- Email: [email protected]
Feasibility study of a pilot-scale sewage treatment system combining an up-flow anaerobic sludge blanket (UASB) and an aerated fixed bed (AFB) reactor at ambient temperature
Bioresource Technology 98 (2007) 177–182
Feasibility study of a pilot-scale sewage treatment system combining an up-flow anaerobic sludge blanket (UASB) and an aerated fixed bed (AFB) reactor at ambient temperature Haruhiko Sumino a,*, Masanobu Takahashi b, Takashi Yamaguchi b,c, Kenichi Abe d, Nobuo Araki d, Shinichi Yamazaki e, Satoshi Shimozaki f, Akihiro Nagano g, Naomichi Nishio b,h a Department of Civil Engineering, Gifu National College of Technology, 2236-2, Kamimakuwa, Motosu, Gifu, 501-0495, Japan Hiroshima Prefectural Institute of Industrial Science of Technology, 3-10-32, Kagamiyama Higashi-hiroshima, Hiroshima, 739-0046, Japan c Department of Civil Engineering, Kure National College of Technology, 2-2-11, Aga-minami, Kure, Hiroshima, 737-8506, Japan d Department of Civil Engineering, Nagaoka National College of Technology, 888, Nishi-katagai, Nagaoka, Nigata, 940-8532, Japan e Department of Civil Engineering, Kochi National College of Technology, 200-1, Monobe-otsu, Nangoku, Kochi, 783-8508, Japan New Product and Business Planning Office, Kotobuki Engineering & Manufacturing Co., Ltd., 1-2-43, Hiro-shirotake, Kure, Hiroshima, 737-0144, Japan g Technical Environmental Systems Division, Sanki Engineering Co., Ltd., 1-4-1, Yuraku-cho, Chiyoda, Tokyo, 100-8484, Japan h Department of Molecular Biotechnology, Hiroshima University Graduate School of Advanced Sciences of Matter, 1-3-2, Kagamiyama Higashi-hiroshima, Hiroshima, 739-8511, Japan b
f
Received 6 June 2005; received in revised form 10 October 2005; accepted 17 October 2005
Abstract A feasibility test of a 17 m3-pilot-scale sewage treatment system was carried out by continuous feeding of raw municipal sewage under ambient temperature conditions. The system consisted of a UASB and an aerated fixed bed reactor. Some of the effluent from the fixed bed reactor was returned to the UASB influent in order to provide a sulfate source. The total BOD of 148–162 mg l1 in the influent was reduced to a more desirable 11–25 mg l1 in the final effluent. The levels of methane-producing activity from acetate and H2/CO2 gas at 10 °C were only 2% and 0% of those at 35 °C, respectively. On the other hand, the sulfate-reducing activity levels of the UASB sludge were relatively high at 10 °C, for example, 18% for acetate and 9% for H2/CO2 gas, compared to the activity levels at 35 °C. Therefore, BOD oxidization by sulfate reduction in the UASB was greater than that by methane production under low temperature conditions. This sulfate-reducing activity tended to be proportional to the copy number of adenosine-5 0 -phosphosulfate (APS) reductase genes in DNA extracted from the sludge. Ó 2006 Elsevier Ltd. All rights reserved. Keywords: Domestic sewage; Pilot-scale UASB; Aerated fixed bed; Sulfate-reducing activity; apsA gene
1. Introduction In regions with a hot climate where conditions were suboptimal for the growth of anaerobic bacteria, UASB technology representing one kind of anaerobic treatment was already being applied at a full-scale plant for sewage treat-
*
Corresponding author.
0960-8524/$ - see front matter Ó 2006 Elsevier Ltd. All rights reserved. doi:10.1016/j.biortech.2005.10.020
ment (Schellinkhout, 1993; Chernicharo and Borges, 1997; Seghezzo et al., 1998; Florencio et al., 2001). Unfortunately, the performance by the UASB was COD removal of 60–80% alone, and raised difficulties in the compliance of effluents with environmental discharge standards, and so an investigation of appropriate post-treatment units was initiated (Tilche et al., 1996; Chernicharo and Nascimento, 2001; Chernicharo et al., 2001; Foresti, 2001). A DHS (Down-flow Hanging Sponge) reactor was developed
178
H. Sumino et al. / Bioresource Technology 98 (2007) 177–182
2. Methods
follows: sewage was passed through a grid chamber, pre-treated by a denitrification (DN) reactor and a UASB. The UASB effluent was post-treated by an AFB reactor under aerobic conditions, and subsequently became the final effluent after passing through the settle tank. A pipeline was used for the system for recirculation from the bottom portion of the settle tank to the influent point of the DN reactor (i.e., the influent point for sewage), from where the effluent of the AFB reactor containing accumulating SS was returned. For phosphorus removal, a pump was used for injection into PAC in the AFB reactor. The total volume of the reactor was 17.0 m3 and the volumes of the tanks were: DN 1.40 m3; UASB 8.40 m3; AFB 4.32 m3; settle 2.88 m3. The media used in the DN reactor and the AFB reactor were sponge sheets fixed to both surfaces of the boards, oriented vertically. Each sheet was flat and its total thickness of each side was 10 mm and 5 mm. The cage volume was 21% of the DN tank volume and 13% of the AFB tank volume. The AFB reactor was aerated from all over the bottom. Mesophilic granular sludge (volume, 3.9 m3) from a food wastewater treatment plant was used as the inoculum sludge in the UASB. Activated sludge (0.1 m3) from a sewage treatment plant was used as the inoculum sludge in the AFB reactor. The system was installed at a municipal sewage treatment plant site in Higashi-Hiroshima, Hiroshima, Japan, Its operations were started in June 2003 under ambient temperature conditions. The influent underwent composite sampling for a day, and effluents from the UASB, AFB, recirculated water and final effluent were spot-sampled between 9 and 10 O’clock.
