FCRL3 gene polymorphisms confer risk for sudden sensorineural hearing loss in a Chinese Han Population

Gene 570 (2015) 89–94

Contents lists available at ScienceDirect

Gene journal homepage: www.elsevier.com/locate/gene

Research paper

FCRL3 gene polymorphisms confer risk for sudden sensorineural hearing loss in a Chinese Han Population Hong Liu, Zheng Gu, Hou-Yong Kang, Xia Ke, Yang Shen, Xiao-Qiang Wang, Guo-Hua Hu, Ji-Hong Zeng, Su-Ling Hong ⁎ The Department of Otorhinolaryngology, The First Affiliated Hospital of Chongqing Medical University, Yuzhong District, Chongqing 400016, PR China

a r t i c l e

i n f o

Article history: Received 26 November 2014 Received in revised form 1 June 2015 Accepted 2 June 2015 Available online 4 June 2015 Keywords: Single-nucleotide polymorphism Immune-related disease Haplotype Steroid

a b s t r a c t Fc receptor-like 3 (FCRL3) has recently been associated with susceptibility to several immune-related diseases. In this study, we evaluated the potential association of FCRL3 polymorphisms with sudden sensorineural hearing loss (SSNHL) in a Chinese Han population. Five single-nucleotide polymorphisms (SNPs) in FCRL3—rs945635, rs3761959, rs7522061, rs10489678, and rs7528684—were genotyped in 630 patients with SSNHL and 600 healthy controls by using a PCR-restriction fragment length polymorphism assay. The allele, genotype, and haplotype frequencies in the patients and the controls were compared using a χ2 test. Moreover, we performed haplotype analysis by using the online software platform SHEsis. The results revealed a significant association between three SNPs—rs7528684, rs3761959, and rs7522061—and SSNHL in the studied Chinese Han population. Furthermore, the AGT and GAC haplotypes were associated with a significantly higher prevalence of SSNHL than were the GAT, GGC and GGT haplotypes. However, no significant differences were detected in either the genotype or allele frequencies of the other two SNPs, rs945635 and rs10489678, between the SSNHL and control groups. Overall, this study has identified an association between FCRL3 polymorphisms and increased risk of SSNHL in a Chinese Han population. © 2015 Elsevier B.V. All rights reserved.

1. Introduction Sudden sensorineural hearing loss (SSNHL) is defined as the rapid onset of sensorineural hearing impairment, occurring within 72 h in

one or both ears, according to the criteria of the National Institute on Deafness and Other Communication Disorders (NIDCD) (National Institute of Deafness and Communication Disorders., 2010). The most frequently used audiometric criterion for SSNHL diagnosis is a decrease

Abbreviations1: A, adenosine; A, absorbance (1 cm); aa, amino acid(s); Ab, antibody(ies); Ad, adenovirus; AdoMet (or SAM), S-adenosylmethionine; AMV, avian myeloblastosis virus; Ap, ampicillin; PGal, P-galactosidase; bp, base pair(s); BSA, bovine serum albumin; C, cytidine; cAMP, cyclic adenosine 3′,5′-monophosphate; CAT, Cm acetyltransferase; cat, gene encoding CAT; ccc, covalently closed circular; cDNA, DNA complementary to RNA; CHO, Chinese hamster ovary; CIAP, calf intestinal alkaline phosphatase; Cm, chloramphenicol; cp, chloroplast; cpm, counts per minute; d, deoxyribo; A, deletion; dd, dideoxyribo; DMSO, dimethylsulfoxide; DNase, deoxyribonuclease; dNTP, deoxyribonucleoside triphosphate; ds, double strand(ed); DTT, dithiothreitol; EF, elongation factor; ELISA, enzyme-linked immunosorbent assay; ENase (or R), restriction endonuclease; Er, erythromycin; EtdBr, ethidium bromide; G, guanosine; Gm, gentamicin; G418, Geneticin; HIV, human immunodeficiency virus; HPLC, high-performance liquid chromatography; HPRT, hypoxanthine-guanine phosphoribosyl transferase; HSV, Herpes simplex virus; Hy, hygromycin; IF, initiation factor; IFN, Interferon; Ig, immunoglobulin(s); IL, interleukin; IPTG, isopropyl P-D-thiogalactopyranoside; IS, insertion sequence(s); kb, kilobase(s) or 1000 bp; kDa, kilodalton(s); Km, kanamycin; lacZpo, lac promoter-operator; LB, Luria–Bertani (medium); LTR, long terminal repeat(s); m6A, N 6-methyladenosine; mAb, monoclonal Ab; MCS, multiple cloning site(s); moi, multiplicity of infection; Mr, relative molecular mass (dimensionless); mt, mitochondria(l); MTase (or  NAD M ■), DNA methyltransferase; Myr, million years; N, any nucleoside; , nicotinamide-adenine dinucleotide and its reduced form; Nm, neomycin; nt, nucleotide(s); o, O, NADH operator; oligo, oligodeoxyribonucleotide; ONPG, o-nitrophenyl P-D-galactopyranoside; ORF, open reading frame; ori, origin(s) of DNA replication; p, plasmid; p, P, promoter; PA, polyacrylamide; PAGE, PA-gel electrophoresis; PEG, poly(ethylene glycol); pfu, plaque-forming unit(s); Pi, inorganic phosphate; Pipes, 1,4-piperazinediethanesulfonic acid; PMSF, phenylmethylsulfonyl fluoride; Pollk, Klenow (large) fragment of E. coli DNA polymerase I; PPi, inorganic pyrophosphate; PPO, 2,5-diphenyloxazole; R, (superscript) resistance/ resistant; R, purine (or restriction); RBS, ribosome-binding site(s); rDNA, DNA coding for rRNA; re-, recombinant; RFLP, restriction-fragment length polymorphism; Rif, rifampicin; RNase, ribonuclease; rRNA, ribosomal RNA; s, (superscript) sensitivity/sensitive; S, sedimentation constant; SD, Shine–Dalgarno (sequence); SDS, sodium dodecyl sulfate; Sm, streptomycin; ss, single strand(ed); SSC, 0.15 M NaCl/0.015 M Na3 citrate pH 7.6; T, thymidine; T, T, terminator of transcription; Tc, tetracycline; Th, thiostrepton; TK, thymidine kinase; TMV, tobacco mosaic virus; Tn, transposon; tsp, transcription start point(s); u, unit(s); U, uridine; URF, unidentified open reading frame; UTR, unstranslated region(s); UV, ultraviolet; wt, wild type; Xgal, 5-bromo-4-chloro-3-indolyl P-D-galactopyranoside; Y, pyrimidine; [], denotes plasmid-carrier state; (), denotes prophage (lysogenic) state; ::, novel junction (fusion or insertion); ′ (prime), denotes a truncated gene at the indicated side. ⁎ Corresponding author. E-mail addresses: [email protected], [email protected] (S.-L. Hong). 1 Nucleotide symbol combinations: Pairs: K = G/T; M = A/C; R = A/G; S = C/G; W = A/T; Y = C/T. Triples: B = C/G/T; D = A/G/T; H = A/C/T; V = A/C/G; N = A/C/G/T.

