ballabio, A., Carrozzo, R., Cesari, G., 1999. Autosomal recessive rolandic epilepsy with paroxysmal-induced dystonia and writer’s cramp: delineation of the syndrome and gene mapping to chromosome 16p12-11.2. Ann. Neurol. 45, 344—352. Gutierrez-Delicado, E., Serratosa, J.M., 2004. Genetics of the epilepsies. Curr. Opin. Neurol. 17, 147—153. Hurst, J.A., Baraitser, M., Auger, E., Graham, F., Norel, S.V., 1990. A extended family with a dominantly inherited speech disorder. Dev. Med. Child Neurol. 32, 352—355. Kinton, L., Johnson, M.R., Smith, S.J.M., Farrell, F., Stevens, J., Rance, J.B., Claudino, A.M., Duncan, J.S., Davis, M.B., Wood, N.W., Sander, W.A., 2002. Partial epilepsy with pericentral spikes: a new familial epilepsy syndrome with evidence for linkage to chromosome 4p15. Ann. Neurol. 51, 740—749. Lai, C.S.L., Fisher, S.E., Hurst, J.A., Vargha-Khadem, F., Monaco, A.P., 2001. A forkhead-domain gene is mutated in a severe speech and language disorder. Nature 413, 519—523. Michelucci, R., Poza, J.J., Sofia, V., de Feo, M.R., Binelli, S., Bisulli, F., Scudellaro, E., Simionati, B., Zimbello, R., d’Orsi, G., Passarelli, D., Avoni, P., Avanzini, G., Tinuper, P., Biondi, R., Valle, G., Mautner, V.F., Stephani, U., Tassinari, C.A., Moschonas, N.K., Siebert, R., de Munain, A.L., Perez-Tur, J., Nobile, C., 2003. Autosomal dominant lateral temporal epilepsy: clinical spectrum, new epitempin mutations, and genetic heterogeneity in seven European families. Epilepsia 44, 1289—1297. Ottman, R., Risch, N., Hauser, W.A., Pedley, T.A., Lee, J.H., BarkerCummings, C., Lustenberger, A., Nagle, K.J., Lee, K.S., Scheuer, M.L., Neystat, M., Susser, M., Wilhelmsen, K.C., 1995. Localization of a gene for partial epilepsy to chromosome 10q. Nat. Genet. 10, 56—60. Picard, A., Cheliout Heraut, F., Bouskraoui, M., Lemoine, M., Lacert, P., Delattre, J., 1998. Sleep EEG and developmental dysphasia. Dev. Med. Child Neurol. 40, 595—599.

Familial epilepsy and developmental dysphasia Phillips, H.A., Scheffer, I.E., Berkovic, S.F., Hollway, G.E., Sutherland, G.R., Mulley, J.C., 1995. Localization of a gene for autosomal dominant nocturnal frontal lobe epilepsy to chromosome 20q13.2. Nat. Genet. 10, 117—118. Rapin, I., Allen, D.A., 1983. Developmental language disorders: nosologic considerations. In: Kirk, U. (Ed.), Neuropsychology of Language, Reading and Spelling. Academic Press, New York, pp. 155—189. Roll, P., Rudolf, G., Pereira, S., Royer, B., Scheffer, I.E., Massacrier, A., Valenti, M.P., Roeckel-Trevisiol, N., Jamali, S., Beclin, C., Seegmuller, C., Metz-Lutz, M.N., Lemainque, A., Delepine, M., Caloustian, C., de Saint Martin, A., Bruneau, N., Dep` etris, D., Matt` ei, M.G., Flori, E., Robaglia-Schlupp, A., L` evy, N., Neubauer, B.A., Ravid, R., Marescaux, C., Berkovic, S.F., Hirsch, E., Lathrop, M., Cau, P., Szepetowski, P., 2006. SRPX2 mutations in disorders of language cortex and cognition. Hum. Mol. Genet. 15, 1195—1207. Scheffer, I.E., Jones, L., Pozzebon, M., Howell, R.A., Saling, M.M., Berkovic, S.F., 1995. Autosomal dominant rolandic epilepsy and speech dyspraxia: a new syndrome with anticipation. Ann. Neurol. 38, 633—642.

17 Scheffer, I.E., Phillips, H.A., O’Brien, C.E., Saling, M.M., Wrennall, J.A., Wallace, R.H., Mulley, J.C., Berkovic, S.F., 1998. Familial partial epilepsy with variable foci: a new partial epilepsy syndrome with suggestion of linkage to chromosome 2. Ann. Neurol. 44, 890—899. Tassinari, C.A., Michelucci, R., Shigematsu, H., Seino, M., 1997. Atonic and falling seizures. In: Engel Jr., J., Pedley, T.A. (Eds.), Epilepsy: A Comprehensive Textbook. Lippincott-Raven, Philadelphia, pp. 605—616. Tassinari, C.A., Rubboli, G., Michelucci, R., Volpi, L., 2000. Acquired epileptic aphasia or Landau-Kleffner syndrome. In: Meinardi, H. (Ed.), Handbook of Clinical Neurology, vol. 73 (29) The Epilepsies. Part II. Elsevier, Amsterdam, pp. 281—290. Xiong, L., Labuda, M., Li, D.S., Hudson, T.J., Desbiens, R., Patry, G., Verret, S., Langevin, P., Mercho, S., Seni, M.H., Scheffer, I.E., Dubeau, F., Berkovic, S.F., Andermann, F., Pandolfo, M., 1999. Mapping of a gene determining familial partial epilepsy with variable foci to chromosome 22q11-q12. Am. J. Hum. Genet. 65, 1698—1710.