2.1. Experimental setup
2.2. Vial activity batch test of UASB sludge
The schematic diagram of the experimental apparatus is shown in Fig. 1. Configuration and treatment flow were as
The specific methane-producing activity (MPA) and sulfate-reducing activity (SRA) of retained sludge in UASB were measured. The sludge was taken from a reactor height of 1.0 m (top height, 5.0 m). The activity test was performed according to Yamaguchi et al. (1997) using acetate solution (2000 mg COD l1 in the vial) or H2/CO2 gas (in a ratio of 80/20%, 1.4 atm). In the SRA test, sodium sulfate solution (final concentration 200 mg S l1) and chloroform solution (final concentration, 5 mg l1) were added to the SRA test vials to stop methane production.
by Harada and his research group at Nagaoka University of Technology, Japan, for the aerobic post-treatment of the UASB effluent, and reached a level adequate to satisfy discharge environmental standards at a hydraulic retention time (HRT) of only 1.5 h from the effluent of the full-scale UASB in India (Ministry of Environment and Forests, Government of India, 2004; Uemura, 2004). In recent years, research on anaerobic treatment for application for psychrophilic and raw sewage was advanced. Previous reports described removal of organic matter because of increased up-flow velocity and enhanced substrate-biomass contact at temperatures below 20 °C (Zeeman et al., 1997; Anthony et al., 1998; Elimitwalli et al., 2001, 2002a,b). But the quality level of these effluents was only moderate, and so the standard requirements for discharge could not be achieved in these effluents. We focused on the sulfur redox reaction for organic removal, in particular when investigating under psychrophilic conditions (Yamaguchi et al., 2003; Yamazaki et al., 2004; Bungo et al., 2004; Sumino et al., 2004). We also found effective equipment for removing organic matter with sulfate-reducing bacteria. On this basis, the feasibility of this study was evaluated. Bacteria contributed to the sulfur redox reaction for a sewage treatment system for novel wastewater treatment that activates the sulfur-redox reaction. The actual sewage was supplied in a continuous feeding experiment, using a system combining UASB and an aerated fixed bed (AFB) reactor.
Raw sewage
PAC
P 2
3
4
Effluent
Recirculation line
1
2.3. Estimation of sulfate-reducing bacteria by APS reductase genes
1 Denitrification: 1.40 m3 2.8 H × 0.5 L × 1.0 W Media: sponge board 2 UASB: 8.40 m3 5.0 H ×1.2 L × 1.4 W
P 3 Aerated Fixed Bed: 4.32 m3 3.0 H ×1.2 L × 1.2 W Media: sponge board 4 Sedimentation: 2.88 m3 Surface: 1.44 m 2
H, height; L, length; W, width (m) Fig. 1. Diagram of the sewage treatment process.
Using sludge similar to that used in the SRA determination, PCR amplification of adenosine-5 0 -phosphosulfate (APS) reductase genes were performed. The apsA gene, a subunit of APS reductase, in the DNA extracted by the bead-beater method (Miller et al., 1999) was amplified by PCR. Using the APS7F-8R primer set (Friedrich, 2002), a hot start at 95 °C lasting for 7 min was followed by 25 cycles of denaturing for 45 s at 45 °C, annealing at 57 °C for 50 s, and extension at 72 °C for 2 min., but a further
H. Sumino et al. / Bioresource Technology 98 (2007) 177–182
extension step was also carried out for 3 min at 72 °C. PCR products were electrophoresed on agarose gel and band strength was determined by image analysis (EDAS290, Kodak). 3. Results and discussion 3.1. Reactor performance Fig. 2 shows the course of reactor operation for more than 300 days, with the daily average, maximum and minimum sewage temperatures, the HRT and the recirculation ratio. Table 1 presents the sequence of APS7F-8R primers. Table 2 presents the composition of sewage and effluent from each reactor during part of each of three seasons. The mean temperature of the sewage was 27.1 °C in the summer, and this gradually decreased to 9.7 °C in the winter. The HRT was fixed at 24 h throughout the experiment. The recirculation ratio (recirculation flow/influent flow) was 2 for days 0–183, 0.3 for days 184–272, and 1 for days 273–318. The time courses of the total COD in the sewage, the UASB effluent and the final effluent are given in Fig. 3. The total COD and soluble COD in the effluent exhibited stable, low levels after one month. The mean total CODs in the final effluent were 54, 66 and 65 mg l1 in the summer, autumn and winter, respectively, while the mean total BODs were 11, 18 and 25 mg l1 for the corresponding periods. After day 250, the sludge was frequently washed out of the UASB. Then, the COD in the final effluent decreased, and the excess sludge was drawn out from the
20
highest average lowest
10 0 30
HRT (hr)
UASB, the AFB reactor and the settle tank. The volume of sludge drawn out (89,000 g SS) was 10% of the overall SS (the difference between the total influent SS and the total effluent SS) in the system. The time course of sulfide concentrations in the UASB effluent is given in Fig. 4. When the recirculation ratio was 2.0 for days 0–183, the sulfide concentration in the UASB effluent was generally less than 10 mg S l1. MPA and SRA were measured at day 165, when both showed
Table 2 Overview of process performance Season
Summer
Autumn
Winter
Days Temp. (°C) HRT (h) Recirc. ratio Total BOD (mg l1)
Sewage UASB eff. AFB eff. Final eff.
46–76 27.1 (1.2) 24.5 (2.6) 2.0 (0.0) 148 (32) 39 (9) 28 (26) 11 (5)
107–137 21.4 (1.7) 24.0 (0.1) 2.0 (0.0) 131 (15) 46 (4) 33 (4) 18 (3)
184–229 9.7 (2.1) 24.4 (2.9) 0.3 (0.1) 162 (33) 92 (10) 63 (11) 25 (5)
Soluble BOD (mg l1)
Sewage UASB eff. AFB eff. Final eff.
31 (3) 21 (5) 8 (10) 5 (2)
29 (6) 18 (2) 6 (2) 8 (3)
46 (24) 52 (10) 6 (1) 7 (1)
Total CODcr (mg l1)
Sewage UASB eff. AFB eff. Final eff.
324 (73) 103 (25) 96 (73) 54 (14)
316 (24) 107 (7) 109 (8) 66 (12)
354 (67) 173 (17) 168 (41) 65 (8)
Soluble CODcr (mg l1)
Sewage UASB eff. AFB eff. Final eff.
70 57 43 39
69 52 35 39
77 96 29 29
SS (mg l1)
Sewage UASB eff. AFB eff. Final eff.
168 (57) 26 (8) 39 (32) 10 (6)
158 (22) 37 (6) 52 (5) 15 (4)
175 (28) 47 (15) 107 (35) 32 (11)
1 SO2 4 (mg S l )
Sewage UASB eff. AFB eff. Final eff.
72 48 68 64
61 62 63 59
130 (49) 80 (34) 128 (77) 102 (23)
Sulfide (mg S l1)
UASB eff. Final eff.
9 (5) 0
6 (2) 0
24 (7) 0
T–N (mg N l1)
Sewage Final eff.
38 (6) 30 (6)
46 (5) 39 (11)
48 (7) 43 (5)
T–P (mg P l1)
Sewage Final eff.
5 (3) 3 (0)
3 (0) 2 (0)
4 (0) 1 (0)
30
3
20
Recirc. ratio
HRT
10
2 1
0
0 0
100
200 Time (days)
Recirc. ratio (–)
Sewage temp. (°C)
40
300
Fig. 2. Time course of sewage temperature, HRT and recirculation ratio.