http://dx.doi.org/10.1016/j.gene.2015.06.005 0378-1119/© 2015 Elsevier B.V. All rights reserved.

90

H. Liu et al. / Gene 570 (2015) 89–94

in hearing of ≥30 dB (dB sound pressure level) affecting at least three consecutive frequencies (Stachler et al., 2012). The onset of SSNHL, which is often described as frightening by patients, typically prompts an urgent visit to a physician (Stachler et al., 2012). SSNHL is the most prevalent otologic disease worldwide. According to a review by Alexander and Harris, (2013), N 66,000 new cases of SSNHL are estimated to be reported annually in USA. This disease is often idiopathic, and because its etiology is usually unknown, empiric treatments remain predominant. SSNHL treatment options include the use of systemic and topical steroids, antiviral and rheological agents, diuretics, and other medications, hyperbaric oxygen treatment, middle ear surgery for fistula repair, and observation without other treatments (Wei et al., 2006). Among these options, steroid use is both the most common and the most effective treatment. Furthermore, for a patient facing the serious consequences of severe SSNHL, corticosteroid treatment is one of the few treatment options supported by data as showing positive efficacy, although even those are somewhat problematic (Moskowitz et al., 1984; Stokroos and Albers, 1996; Chen et al., 2003; Ghosh and Jackson, 2005; Slattery et al., 2005; Jeyakumar et al., 2006). Corticosteroids are known for their efficacy in the treatment of viral, vascular, and autoimmune diseases (ADs), Meniere's disease, and other etiologies of hearing loss in the inner ear (Norris, 1988; McCall et al., 2010). The anti-autoimmune effect of corticosteroids plays a crucial role in their efficacy, which implies that, to a certain extent, SSNHL might also constitute an autoimmune disorder (Pham et al., 2007). Fc receptor-like genes (FCRLs), which are also known as Fc receptor homologs (FCRHs), are located in the 1q21–22 region of Chromosome 1 (Davis et al., 2001, 2002). FCRL3 is predominantly expressed in the germinal centers of lymphoid organs, and it has been linked to the maturation of B cells (Davis, 2007). FCRL3 encodes a glycoprotein that belongs to the immunoglobulin receptor superfamily. Although this protein's precise function remains unknown, its cytoplasmic domain contains tyrosine-based activation and inhibition motifs, which suggests that FCRL3 plays a role in immune cell regulation (Chistiakov and Chistiakov, 2007). FCRL3 might be involved in the differentiation of B cells into auto-reactive cells, and the protein is presumed to function by modulating signal transduction through the activation/inactivation of tyrosine kinase signaling (Chistiakov and Chistiakov, 2007). Recently, FCRL3 polymorphisms have been reported to be associated with rheumatoid arthritis, systemic lupus erythematous (Kochi et al., 2005), Behcet's disease (Li et al., 2009), autoimmune thyroid disease (Simmonds et al., 2006), and multiple sclerosis (Matesanz et al., 2008; Martinez et al., 2007). Two of the polymorphisms identified in these studies feature a strong autoantibody component, whereas three others are predominately mediated by a T-cell response. In accordance with the latter finding, we have also demonstrated an association between FCRL3 polymorphisms and allergic rhinitis (Shen et al., 2014). Together, these genetic studies indicate that in ADs, critical roles are played by the lymphocyte differentiation (i.e., in lupus) and ubiquitination (i.e., in UPS) pathways. Therefore, we hypothesized that FCRL3 might be involved in SSNHL pathogenesis. However, FCRL3 SNPs that are also associated with susceptibility to SSNHL remains unknown. To address this question, we analyzed the SNPs within FCRL3 as part of a case-controlled study of SSNHL. We genotyped five FCRL3 SNPs—rs945635, rs3761959, rs7522061, rs10489678, and rs7528684—in 630 patients with SSNHL and 600 healthy controls by using a PCR–restriction fragment length polymorphism (PCR–RFLP) assay, compared the allele, genotype, and haplotype frequencies between the patients and the controls, and performed haplotype analysis by using the online software platform SHEsis. 2. Materials and methods 2.1. Ethics statement This study was conducted in accordance with the guidelines of the Declaration of Helsinki and was approved by the Ethics Committee