179
Sewage
(7) (11) (21) (7)
(25) (22) (21) (32)
(6) (3) (3) (5)
(24) (24) (22) (21)
( ): standard deviation.
Table 1 Primers used for PCR amplification in this study Primer
Sequence (5 0 -3 0 )a
Primer blinding siteb
References
APS7F APSR8R
GGGYCTKTCCGCYATCAAYAC GCACATGTCGAGGAAGTCTTC
206–236 1139–1159
Friedrich (2002) Friedrich (2002)
a b
D, not C; K, G or T; R, G or A; S, C or G; Y, C or T. Positions of the Desulfovibrio-vulgaris ApsA and DsrAB open reading frame.
(20) (13) (4) (4)
180
H. Sumino et al. / Bioresource Technology 98 (2007) 177–182
Total COD (mg l-1)
800 Sewage UASB effluent Final effluent
600 400
200 0 0
100
200 Time (days)
300
Fig. 3. Time course of total COD concentration.
60
Sulfide (mgS l-1)
50
3.2. Batch testing of UASB sludge vial activity
UASB effluent
40 30 20 10 0 0
100
200
When the recirculation ratio was changed to 1.0, the UASB continued to produce sulfide. The sulfide produced was oxidized to sulfate again in the AFB reactor and no sulfide was detected, except in the UASB effluent. In a continuous feeding experiment, this system stably eliminated organic matter, despite the temperature fluctuation with the seasons. In low UASB temperature conditions, such as in winter, sulfate reduction was found to be an effective technique for removing organic matter. When PAC was injected into the AFB reactor on days 169–245, the additional volume of PAC was adjusted with Al/P (Moller ratio) = 1–2, and the total phosphorus concentration in the final effluent was below 1 mg P l1. Although it was summer, nitrogen removal was only 20%, and because there was little nitrification in the AFB reactor, the mean nitrate and nitrite concentrations in the AFB effluent were 4 mg N l1.
300
Time (days) Fig. 4. Time course of Sulfide concentration.
low values (detailed results in Section 3.2, below). The recirculation ratio was changed to 0.3 at day 184, and immediately the sulfide in the UASB effluent increased markedly. In the winter, the mean sulfide concentration was 24 mg S l1. The recirculation ratio was changed to 1.0 on day 273 because the sulfate reduction was stable.
Fig. 5 presents the changes at 35 °C in the MPA and SRA of retained sludge in the UASB. MPA was greater than SRA at seed and on day 79. Acetate and H2/CO2 were used as test substrates. UASB sludge kept MPA from seeding through a sub-tropical climate. A decrease of influent temperature then followed, and at day 165, MPA had decreased to 20% of the seeding day level for acetate, and to 16% of the seeding day level for H2/CO2 gas. At day 165, SRA was increased to 140% and 120% for acetate and H2/CO2 gas for seeding, respectively, and SRA/MPA was 0.58 and 0.41 for them for the correspondingly indicating that the contribution of organic matter removal to sulfate reduction was high. Table 3 presents the MPA and SRA of sludge retained in the UASB at 35 °C and 10 °C on day 236. The test at 10 °C was conducted in order to simulate an actual seasonal temperature. In the 35 °C test, MPA was higher than the SRA tested with substrates of acetate and H2/CO2. In 0.15
SRA (g COD g VSS-1 day )
Seed
Seed
-1
-1
MPA (g COD g VSS-1 day )
1.5
Day 79 1.0
Day 165 Day 236
0.5
Day 79 0.10
Day 236
0.05
0.00
0.0 Acetate Test substrate
H2/CO2
Day 165
0.0 00 Acetate
H2/CO2
Test substrate
Fig. 5. Changes in methane-producing activity (MPA) and sulfate-reducing activity (SRA) of sludge retained in the UASB reactor. The activities were determined by vial test at 35 °C with acetate and H2/CO2 gas as test substrates.
H. Sumino et al. / Bioresource Technology 98 (2007) 177–182
181
Table 3 Methane-producing activity (MPA) and sulfate-reducing activity (SRA) of sludge retained in UASB reactor, was measured at each temperature (35 and 10 °C) on day 236
Acetate H2/CO2
MPA (g COD g VSS1day1)
SRA (g COD g VSS1day1)
35 °C
10 °C
Remainder (%)
35 °C
10 °C
Remainder (%)
0.223 0.252
0.005 0.000
2 0
0.017 0.094
0.003 0.008
18 9
the 10 °C test, the MPA and SRA levels were similar to those when acetate was used as substrate; but MPA was not detectable and SRA remained low when H2/CO2 was used as the substrate. MPA was relatively low at 10 °C (for example, 2% and 0% for acetate and H2/CO2, respectively), whereas SRA was relatively high at 10 °C (e.g., 18% for acetate and 9% for H2/CO2) compared with its activity at 35 °C. Consequently, in comparison with MPA, SRA seemed not to be significantly affected by temperature decreases. The performance of conventional anaerobic wastewater treatment was poor when hydrogen produced from the degradation of organic matter was not consumed. In the UASB, the alternatives to methane-producing bacteria as the hydrogen scavenger were sulfate-reducing bacteria, which could be used even if the reactor temperature decreased. Therefore, the MPA, when acetate was used as the substrate, did not fall to zero, and, therefore, acetate-consuming methanogens (Tagawa et al., 2000) also remained. The sludge could be observed as granular in form. Sludge retained in the UASB was feasibly maintained in granular form, under conditions of low organic concentration, without temperature control and over a long period. 3.3. Estimation of the sulfate-reducing bacteria using APS reductase genes In sludge similar to that used for SRA determination, it was not possible to estimate sulfate-reducing bacteria by fluorescence in situ hybridization (FISH), because of the abundance of impurities such as crystals in the actual original sewage sample. Therefore, DNA was extracted from the sludge retained in the UASB in an attempt to quantify the apsA gene for sulfate-reducing bacteria. All sulfatereducing bacteria had the apsA reductase gene, and it was estimated that various sulfate-reducing bacteria could be detected. Fig. 6 shows a photograph of the electrophoresis of the products of PCR amplification by the APS7F8R primer set used that was peculiar to apsA gene. For PCR, the amount of DNA template was the same for each sample, and the number of PCR cycles used to prevent the amplification from reaching a plateau was 25. The function of APS7F-8R was the specific amplification of the apsA gene extracted from UASB sludge DNA to obtain an amplification fragment of approximately 900 bp, which was consistent with the theoretical size. Subsequently, the amount of apsA gene extracted from the DNA (copies/ng of DNA) was determined by image analysis of the electro-
Fig. 6. PCR amplification of apsA gene of sludge retained in the UASB reactor.
Ratio of apsA gene abundance (%)
Substrate
120 100 80 60 40 20 0 Seed Day 79
Day 165
Day 236
Fig. 7. Changes in apsA gene abundance in total DNA extracted from the UASB sludge.
phoresis band obtained. Fig. 7 presents the changes in the ratio of the apsA gene, with that of seed as 100%. The amount of apsA gene decreased for a while on day 79, and had later increased gradually. These changes were the same as were seen with SRA, and it was presumed that the sulfate-reducing bacteria had decreased because the methane-producing bacteria were effective for the hightemperature period in the reactor (e.g., at day 79). On days 165 and 236, sulfate-reducing bacteria had increased because of the decrease in the MPA. Monitoring of the apsA reductase gene of sulfate-reducing bacteria will indicate the sulfate-reducing potential of UASB. 4. Conclusions A sewage treatment system combining a UASB and an AFB reactor receiving sewage was operated for over 300
182
H. Sumino et al. / Bioresource Technology 98 (2007) 177–182
days. The following conclusions were drawn from the experiment. (1) The mean total CODs in the final effluent were 54, 66 and 65 mg l1 in the summer, autumn, and winter with mean total BODs as 11, 18 and 25 mg l1 for the corresponding periods respectively. (2) When the test temperature was 10 °C, MPA and SRA were at levels similar to those when acetate was used as substrate. MPA was not detectable, and SRA was 0.008 g COD g VSS1 day1 with H2/CO2 as substrate. In the UASB at a low temperature, the alternative to methane-producing bacteria as hydrogen scavengers were sulfate-reducing bacteria, and hence, only a small amount of MPA was obtained with acetate as substrate, as a result of which it was presumed that acetate-consuming methanogen, the predominant species of granule, were conserved. (3) SRA tended to be proportional to the copy number of adenosine-5 0 -phosphosulfate (APS) reductase genes in the DNA extracted from the sludge. Monitoring of the apsA reductase gene of sulfate-reducing bacteria could be used as an indicator of the sulfatereducing potential of UASB. Acknowledgements This work was supported by the Nishio Project of Hiroshima Prefectural Institute of Industrial Science and Technology. We thank Yoshiharu Kuramoto, Yoshihisa Bungo and all staff of this project for their help. References Anthony, G.C., Thomas, L.T., Srinivas, K., Lin, H., Spyros, G.P., 1998. Anaerobic treatment of low-strength domestic wastewater using an anaerobic expanded bed reactor. Journal of Environmental Engineering (July), 652–659. Bungo, Y., Yamamoto, T., Ono, S., Yamaguchi, T., Sumino, H., Nagano, A., Araki, N., Yamazaki, S., Harada, H., 2004. Low strength wastewater treatment under low temperature condition by the novel sulfur redox action process consisting of an UASB and aerobic reactor. In: Proceeding 10th International Conference on Anaerobic Digestion, vol. 4, pp. 2326–2525. Chernicharo, C.A.L., Borges, J.M., 1997. Evaluation and start up of a full scale UASB reactor treating domestic sewage. Case study In: Proceeding 8th International conference on Anaerobic Digestion, vol. 2, pp. 192–199. Chernicharo, C.A.L., Nascimento, M.C.P., 2001. Feasibility of a pilotscale UASB/trickling filter system for domestic sewage treatment. Water Science and Technology 44 (4), 221–228. Chernicharo, C.A.L., da Silveira Cota, R., Zerbini, A.M., von Sperling, M., Novy Castro Brito, L.H., 2001. Post-treatment of anaerobic effluents in an overland flow system. Water Science and Technology 44 (4), 229–236. Elimitwalli, T., Zeeman, G., Lettinga, G., 2001. Anaerobic treatment of domestic sewage at low temperature. Water Science and Technology 44 (4), 33–40.
Elimitwalli, T., Oahn, K.L.T., Zeeman, G., Lettinga, G., 2002a. Treatment of domestic sewage in a two-step anaerobic filter/anaerobic hybrid system at low temperature. Water Research 36, 2225–2232. Elimitwalli, T., Sklyar, V., Zeeman, G., Lettinga, G., 2002b. Low temperature pre-treatment of domestic sewage in an anaerobic filter reactor. Bioresource Technology 82, 233–239. Florencio, M.L., Kato, T., Cardoso de Morais, J., 2001. Domestic sewage treatment in full-scale UASBB plant at Mangueira, Recife, Pernambuco. Water Science and Technology 44 (4), 71–77. Foresti, E., 2001. Perspectives on anaerobic treatment in developing countries. Water Science and Technology 44 (8), 141–148. Friedrich, M.W., 2002. Phylogenetic analysis reveals multiple lateral transfers of adenosine-5 0 -phosphate reductase genes among sulfatereducing microorganisms. Journal of Bacteriology 184, 278–289. Miller, D.N., Bryant, J.E., Madsen, E.L., Ghiorse, W.C., 1999. Evaluation and optimization of DNA extraction and purification procedures for soil and sediment samples. Applied and Environmental Microbiology 65, 4715–4724. Ministry of Environment and Forests, Government of India, 2004. Annual Report 2002–2003, Chapter No. 6, Regeneration and Development. Available from:. Schellinkhout, A., 1993. UASB technology for sewage treatment: experience with a full scale plant and its applicability in Egypt. Water Science and Technology 27 (9), 173–180. Seghezzo, L., Zeeman, G., van Lier, J.B., Hamelers, H.V.M., Lettinga, G., 1998. A review: the anaerobic treatment of sewage in UASB and EGSB reactors. Bioresource Technology 65, 175–190. Sumino, H., Bungo, Y., Yamaguchi, T., Nagano, A., Araki, N., Yamazaki, S., Harada, H., 2004. Development of novel wastewater treatment process by activated sulfur-redox action at low temperature. In: Proceeding 10th International Conference on Anaerobic Digestion, vol. 3, pp. 1517–1520. Tagawa, T., Sekiguchi, Y., Araki, N., Ohashi, A., Harada, H., 2000. Quantification of methanogen cell density in anaerobic granular sludge consortia by fluorescence in-situ hybridization. Water Science and Technology 42 (3–4), 77–82. Tilche, A., Bortone, G., Garuti, G., Malaspina, F., 1996. Post-treatments of anaerobic effluents. Antonie van Leeuwenhoek 69, 47–59. Uemura, S. 2004. Performance of DHS-Biotower in Karnal, India. The International Seminar of ‘‘Wastewater Treatment Appropriate Technology—The Time for Action’’, organized by PUSKLIM (Pusat Teknologi Tepat Guna Pengolahan Limbah Cair), 24–25 August, Yogyakarta, Indonesia. Yamaguchi, T., Harada, H., Tseng, I.-C., 1997. Competitive exclusion of methane-producing bacteria by sulfate-reducing bacteria in anaerobic degradation of long chain fatty acid. In: Proceedings of the 8th International Conference on Anaerobic Digestion, vol. 2, pp. 362–370. Yamaguchi, T., Sumino, H., Tanigawa, D., Okazaki, Y., Araki, N., Yamazaki, S., Harada, H., 2003. Ecological significance of sulfatereducing bacteria and sulfur-oxidizing bacteria in sulfur redox reactors system treating domestic wastewater. In: Proceedings of IWA AsiaPacific Regional Conference, ASIAN, WATERQUAL, 80. Yamazaki, S., Yamaguchi, T., Araki, N., Sumino, H., Harada, H., 2004. Simultaneous removal of organic and nitrogen by a combined system of UASB reactor and aerobic biofilm reactor. In: Proceeding of the 21st Century’s COE First Symposium on Global Renaissance by Green Energy Revolution, Nagaoka, Japan, p. 135. Zeeman, G., Sanders, W.T.M., Wang, K.Y., Lettinga, G., 1997. Anaerobic treatment of complex wastewater and waste activated sludge— application of an upflow anaerobic solid removal (UASR) reactor for the removal and pre-hydrolysis of suspended COD. Water Science and Technology 35 (10), 121–128.