of the First Affiliated Hospital of Chongqing Medical University (Chongqing, China). Written informed consent was obtained from all participants prior to the start of the study. 2.2. Study participants In this study, we included 630 patients with SSNHL who were referred to us from September 2012 to August 2014. All patients were of Chinese Han ethnic origin, and all were from the city of Chongqing and its neighboring townships in southwestern China. All patients had been treated at the inpatient clinic of the Department of Otorhinolaryngology of the First Affiliated Hospital of Chongqing Medical University, Chongqing, China. SSNHL was diagnosed based on the patients' medical history and on the assessment of their symptoms against the criteria established by the NIDCD (National Institute of Deafness and Communication Disorders, 2010). For the control group, we recruited 600 healthy volunteers who were also of Chinese Han ethnicity. The clinical characteristics of the SSNHL patients and the healthy controls were assessed at the time of diagnosis and enrollment in the study (Teranishi et al., 2012; Liu et al., 2011; BMC Genetics et al., 2009), respectively, and these characteristics are summarized in Table 1. The samples with family history of deafness were excluded. 2.3. SNP selection and DNA extraction We studied five FCRL3 SNPs (rs945635, rs3761959, rs7522061, rs10489678, and rs7528684) that had previously been associated with certain immune-related diseases (Shen et al., 2014). SNP rs7528684 lies in the FCRL3 promoter region; SNPs rs945635 and rs7522061 are located in exons 2 and 4, respectively; and SNPs rs3761959 and rs10489678 are located in intronic regions (Li et al., 2008). Genomic DNA was extracted from 300 μL of EDTA-anticoagulated peripheral blood leukocytes by using the Wizard® Genomic DNA Purification Kit as per the manufacturer's instructions. The purified DNA was dissolved in 100 μL of DNA Rehydration Solution and stored at − 80 °C until further use. 2.4. Genotyping The five SNPs chosen for analysis in this study were genotyped using a PCR–RFLP assay. Amplification was performed with an initial denaturation step at 95 °C for 5 min, followed by 37 cycles each comprising a denaturation step at 95 °C for 30 s, an annealing step at 56–60 °C for 30 s, and an elongation step at 72 °C for 30 s, and a final step at 72 °C for 5 min. The PCR products were directly incubated with restriction enzymes (Table 2) for at least 4 h. The primer sequences and reaction conditions used in this study are shown in Table 2. The resulting digestion products were separated on 4% agarose gels and visualized by staining with Gold View (SBS Genentech, Beijing, China). Direct sequencing was performed on randomly selected participant DNA (20% of all samples) by Invitrogen Biotechnology Company (Guangzhou, Guangdong Province, China) to validate the method used in this study. Table 1 Clinical features and demographic characteristics in SSNHL patients and healthy controls. Characteristics

SSNHL

Control

P value

Gender (male/female) Age (mean ± SD) PTA(mean ± SD)

336/294 46.5 ± 6.8 68.58 ± 29.55

316/284 45.2 ± 8.4 10.75 ± 8.29

NS NS b0.01

Deafness type (%) Low frequency High frequency All frequency Profound deafness※

156 (24.76) 195 (30.95) 105 (16.67) 174 (27.62)

0 0 0 0

b0.01 b0.01 b0.01 b0.01

PTA (pure tone average), NS (no significance), the PTA of the type is less than 80 dB hearing level.