Feasibility study of a pilot-scale sewage treatment system combining an up-flow anaerobic sludge blanket (UASB) and an aerated fixed bed (AFB) reactor at ambient temperature Haruhiko Sumino a,*, Masanobu Takahashi b, Takashi Yamaguchi b,c, Kenichi Abe d, Nobuo Araki d, Shinichi Yamazaki e, Satoshi Shimozaki f, Akihiro Nagano g, Naomichi Nishio b,h a Department of Civil Engineering, Gifu National College of Technology, 2236-2, Kamimakuwa, Motosu, Gifu, 501-0495, Japan Hiroshima Prefectural Institute of Industrial Science of Technology, 3-10-32, Kagamiyama Higashi-hiroshima, Hiroshima, 739-0046, Japan c Department of Civil Engineering, Kure National College of Technology, 2-2-11, Aga-minami, Kure, Hiroshima, 737-8506, Japan d Department of Civil Engineering, Nagaoka National College of Technology, 888, Nishi-katagai, Nagaoka, Nigata, 940-8532, Japan e Department of Civil Engineering, Kochi National College of Technology, 200-1, Monobe-otsu, Nangoku, Kochi, 783-8508, Japan New Product and Business Planning Office, Kotobuki Engineering & Manufacturing Co., Ltd., 1-2-43, Hiro-shirotake, Kure, Hiroshima, 737-0144, Japan g Technical Environmental Systems Division, Sanki Engineering Co., Ltd., 1-4-1, Yuraku-cho, Chiyoda, Tokyo, 100-8484, Japan h Department of Molecular Biotechnology, Hiroshima University Graduate School of Advanced Sciences of Matter, 1-3-2, Kagamiyama Higashi-hiroshima, Hiroshima, 739-8511, Japan b
f
Received 6 June 2005; received in revised form 10 October 2005; accepted 17 October 2005
Abstract A feasibility test of a 17 m3-pilot-scale sewage treatment system was carried out by continuous feeding of raw municipal sewage under ambient temperature conditions. The system consisted of a UASB and an aerated fixed bed reactor. Some of the effluent from the fixed bed reactor was returned to the UASB influent in order to provide a sulfate source. The total BOD of 148–162 mg l1 in the influent was reduced to a more desirable 11–25 mg l1 in the final effluent. The levels of methane-producing activity from acetate and H2/CO2 gas at 10 °C were only 2% and 0% of those at 35 °C, respectively. On the other hand, the sulfate-reducing activity levels of the UASB sludge were relatively high at 10 °C, for example, 18% for acetate and 9% for H2/CO2 gas, compared to the activity levels at 35 °C. Therefore, BOD oxidization by sulfate reduction in the UASB was greater than that by methane production under low temperature conditions. This sulfate-reducing activity tended to be proportional to the copy number of adenosine-5 0 -phosphosulfate (APS) reductase genes in DNA extracted from the sludge. Ó 2006 Elsevier Ltd. All rights reserved. Keywords: Domestic sewage; Pilot-scale UASB; Aerated fixed bed; Sulfate-reducing activity; apsA gene
1. Introduction In regions with a hot climate where conditions were suboptimal for the growth of anaerobic bacteria, UASB technology representing one kind of anaerobic treatment was already being applied at a full-scale plant for sewage treat-
*
Corresponding author.
0960-8524/$ - see front matter Ó 2006 Elsevier Ltd. All rights reserved. doi:10.1016/j.biortech.2005.10.020
ment (Schellinkhout, 1993; Chernicharo and Borges, 1997; Seghezzo et al., 1998; Florencio et al., 2001). Unfortunately, the performance by the UASB was COD removal of 60–80% alone, and raised difficulties in the compliance of effluents with environmental discharge standards, and so an investigation of appropriate post-treatment units was initiated (Tilche et al., 1996; Chernicharo and Nascimento, 2001; Chernicharo et al., 2001; Foresti, 2001). A DHS (Down-flow Hanging Sponge) reactor was developed
178
H. Sumino et al. / Bioresource Technology 98 (2007) 177–182
2. Methods
follows: sewage was passed through a grid chamber, pre-treated by a denitrification (DN) reactor and a UASB. The UASB effluent was post-treated by an AFB reactor under aerobic conditions, and subsequently became the final effluent after passing through the settle tank. A pipeline was used for the system for recirculation from the bottom portion of the settle tank to the influent point of the DN reactor (i.e., the influent point for sewage), from where the effluent of the AFB reactor containing accumulating SS was returned. For phosphorus removal, a pump was used for injection into PAC in the AFB reactor. The total volume of the reactor was 17.0 m3 and the volumes of the tanks were: DN 1.40 m3; UASB 8.40 m3; AFB 4.32 m3; settle 2.88 m3. The media used in the DN reactor and the AFB reactor were sponge sheets fixed to both surfaces of the boards, oriented vertically. Each sheet was flat and its total thickness of each side was 10 mm and 5 mm. The cage volume was 21% of the DN tank volume and 13% of the AFB tank volume. The AFB reactor was aerated from all over the bottom. Mesophilic granular sludge (volume, 3.9 m3) from a food wastewater treatment plant was used as the inoculum sludge in the UASB. Activated sludge (0.1 m3) from a sewage treatment plant was used as the inoculum sludge in the AFB reactor. The system was installed at a municipal sewage treatment plant site in Higashi-Hiroshima, Hiroshima, Japan, Its operations were started in June 2003 under ambient temperature conditions. The influent underwent composite sampling for a day, and effluents from the UASB, AFB, recirculated water and final effluent were spot-sampled between 9 and 10 O’clock.
2.1. Experimental setup
2.2. Vial activity batch test of UASB sludge
The schematic diagram of the experimental apparatus is shown in Fig. 1. Configuration and treatment flow were as
The specific methane-producing activity (MPA) and sulfate-reducing activity (SRA) of retained sludge in UASB were measured. The sludge was taken from a reactor height of 1.0 m (top height, 5.0 m). The activity test was performed according to Yamaguchi et al. (1997) using acetate solution (2000 mg COD l1 in the vial) or H2/CO2 gas (in a ratio of 80/20%, 1.4 atm). In the SRA test, sodium sulfate solution (final concentration 200 mg S l1) and chloroform solution (final concentration, 5 mg l1) were added to the SRA test vials to stop methane production.
by Harada and his research group at Nagaoka University of Technology, Japan, for the aerobic post-treatment of the UASB effluent, and reached a level adequate to satisfy discharge environmental standards at a hydraulic retention time (HRT) of only 1.5 h from the effluent of the full-scale UASB in India (Ministry of Environment and Forests, Government of India, 2004; Uemura, 2004). In recent years, research on anaerobic treatment for application for psychrophilic and raw sewage was advanced. Previous reports described removal of organic matter because of increased up-flow velocity and enhanced substrate-biomass contact at temperatures below 20 °C (Zeeman et al., 1997; Anthony et al., 1998; Elimitwalli et al., 2001, 2002a,b). But the quality level of these effluents was only moderate, and so the standard requirements for discharge could not be achieved in these effluents. We focused on the sulfur redox reaction for organic removal, in particular when investigating under psychrophilic conditions (Yamaguchi et al., 2003; Yamazaki et al., 2004; Bungo et al., 2004; Sumino et al., 2004). We also found effective equipment for removing organic matter with sulfate-reducing bacteria. On this basis, the feasibility of this study was evaluated. Bacteria contributed to the sulfur redox reaction for a sewage treatment system for novel wastewater treatment that activates the sulfur-redox reaction. The actual sewage was supplied in a continuous feeding experiment, using a system combining UASB and an aerated fixed bed (AFB) reactor.
Raw sewage
PAC
P 2
3
4
Effluent
Recirculation line
1
2.3. Estimation of sulfate-reducing bacteria by APS reductase genes
1 Denitrification: 1.40 m3 2.8 H × 0.5 L × 1.0 W Media: sponge board 2 UASB: 8.40 m3 5.0 H ×1.2 L × 1.4 W
P 3 Aerated Fixed Bed: 4.32 m3 3.0 H ×1.2 L × 1.2 W Media: sponge board 4 Sedimentation: 2.88 m3 Surface: 1.44 m 2
H, height; L, length; W, width (m) Fig. 1. Diagram of the sewage treatment process.
Using sludge similar to that used in the SRA determination, PCR amplification of adenosine-5 0 -phosphosulfate (APS) reductase genes were performed. The apsA gene, a subunit of APS reductase, in the DNA extracted by the bead-beater method (Miller et al., 1999) was amplified by PCR. Using the APS7F-8R primer set (Friedrich, 2002), a hot start at 95 °C lasting for 7 min was followed by 25 cycles of denaturing for 45 s at 45 °C, annealing at 57 °C for 50 s, and extension at 72 °C for 2 min., but a further
H. Sumino et al. / Bioresource Technology 98 (2007) 177–182
extension step was also carried out for 3 min at 72 °C. PCR products were electrophoresed on agarose gel and band strength was determined by image analysis (EDAS290, Kodak). 3. Results and discussion 3.1. Reactor performance Fig. 2 shows the course of reactor operation for more than 300 days, with the daily average, maximum and minimum sewage temperatures, the HRT and the recirculation ratio. Table 1 presents the sequence of APS7F-8R primers. Table 2 presents the composition of sewage and effluent from each reactor during part of each of three seasons. The mean temperature of the sewage was 27.1 °C in the summer, and this gradually decreased to 9.7 °C in the winter. The HRT was fixed at 24 h throughout the experiment. The recirculation ratio (recirculation flow/influent flow) was 2 for days 0–183, 0.3 for days 184–272, and 1 for days 273–318. The time courses of the total COD in the sewage, the UASB effluent and the final effluent are given in Fig. 3. The total COD and soluble COD in the effluent exhibited stable, low levels after one month. The mean total CODs in the final effluent were 54, 66 and 65 mg l1 in the summer, autumn and winter, respectively, while the mean total BODs were 11, 18 and 25 mg l1 for the corresponding periods. After day 250, the sludge was frequently washed out of the UASB. Then, the COD in the final effluent decreased, and the excess sludge was drawn out from the
20
highest average lowest
10 0 30
HRT (hr)
UASB, the AFB reactor and the settle tank. The volume of sludge drawn out (89,000 g SS) was 10% of the overall SS (the difference between the total influent SS and the total effluent SS) in the system. The time course of sulfide concentrations in the UASB effluent is given in Fig. 4. When the recirculation ratio was 2.0 for days 0–183, the sulfide concentration in the UASB effluent was generally less than 10 mg S l1. MPA and SRA were measured at day 165, when both showed
Table 2 Overview of process performance Season
Summer
Autumn
Winter
Days Temp. (°C) HRT (h) Recirc. ratio Total BOD (mg l1)
Sewage UASB eff. AFB eff. Final eff.
46–76 27.1 (1.2) 24.5 (2.6) 2.0 (0.0) 148 (32) 39 (9) 28 (26) 11 (5)
107–137 21.4 (1.7) 24.0 (0.1) 2.0 (0.0) 131 (15) 46 (4) 33 (4) 18 (3)
184–229 9.7 (2.1) 24.4 (2.9) 0.3 (0.1) 162 (33) 92 (10) 63 (11) 25 (5)
Soluble BOD (mg l1)
Sewage UASB eff. AFB eff. Final eff.
31 (3) 21 (5) 8 (10) 5 (2)
29 (6) 18 (2) 6 (2) 8 (3)
46 (24) 52 (10) 6 (1) 7 (1)
Total CODcr (mg l1)
Sewage UASB eff. AFB eff. Final eff.