H. Liu et al. / Gene 570 (2015) 89–94

91

Table 2 Primers and restriction enzymes used for RFLP analysis of FCRL3 gene. rs number

Primers

Tm(°C)

Restriction enzyme

rs7528684

5′ ATAATTCTTTCTGTATTTTTCATATGGGAA 3′ 5′TTGTTATAAACACTGTGAAAAAAACACA 3′ 5′ TTATAGCCCATCTACTCACTCAGGATCA 3′ 5 CCGGGATTGAGATACAAACAGCATTT 3′ 5′ AATCAGGTAAGTTTCTCCTTCTCTCTGC 3′ 5′ GTGGATGGGATCTATTTCTATGTCCTTT 3′ 5′ TCACCAGGTGAAAATTCCACATGCAC 3′ 5′ TTTCTGCTCAATTTTCCACCCTGGTC 3′ 5′ GAGAAACTTACCTGATTGTTCTCTTCCA 3′ 5′ AAGGAGGATAAACCATTTCTGTAAGTCC 3′

58

FaqI

56

Hae III

60

MspI

60

TaqI

56

Hin 1II

rs945635 rs3761959 rs7522061 rs10489678

2.5. Statistical analysis All statistical analyses were performed using SPSS software Version 18.0 (SPSS Inc., Chicago, IL). P b 0.05 was considered statistically significant. A chi-square (χ2) test was used to determine whether the SNP genotype frequencies were in Hardy–Weinberg equilibrium (HWE), which served as an evaluation of the quality of the genotyping data. The allelic and genotypic frequencies were compared between patients with SSNHL and controls by using a χ2 test. The online software platform SHEsis (http://analysis.bio-x.cn/SHEsisMain.htm) was used for calculating the probability of obtaining a difference in the haplotype frequencies observed between patients and controls, and for analyzing the haplotype frequencies and probabilities. The associations between genotypes/alleles and the risk of SSNHL were estimated by calculating the odds ratios (ORs) and the 95% confidence intervals (CIs).

3. Results 3.1. Clinical characteristics of study participants Table 1 shows the demographics of the patients and the control participants enrolled in this study. The mean ages and gender distribution were not significantly different between the patients and the controls. The mean value of pure tone audiometry (PTA) in patients with SSNHL was 68.58 ± 29.55 dB HL (hearing level), whereas that of the

controls was 10.75 ± 8.29 dB HL. Based on the main frequency affected, the patients were divided into four SSNHL subgroups: low frequency type (156 patients, 24.76%), high frequency type (195 patients, 30.95%), all frequency type (105 patients, 16.67%), and profound deafness type (174 patients, 27.62%). 3.2. Genotype distributions of FCRL3 polymorphism Our results showed that the five FCRL3 SNPs tested—rs945635, rs3761959, rs7522061, rs10489678, and rs7528684—were in HWE in both patients and controls (P N 0.01). The genotype and allele frequencies of these five SNPs are shown in Table 3. The call rate for each of the five SNPs was 100%. We identified significant differences between the frequencies of rs7528684, rs3761959, and rs7522061 in patients with SSNHL and the control participants. The prevalence of the rs7528684 AA genotype and the A allele was significantly higher in SSNHL patients than in controls (Bonferroni-corrected P (Pc) = 8.00 × 10−5, OR = 2.13, 95% CI = 1.47–3.08; and Pc = 1.20 × 10− 5, OR = 1.80, 95% CI = 1.39–2.35, respectively). By contrast, the frequencies of the GG genotype and the G allele were significantly lower in the patients with SSNHL than in controls (Pc = 1.70 × 10− 3, OR = 0.39, 95% CI = 0.22–0.70; and Pc = 1.20 × 10−5, OR = 0.55, 95% CI = 0.43–0.72, respectively). In the case of rs3761959, a higher frequency of the AA genotype (Pc = 2.04 × 10−3, OR = 1.95, 95% CI = 1.29–2.96) and a lower frequency of the AG genotype (Pc = 9.82 × 10−3, OR = 0.62, 95%

Table 3 Frequencies of alleles and genotypes of FCRL3 polymorphisms in SSNHL patients and controls. The age and sex factors were adjusted in the multivariate logistic regression model. SNP

Genotype allele

SSNHL (%)

Controls (%)

χ2

P value

Pc*

OR (95% CI)

rs7528684

AA AG GG A G AA AG GG A G CC CT TT C T CC CG GG C G CC CT TT C T

288 (45.7) 291 (46.2) 51 (8.10) 867 (68.8) 393 (31.2) 192 (30.5) 252 (40.0) 186 (29.5) 636 (50.5) 624 (49.5) 141 (22.4) 255 (40.5) 234 (37.1) 537 (42.6) 723 (57.4) 198 (31.4) 270 (42.9) 162 (25.7) 666 (52.9) 594 (47.1) 36 (5.7) 192 (30.5) 402 (63.8) 264 (21.0) 996 (79.0)

170 (28.3) 320 (53.3) 110 (18.3) 660 (55.0) 540 (45.0) 110 (18.3) 312 (52.0) 178 (29.7) 532 (44.3) 668 (55.7) 108 (18.0) 330 (55.0) 162 (27.0) 546 (45.5) 654 (54.5) 182 (30.3) 306 (51.0) 112 (18.7) 670 (55.8) 530 (44.2) 22 (3.7) 208 (34.7) 370 (61.7) 252 (21.0) 948 (79.0)

16.30 2.52 10.68 19.75 19.75 10.18 7.14 1.21 × 10−3 3.74 3.74 1.49 10.42 5.92 0.83 0.83 0.07 3.28 3.63 2.63 2.63 1.20 0.98 0.24 3.38 × 10−4 3.38 × 10−4

5.40 × 10−5 0.11 1.08 × 10−3 9.00 × 10−6 9.00 × 10−6 1.42 × 10−3 7.54 × 10−3 0.97 0.05 0.05 0.22 1.24 × 10−3 0.01 0.36 0.36 0.79 0.07 0.06 0.11 0.11 0.27 0.32 0.62 0.99 0.99

8.00 × 10−5 0.13 1.70 × 10−3 1.20 × 10−5 1.20 × 10−5 2.04 × 10−3 9.82 × 10−3 1.00 0.61 0.61 0.27 1.70 × 10−3 0.02 0.40 0.40 0.87 0.09 0.07 0.12 0.12 0.38 0.37 0.69 1.00 1.00

2.13 [1.47–3.08] 0.75 [0.52–1.07] 0.39 [0.22–0.70] 1.80 [1.39–2.35] 0.55 [0.43–0.72] 1.95 [1.29–2.96] 0.62 [0.43–0.88] 0.99 [0.68–1.46] 1.28 [1.00–1.64] 0.78 [0.61–1.00] 1.31 [0.85–2.04] 0.56 [0.39–0.80] 1.60 [1.09–2.33] 0.89 [0.69–1.14] 1.12 [0.87–1.45] 1.05 [0.72–1.54] 0.72 [0.51–1.03] 1.51 [0.99–2.31] 1.22 [0.96–1.56] 0.82 [0.64–1.04] 1.59 [0.70–3.68] 0.83 [0.57–1.21] 1.10 [0.76–1.58] 1.00 [0.73–1.35] 1.00 [0.74–1.36]

rs3761959

rs7522061

rs945635

rs945635

92

H. Liu et al. / Gene 570 (2015) 89–94

Table 4 Haplotypes analysis of FCRL3 polymorphisms in SSNHL patients and controls. The age and sex factors were adjusted in the multivariate logistic regression model. Haplotype

SSNHL (%)

Control (%)

χ2

P value

Odds Ratio (95%CI)

AAC AAT AGC AGT GAC GAT GGC GGT

137.62 (0.109) 209.07 (0.166) 129.94 (0.103) 395.37 (0.314) 165.98 (0.132) 79.32 (0.063) 45.46 (0.036) 97.23 (0.077)

130.78 (0.109) 180.61 (0.151) 152.82 (0.127) 192.79 (0.161) 95.71 (0.080) 131.91 (0.110) 141.69 (0.118) 173.69 (0.145)

0.000 1.097 3.546 79.215 17.467 17.274 58.795 28.636

0.985 0.295 0.06 5.66 × 10−15 2.97 × 10−5 3.29 × 10−5 1.83 × 10−14 9.12 × 10−8

1.003 [0.778–1.292] 1.123 [0.904–1.395] 0.788 [0.615–1.010] 2.389 [1.966–2.902] 1.751 [1.343–2.282] 0.544 [0.407–0.727] 0.280 [0.198–0.394] 0.494 [0.380–0.642]

Haplotype analysis (All those frequency b0.03 will be ignored in analysis.) Loci chosen for hap-analysis: rs7528684, rs3761959, and rs7522061.

CI = 0.43–0.88) were found in patients with SSNHL as compared to the findings in controls. Moreover, for rs7522061, a higher frequency of the TT genotype (Pc = 0.02, OR = 1.60, 95% CI = 1.09–2.33) and a lower frequency of the CT genotype (Pc = 1.70 × 10− 3, OR = 0.56, 95% CI = 0.39–0.80) were found in patients with SSNHL as compared to the findings in controls. We observed no significant difference in the genotype and allele frequencies between the SSNHL cohort and the control group for the other two FCRL3 SNPs examined, rs945635 and rs10489678. 3.3. Haplotype analysis of FCRL3 allelic variants A haplotype analysis was performed using the Haploview V3.32 program and the SHEsis online software platform. The eight possible haplotype frequencies are shown in Table 4. The AGT and GAC haplotypes for the rs7528684, rs3761959, and rs7522061 SNPs accounted for 31.4% and 13.2% of the SSNHL patients respectively, and these were significantly higher in the patients than in controls (P = 5.66 × 10− 15, OR = 2.389, 95% CI = 1.966–2.902; P = 2.97 × 10− 5, OR = 1.751, 95% CI = 1.343–2.282; respectively). We also found that the GAT, GGC and GGT haplotypes were significantly less prevalent in SSNHL patients than in controls (P = 3.29 × 10−5, OR = 0.544, 95% CI = 0.407–0.727; P = 1.83 × 10−14, OR = 0.280, 95% CI = 0.198–0.394; and P = 9.12 × 10− 8, OR = 0.494, 95% CI = 0.380–0.642, respectively). In summary, three of the FCRL3 SNPs tested in this study (rs7528684, rs3761959, and rs7522061) were identified to be significantly associated with SSNHL patients in a Chinese Han population. Whereas the AGT and GAC haplotypes of these SNPs were associated with a significantly increased risk of SSNHL, the GAT, GGC and GGT haplotypes were associated with a notably decreased risk of SSNHL. By contrast, the genotype and allele frequencies of the other two FCRL3 SNPs, rs945635 and rs10489678, were not significantly different between the SSNHL and the control groups. 4. Discussion In this study, we investigated the association between five FCRL3 SNPs (rs945635, rs3761959, rs7522061, rs10489678, and rs7528684) and SSNHL in a Chinese Han population. The results demonstrated a significant association between three SNPs (rs7528684, rs3761959, and rs7522061) and SSNHL. In the case of rs7528684, the AA genotype and the A allele significantly increased the risk of SSNHL, but the GG genotype and the G allele decreased the risk. Conversely, the AA genotype of rs3761959 was identified as an SSNHL risk factor, but the AG genotype was found to confer protection. For rs7522061, the TT genotype significantly increased the risk of SSNHL, whereas the CT genotype decreased the risk. Lastly, although rs945635 expression was not significantly different between the two groups, a weak protective association was detected between rs945635 and SSNHL patients with the CC genotype and the G allele.

Haplotype analysis of the three significant FCRL3 SNPs—rs7528684, rs3761959, and rs7522061—revealed that the AGT and GAC haplotypes were associated with a significantly increased risk of SSNHL, whereas the GAT. GGC and GGT haplotypes were associated with a notably decreased risk of this disorder. Together, these results support an association of FCRL3 with the putative autoimmune disorder SSNHL, and this is consistent with earlier studies that suggested that SSNHL is such a disorder. However, to the best of our knowledge, this is the first study to evaluate an association between FCRL3 SNPs and SSNHL in a Chinese Han population (Chien et al., 2012). FCRL3 is a crucial genetic autoimmunity factor that functions as the mediator between the innate and adaptive immune systems. Despite thorough evaluation, the underlying cause of SSNHL is typically unknown at the time of symptom presentation (Foden et al., 2013; Stachler et al., 2012), and therefore treatment decisions are commonly made without any knowledge of disease etiology. However, corticosteroid treatment is one of the few treatment options suggested by data to show positive efficacy (Stachler et al., 2012; Moskowitz et al., 1984; Stokroos and Albers, 1996; Chen et al., 2003). Thus, autoimmunity might be involved in SSNHL pathogenesis: SSNHL might be regulated in part by the innate and adaptive immune systems. FCRL3, in turn, might confer the autoimmunity risk for SSNHL, although its exact role remains unclear. The FCRL3 rs7528684 polymorphism has been identified as a risk factor in various immune system-related diseases, including systemic lupus erythematosus (SLE); however, these findings have been inconsistent across distinct ethnicities. A recent meta-analysis (Yang et al., 2013) has shown that the TC and TT + TC genotypes of rs7528684 lower the risk of ADs as compared to the risk observed for CC carriers (OR = 0.91, 95% CI = 0.85–0.97; OR = 0.91, 95% CI = 0.85–0.98, respectively). Compared to people with the rs7528684 TC genotype, the TT + CC carriers were significantly associated with a higher risk of ADs (OR = 1.03, 95% CI = 1.00–1.07). In analyses performed using data stratified according to ethnicity and disease phenotypes, significant associations of the rs7528684 polymorphism have been identified with ADs, as well as with rheumatoid arthritis, Graves' disease, type-1 diabetes, and other ADs under different genetic models in both Asians and Europeans. The CC genotype of rs7528684 was also shown to be significantly more prevalent in Polish women with endometriosis-associated infertility than in controls (Szczepańska et al., 2013). This genotype alters the expression of FCRL3 and can serve as a risk factor in endometriosis-related infertility. Moreover, whereas the CC genotype was not determined to be a risk factor for SLE in the Polish population, this polymorphism might contribute to autoantibody production in SLE. Furthermore, rs7528684, together with rs7522061, was one of the two FCRL3 SNPs that differed notably between 645 Caucasian patients with multiple sclerosis (MS) and 786 controls, and these SNPs were shown to be in high linkage disequilibrium. The C allele of rs7528684 was also found to confer protection against MS (Simmonds et al., 2010). However, another study (Xia et al., 2010) found no significant association between rs7522061 and susceptibility to HLA-B27-positive ankylosing spondylitis, a form of inflammatory arthritis, in 169 Chinese Han patients and 184 HLA-B27-positive controls.

H. Liu et al. / Gene 570 (2015) 89–94

Despite this previously discussed case, our findings of a strong association between the FCRL3 SNPs rs7528684, rs3761959, and rs7522061 and Chinese Han patients with SSNHL are supported by other studies that have focused on the association of these SNPs with numerous ADs. This study has revealed two clinical clues related to SSNHL. First, our results identified three FCRL3 SNPs (rs7528684, rs3761959, and rs7522061) that are strongly associated with the risk of SSNHL in Chinese Han patients. Furthermore, the haplotype analysis performed here revealed that the FCRL3 haplotypes AGT, GAC, and GAT were significantly more prevalent in patients with SSNHL than in controls. Thus, we suggest that these SNPs should be chosen as tag SNPs to evaluate the high risk of developing SSNHL in the Chinese Han population. Second, our clinical data showed that the prognosis was better for two subgroups of SSNHL patients—the low and all-frequency types—than for the other subgroups, although all patients in this study received oral and/or intratympanic steroids as their primary treatment. The low and all-frequency types of SSNHL have been postulated to be potentially more strongly associated than the other subgroups with an autoimmune pathogenesis. However, the prognoses did not differ significantly among the four subgroups (P N 0.05), because the data on the patients in this study were limited. Therefore, to validate the conclusions presented here, additional studies must be conducted using a comparatively larger population base and more complete clinical information. In this study, we were careful to diminish the influence of confounding factors on the results. We selected the SSNHL patients and the controls by using strict guidelines, and confirmed the genotyping results by direct sequencing. Our analysis demonstrated a novel association between three FCRL3 SNPs (rs7528684, rs3761959, and rs7522061) and SSNHL in a Chinese Han population. However, our study has certain limitations. First, we did not determine the level of the FCRL3 protein in peripheral blood and did not perform functional analyses. Therefore, we could not draw conclusions regarding the effect of these polymorphisms on cytokine levels. Second, because of the small number of patients with SSNHL enrolled in the study, we could not reach a strong conclusion that can explain the different prognoses among the distinct subgroups. Third, in this study, we did not examine other predisposing factors such as infective and vascular factors and environmental factors that probably contribute to SSNHL pathogenesis. Extensive research on the potential contribution of multiple factors to SSNHL is therefore likely required to elucidate its etiology. In summary, we have demonstrated an association between FCRL3 gene polymorphisms and the susceptibility to SSNHL. Our results suggest that autoimmunity is involved in SSNHL pathogenesis, and that FCRL3 is a susceptibility gene for autoimmunity-mediated development of SSNHL in the Chinese Han population. However, more resourceintensive studies conducted using advanced methods such as genomewide association, together with gene–gene, gene–environment, and large-scale association studies, are required to further clarify the molecular mechanisms underlying SSNHL and the complex interactions that likely exist between FCRL3 gene polymorphisms and other predisposing factors for SSNHL. In conclusion, the results of this study provide information that can yield deep insights into SSNHL pathogenesis. Conflict of interest The authors have no conflicts of interest to declare. Acknowledgments This study was supported by a project of the National Natural Science Foundation of China (Grant No. 81170926) and by the National Key Clinic Center Construction Project ([2012]649), China. We sincerely thank Sheng-Ping Hou, Hong-Song Yu, Gang-xiang Yuan, and Qing-feng Cao (Chongqing Key Laboratory of Ophthalmology of Chongqing Medical University) for providing excellent technical support for the PCR–RFLP analysis.

93

Appendix A. Supplementary data Supplementary data to this article can be found online at http://dx. doi.org/10.1016/j.gene.2015.06.005. References Alexander, T.H., Harris, J.P., 2013. Incidence of sudden sensorineural hearing loss. Otol. Neurotol. 34 (9), 1586–1589. BMC Genetics, L., M., Kurosaki, T., Suzuki, M., Enomoto, Y., Nishimatsu, H., et al., 2009. Significance of common variants on human chromosome 8q24 in relation to the risk of prostate cancer in native Japanese men. BMC Genet. 37. Chen, C.Y., Halpin, C., Rauch, S.D., 2003. Oral steroid treatment of sudden sensorineural hearing loss: a ten year retrospective analysis. Otol. Neurotol. 24 (5), 728–733. Chien, C.Y., Chang, N.C., Tai, S.Y., Wang, L.F., Wu, M.T., Ho, K.Y., 2012. Heat shock protein 70 gene polymorphisms in sudden sensorineural hearing loss. Audiol Neurootol. 17 (6), 381–385. Chistiakov, D.A., Chistiakov, A.P., 2007. Is FCRL3 a new general autoimmunity gene? Hum. Immunol. 68 (5), 375–383. Davis, R.S., 2007. Fc receptor-like molecules. Annu. Rev. Immunol. 25, 525–560. Davis, R.S., Wang, Y.H., Kubagawa, H., Cooper, M.D., 2001. Identification of a family of Fc receptor homologs with preferential B cell expression. Proc. Natl. Acad. Sci. U. S. A. 98 (17), 9772–9777. Davis, R.S., Dennis Jr., G., Odom, M.R., Gibson, A.W., Kimberly, R.P., et al., 2002. Fc receptor homologs: newest members of a remarkably diverse Fc receptor gene family. Immunol. Rev. 190, 123–136. Foden, N., Mehta, N., Joseph, T., 2013. Sudden onset hearing loss—causes, investigations and management. Aust. Fam. Physician 42 (9), 641–644. Ghosh, A., Jackson, R., 2005. Best evidence topic report. Steroids in sudden sensorineural hearing loss. Emerg. Med. J. 22 (10), 732–733. Jeyakumar, A., Francis, D., Doerr, T., 2006. Treatment of idiopathic sudden sensorineural hearing loss. Acta Otolaryngol. 126 (7), 708–713. Kochi, Y., Yamada, R., Suzuki, A., Harley, J.B., Shirasawa, S., et al., 2005. A functional variant in FCRL3, encoding Fc receptor-like 3, is associated with rheumatoid arthritis and several autoimmunities. Nat. Genet. 37 (5), 478–485. Li, K., Zhao, M., Hou, S., Du, L., Kijlstra, A., et al., 2008. Association between polymorphisms of FCRL3, a non-HLA gene, and Behcet's disease in a Chinese population with ophthalmic manifestations. Mol. Vis. 14, 2136–2142. Li, K., Yang, P., Zhao, M., Hou, S., Du, L., et al., 2009. Polymorphisms of FCRL3 in a Chinese population with Vogt-Koyanagi-Harada (VKH) syndrome. Mol. Vis. 15, 955–961. Liu, M., Suzuki, M., Arai, T., Sawabe, M., Enomoto, Y., et al., 2011. A replication study examining three common single-nucleotide polymorphisms and the risk of prostate cancer in a Japanese population. Prostate 71 (10), 1023–1032. Martinez, A., Mas, A., de Las Heras, V., Bartolome, M., Arroyo, R., et al., 2007. FcRL3 and multiple sclerosis pathogenesis: role in autoimmunity? J. Neuroimmunol. 189 (1-2), 132–136. Matesanz, F., Fernandez, O., Milne, R.L., Fedetz, M., Leyva, L., et al., 2008. The high producer variant of the Fc-receptor like-3 (FCRL3) gene is involved in protection against multiple sclerosis. J. Neuroimmunol. 195 (1-2), 146–150. McCall, A.A., Swan, E.E., Borenstein, J.T., Sewell, W.F., Kujawa, S.G., et al., 2010. Drug delivery for treatment of inner ear disease: current state of knowledge. Ear Hear. 31 (2), 156–165. Moskowitz, D., Lee, K.J., Smith, H.W., 1984. Steroid use in idiopathic sudden sensorineural hearing loss. Laryngoscope 94 (5 Pt 1), 664–666. National Institute of Deafness and Communication Disorders., 2010. Norris, C.H., 1988. Drugs affecting the inner ear. A review of their clinical efficacy, mechanisms of action, toxicity, and place in therapy. Drugs 36 (6), 754–772. Pham, B.N., Rudic, M., Bouccara, D., Sterkers, O., Belmatoug, N., et al., 2007. Antibodies to myelin protein zero (P0) protein as markers of auto-immune inner ear diseases. Autoimmunity 40 (3), 202–207. Shen, Y., Yuan, X.D., Hu, D., Ke, X., Wang, X.Q., et al., 2014. Association between interleukin-27 gene polymorphisms and susceptibility to allergic rhinitis. Hum. Immunol. 75 (9), 991–995. Simmonds, M.J., Heward, J.M., Carr-Smith, J., Foxall, H., Franklyn, J.A., et al., 2006. Contribution of single nucleotide polymorphisms within FCRL3 and MAP3K7IP2 to the pathogenesis of Graves' disease. J. Clin. Endocrinol. Metab. 91 (3), 1056–1061. Simmonds, M.J., Brand, O.J., Barrett, J.C., Newby, P.R., Franklyn, J.A., et al., 2010. Association of Fc receptor-like 5 (FCRL5) with Graves' disease is secondary to the effect of FCRL3. Clin. Endocrinol. 73 (5), 654–660. Slattery, W.H., Fisher, L.M., Iqbal, Z., Friedman, R.A., Liu, N., 2005. Intratympanic steroid injection for treatment of idiopathic sudden hearing loss. Otolaryngol. Head Neck Surg. 133 (2), 251–259. Stachler, R.J., Chandrasekhar, S.S., Archer, S.M., Rosenfeld, R.M., Schwartz, S.R., et al., 2012. Clinical practice guideline: sudden hearing loss. Otolaryngol. Head Neck Surg. 146 (3 Suppl.), S1–S35. Stokroos, R.J., Albers, F.W., 1996. Therapy of idiopathic sudden sensorineural hearing loss. A review of the literature. Acta Otorhinolaryngol. Belg. 50 (1), 77–84. Szczepańska, M., W.P., Hołysz, H., Skrzypczak, J., Jagodziński, P.P., 2013. FCRL3-169TNC polymorphism and the risk of endometriosis-related infertility in a Polish population. Arch. Gynecol. Obstet. 288 (4). Teranishi, M., Uchida, Y., Nishio, N., Kato, K., Otake, H., et al., 2012. Polymorphisms in genes involved in oxidative stress response in patients with sudden sensorineural

94

H. Liu et al. / Gene 570 (2015) 89–94

hearing loss and Meniere's disease in a Japanese population. DNA Cell Biol. 31 (10), 1555–1562. Wei, B.P., Mubiru, S., O'Leary, S., 2006. Steroids for idiopathic sudden sensorineural hearing loss. Cochrane Database Syst. Rev. (1), Cd003998. Xia, G., Pan, F., Liao, F., Tang, X., Ge, R., Mei, Y., Pan, H., Xu, S., Xu, J., 2010. No significant association between Fc receptor-like 3 gene polymorphisms and human leukocyte

antigen-B27 positive ankylosing spondylitis in Han Chinese. Mol Biol Rep. 37 (1), 297–300. Yang, Y., Su, X., Zhang, K., Zhou, R., 2013. The Fc receptor-like 3 gene polymorphisms and susceptibility to autoimmune diseases: an updated meta-analysis. Autoimmunity 46 (8), 547–558.