324 (73) 103 (25) 96 (73) 54 (14)
316 (24) 107 (7) 109 (8) 66 (12)
354 (67) 173 (17) 168 (41) 65 (8)
Soluble CODcr (mg l1)
Sewage UASB eff. AFB eff. Final eff.
70 57 43 39
69 52 35 39
77 96 29 29
SS (mg l1)
Sewage UASB eff. AFB eff. Final eff.
168 (57) 26 (8) 39 (32) 10 (6)
158 (22) 37 (6) 52 (5) 15 (4)
175 (28) 47 (15) 107 (35) 32 (11)
1 SO2 4 (mg S l )
Sewage UASB eff. AFB eff. Final eff.
72 48 68 64
61 62 63 59
130 (49) 80 (34) 128 (77) 102 (23)
Sulfide (mg S l1)
UASB eff. Final eff.
9 (5) 0
6 (2) 0
24 (7) 0
T–N (mg N l1)
Sewage Final eff.
38 (6) 30 (6)
46 (5) 39 (11)
48 (7) 43 (5)
T–P (mg P l1)
Sewage Final eff.
5 (3) 3 (0)
3 (0) 2 (0)
4 (0) 1 (0)
30
3
20
Recirc. ratio
HRT
10
2 1
0
0 0
100
200 Time (days)
Recirc. ratio (–)
Sewage temp. (°C)
40
300
Fig. 2. Time course of sewage temperature, HRT and recirculation ratio.
179
Sewage
(7) (11) (21) (7)
(25) (22) (21) (32)
(6) (3) (3) (5)
(24) (24) (22) (21)
( ): standard deviation.
Table 1 Primers used for PCR amplification in this study Primer
Sequence (5 0 -3 0 )a
Primer blinding siteb
References
APS7F APSR8R
GGGYCTKTCCGCYATCAAYAC GCACATGTCGAGGAAGTCTTC
206–236 1139–1159
Friedrich (2002) Friedrich (2002)
a b
D, not C; K, G or T; R, G or A; S, C or G; Y, C or T. Positions of the Desulfovibrio-vulgaris ApsA and DsrAB open reading frame.
(20) (13) (4) (4)
180
H. Sumino et al. / Bioresource Technology 98 (2007) 177–182
Total COD (mg l-1)
800 Sewage UASB effluent Final effluent
600 400
200 0 0
100
200 Time (days)
300
Fig. 3. Time course of total COD concentration.
60
Sulfide (mgS l-1)
50
3.2. Batch testing of UASB sludge vial activity
UASB effluent
40 30 20 10 0 0
100
200
When the recirculation ratio was changed to 1.0, the UASB continued to produce sulfide. The sulfide produced was oxidized to sulfate again in the AFB reactor and no sulfide was detected, except in the UASB effluent. In a continuous feeding experiment, this system stably eliminated organic matter, despite the temperature fluctuation with the seasons. In low UASB temperature conditions, such as in winter, sulfate reduction was found to be an effective technique for removing organic matter. When PAC was injected into the AFB reactor on days 169–245, the additional volume of PAC was adjusted with Al/P (Moller ratio) = 1–2, and the total phosphorus concentration in the final effluent was below 1 mg P l1. Although it was summer, nitrogen removal was only 20%, and because there was little nitrification in the AFB reactor, the mean nitrate and nitrite concentrations in the AFB effluent were 4 mg N l1.
300
Time (days) Fig. 4. Time course of Sulfide concentration.
low values (detailed results in Section 3.2, below). The recirculation ratio was changed to 0.3 at day 184, and immediately the sulfide in the UASB effluent increased markedly. In the winter, the mean sulfide concentration was 24 mg S l1. The recirculation ratio was changed to 1.0 on day 273 because the sulfate reduction was stable.
Fig. 5 presents the changes at 35 °C in the MPA and SRA of retained sludge in the UASB. MPA was greater than SRA at seed and on day 79. Acetate and H2/CO2 were used as test substrates. UASB sludge kept MPA from seeding through a sub-tropical climate. A decrease of influent temperature then followed, and at day 165, MPA had decreased to 20% of the seeding day level for acetate, and to 16% of the seeding day level for H2/CO2 gas. At day 165, SRA was increased to 140% and 120% for acetate and H2/CO2 gas for seeding, respectively, and SRA/MPA was 0.58 and 0.41 for them for the correspondingly indicating that the contribution of organic matter removal to sulfate reduction was high. Table 3 presents the MPA and SRA of sludge retained in the UASB at 35 °C and 10 °C on day 236. The test at 10 °C was conducted in order to simulate an actual seasonal temperature. In the 35 °C test, MPA was higher than the SRA tested with substrates of acetate and H2/CO2. In 0.15
SRA (g COD g VSS-1 day )
Seed
Seed
-1
-1
MPA (g COD g VSS-1 day )
1.5
Day 79 1.0
Day 165 Day 236
0.5
Day 79 0.10
Day 236
0.05
0.00
0.0 Acetate Test substrate
H2/CO2
Day 165
0.0 00 Acetate
H2/CO2
Test substrate
Fig. 5. Changes in methane-producing activity (MPA) and sulfate-reducing activity (SRA) of sludge retained in the UASB reactor. The activities were determined by vial test at 35 °C with acetate and H2/CO2 gas as test substrates.
H. Sumino et al. / Bioresource Technology 98 (2007) 177–182
181
Table 3 Methane-producing activity (MPA) and sulfate-reducing activity (SRA) of sludge retained in UASB reactor, was measured at each temperature (35 and 10 °C) on day 236
Acetate H2/CO2
MPA (g COD g VSS1day1)
SRA (g COD g VSS1day1)
35 °C
10 °C
Remainder (%)
35 °C
10 °C
Remainder (%)
0.223 0.252
0.005 0.000
2 0
0.017 0.094
0.003 0.008
18 9
the 10 °C test, the MPA and SRA levels were similar to those when acetate was used as substrate; but MPA was not detectable and SRA remained low when H2/CO2 was used as the substrate. MPA was relatively low at 10 °C (for example, 2% and 0% for acetate and H2/CO2, respectively), whereas SRA was relatively high at 10 °C (e.g., 18% for acetate and 9% for H2/CO2) compared with its activity at 35 °C. Consequently, in comparison with MPA, SRA seemed not to be significantly affected by temperature decreases. The performance of conventional anaerobic wastewater treatment was poor when hydrogen produced from the degradation of organic matter was not consumed. In the UASB, the alternatives to methane-producing bacteria as the hydrogen scavenger were sulfate-reducing bacteria, which could be used even if the reactor temperature decreased. Therefore, the MPA, when acetate was used as the substrate, did not fall to zero, and, therefore, acetate-consuming methanogens (Tagawa et al., 2000) also remained. The sludge could be observed as granular in form. Sludge retained in the UASB was feasibly maintained in granular form, under conditions of low organic concentration, without temperature control and over a long period. 3.3. Estimation of the sulfate-reducing bacteria using APS reductase genes In sludge similar to that used for SRA determination, it was not possible to estimate sulfate-reducing bacteria by fluorescence in situ hybridization (FISH), because of the abundance of impurities such as crystals in the actual original sewage sample. Therefore, DNA was extracted from the sludge retained in the UASB in an attempt to quantify the apsA gene for sulfate-reducing bacteria. All sulfatereducing bacteria had the apsA reductase gene, and it was estimated that various sulfate-reducing bacteria could be detected. Fig. 6 shows a photograph of the electrophoresis of the products of PCR amplification by the APS7F8R primer set used that was peculiar to apsA gene. For PCR, the amount of DNA template was the same for each sample, and the number of PCR cycles used to prevent the amplification from reaching a plateau was 25. The function of APS7F-8R was the specific amplification of the apsA gene extracted from UASB sludge DNA to obtain an amplification fragment of approximately 900 bp, which was consistent with the theoretical size. Subsequently, the amount of apsA gene extracted from the DNA (copies/ng of DNA) was determined by image analysis of the electro-
Fig. 6. PCR amplification of apsA gene of sludge retained in the UASB reactor.
Ratio of apsA gene abundance (%)
Substrate
120 100 80 60 40 20 0 Seed Day 79
Day 165
Day 236
Fig. 7. Changes in apsA gene abundance in total DNA extracted from the UASB sludge.
phoresis band obtained. Fig. 7 presents the changes in the ratio of the apsA gene, with that of seed as 100%. The amount of apsA gene decreased for a while on day 79, and had later increased gradually. These changes were the same as were seen with SRA, and it was presumed that the sulfate-reducing bacteria had decreased because the methane-producing bacteria were effective for the hightemperature period in the reactor (e.g., at day 79). On days 165 and 236, sulfate-reducing bacteria had increased because of the decrease in the MPA. Monitoring of the apsA reductase gene of sulfate-reducing bacteria will indicate the sulfate-reducing potential of UASB. 4. Conclusions A sewage treatment system combining a UASB and an AFB reactor receiving sewage was operated for over 300
182
H. Sumino et al. / Bioresource Technology 98 (2007) 177–182
days. The following conclusions were drawn from the experiment. (1) The mean total CODs in the final effluent were 54, 66 and 65 mg l1 in the summer, autumn, and winter with mean total BODs as 11, 18 and 25 mg l1 for the corresponding periods respectively. (2) When the test temperature was 10 °C, MPA and SRA were at levels similar to those when acetate was used as substrate. MPA was not detectable, and SRA was 0.008 g COD g VSS1 day1 with H2/CO2 as substrate. In the UASB at a low temperature, the alternative to methane-producing bacteria as hydrogen scavengers were sulfate-reducing bacteria, and hence, only a small amount of MPA was obtained with acetate as substrate, as a result of which it was presumed that acetate-consuming methanogen, the predominant species of granule, were conserved. (3) SRA tended to be proportional to the copy number of adenosine-5 0 -phosphosulfate (APS) reductase genes in the DNA extracted from the sludge. Monitoring of the apsA reductase gene of sulfate-reducing bacteria could be used as an indicator of the sulfatereducing potential of UASB. Acknowledgements This work was supported by the Nishio Project of Hiroshima Prefectural Institute of Industrial Science and Technology. We thank Yoshiharu Kuramoto, Yoshihisa Bungo and all staff of this project for their help. References Anthony, G.C., Thomas, L.T., Srinivas, K., Lin, H., Spyros, G.P., 1998. Anaerobic treatment of low-strength domestic wastewater using an anaerobic expanded bed reactor. Journal of Environmental Engineering (July), 652–659. Bungo, Y., Yamamoto, T., Ono, S., Yamaguchi, T., Sumino, H., Nagano, A., Araki, N., Yamazaki, S., Harada, H., 2004. Low strength wastewater treatment under low temperature condition by the novel sulfur redox action process consisting of an UASB and aerobic reactor. In: Proceeding 10th International Conference on Anaerobic Digestion, vol. 4, pp. 2326–2525. Chernicharo, C.A.L., Borges, J.M., 1997. Evaluation and start up of a full scale UASB reactor treating domestic sewage. Case study In: Proceeding 8th International conference on Anaerobic Digestion, vol. 2, pp. 192–199. Chernicharo, C.A.L., Nascimento, M.C.P., 2001. Feasibility of a pilotscale UASB/trickling filter system for domestic sewage treatment. Water Science and Technology 44 (4), 221–228. Chernicharo, C.A.L., da Silveira Cota, R., Zerbini, A.M., von Sperling, M., Novy Castro Brito, L.H., 2001. Post-treatment of anaerobic effluents in an overland flow system. Water Science and Technology 44 (4), 229–236. Elimitwalli, T., Zeeman, G., Lettinga, G., 2001. Anaerobic treatment of domestic sewage at low temperature. Water Science and Technology 44 (4), 33–40.
Elimitwalli, T., Oahn, K.L.T., Zeeman, G., Lettinga, G., 2002a. Treatment of domestic sewage in a two-step anaerobic filter/anaerobic hybrid system at low temperature. Water Research 36, 2225–2232. Elimitwalli, T., Sklyar, V., Zeeman, G., Lettinga, G., 2002b. Low temperature pre-treatment of domestic sewage in an anaerobic filter reactor. Bioresource Technology 82, 233–239. Florencio, M.L., Kato, T., Cardoso de Morais, J., 2001. Domestic sewage treatment in full-scale UASBB plant at Mangueira, Recife, Pernambuco. Water Science and Technology 44 (4), 71–77. Foresti, E., 2001. Perspectives on anaerobic treatment in developing countries. Water Science and Technology 44 (8), 141–148. Friedrich, M.W., 2002. Phylogenetic analysis reveals multiple lateral transfers of adenosine-5 0 -phosphate reductase genes among sulfatereducing microorganisms. Journal of Bacteriology 184, 278–289. Miller, D.N., Bryant, J.E., Madsen, E.L., Ghiorse, W.C., 1999. Evaluation and optimization of DNA extraction and purification procedures for soil and sediment samples. Applied and Environmental Microbiology 65, 4715–4724. Ministry of Environment and Forests, Government of India, 2004. Annual Report 2002–2003, Chapter No. 6, Regeneration and Development. Available from: